ID: 916173042

View in Genome Browser
Species Human (GRCh38)
Location 1:162015611-162015633
Sequence CACTTCCCAATATTGGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916173040_916173042 -7 Left 916173040 1:162015595-162015617 CCTAGGAAAACAGAGGCACTTCC 0: 1
1: 0
2: 1
3: 26
4: 290
Right 916173042 1:162015611-162015633 CACTTCCCAATATTGGACCTTGG 0: 1
1: 0
2: 1
3: 8
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916173042 Original CRISPR CACTTCCCAATATTGGACCT TGG Intronic
902852309 1:19169435-19169457 AATTTCCCAATATTGGATCCTGG - Exonic
904855885 1:33498019-33498041 CAGTTTCAAATATTGGGCCTAGG + Intergenic
911877181 1:103181783-103181805 TACTTCTGAATATTGTACCTTGG + Intergenic
916173042 1:162015611-162015633 CACTTCCCAATATTGGACCTTGG + Intronic
916421446 1:164641326-164641348 CAGTTCCCACTATGGTACCTAGG + Intronic
918913436 1:190604178-190604200 CAATTCCCAGTGTTGGAGCTGGG + Intergenic
923322759 1:232852045-232852067 CACATCCCACTCTTGGCCCTAGG - Intergenic
923363004 1:233231114-233231136 CTCTTCCTAATCTAGGACCTTGG - Intronic
1063034725 10:2275441-2275463 CAATTCCCAATGTTGGAGGTTGG + Intergenic
1064842587 10:19611623-19611645 TAATTCCCAATATGGGAACTGGG - Intronic
1064899274 10:20276027-20276049 CACTTCCCAGTGTAGGACTTGGG - Intronic
1065000908 10:21336837-21336859 CACCCCACAATATTGGACTTGGG - Intergenic
1072408357 10:95176351-95176373 AACTACCCAGTGTTGGACCTGGG - Intergenic
1072849308 10:98870788-98870810 CAATTCCCAATGTTGGAGCTAGG + Intronic
1076112701 10:127873074-127873096 CACTTCCCAGTAGTAGACCTTGG - Intergenic
1078447035 11:11412186-11412208 CACTTCCCCAAAGTGTACCTAGG + Intronic
1086871404 11:92041868-92041890 TAATTCCCAATATTGGAAGTGGG + Intergenic
1089689246 11:120176677-120176699 CACTTCTCTATATTTGACCTGGG - Intronic
1090958787 11:131537478-131537500 CTCTTCCCAAGATGGCACCTGGG - Intronic
1091934126 12:4421798-4421820 CACTTCATTATATTAGACCTTGG - Intergenic
1092259886 12:6947118-6947140 CACTTCCCAACATCAGACTTTGG + Intronic
1095476883 12:42594533-42594555 CAAATCCCAATACTTGACCTGGG - Intergenic
1095514491 12:42991038-42991060 CCCTTACCAACATGGGACCTGGG - Intergenic
1095947504 12:47761919-47761941 CACTTCCTAGTATGGGACCTTGG - Intronic
1097765601 12:63523314-63523336 CCCTTCCTATTAGTGGACCTTGG - Intergenic
1097804071 12:63945780-63945802 CCCTCCCCAGTAATGGACCTTGG - Intronic
1102418578 12:112786088-112786110 TACTTCCCAGTTTGGGACCTTGG - Intronic
1109991201 13:70059955-70059977 CAATTCCCAATATTGGAGGAGGG - Intronic
1116352822 14:43887308-43887330 TAATTCCCAATATTGGAGGTGGG + Intergenic
1116647072 14:47541799-47541821 CACTTCCCAATACTGTTCTTAGG + Intronic
1118111355 14:62723861-62723883 CCATTCTCAATTTTGGACCTGGG - Intronic
1119496281 14:75082452-75082474 CACTTTCCCATATTGTGCCTGGG - Exonic
1122198217 14:100105638-100105660 CATTTCCCTTTCTTGGACCTTGG + Intronic
1124189906 15:27565624-27565646 CACTTCCCAATCCTGGAACAAGG - Intergenic
1129855159 15:78818752-78818774 CACTTCCAAATGTGGGACGTTGG - Intronic
1133553377 16:6881240-6881262 AGGTTCCCAAGATTGGACCTAGG + Intronic
1134904343 16:17967151-17967173 TAATTCCCAATATTGGAGGTAGG + Intergenic
1136475650 16:30511520-30511542 TACTTCCAGCTATTGGACCTTGG - Intronic
1137781023 16:51098019-51098041 CAACACCAAATATTGGACCTGGG - Intergenic
1138958472 16:62001024-62001046 CAGTTACCATTATTTGACCTTGG - Intronic
1139290304 16:65852316-65852338 TAATTCCCAATATTGGAGGTGGG - Intergenic
1140716939 16:77735232-77735254 TAAACCCCAATATTGGACCTGGG + Intronic
1146175209 17:30661741-30661763 TAATTCCCAATATTGGAGGTGGG - Intergenic
1146348661 17:32077775-32077797 TAATTCCCAATATTGGAGGTGGG - Intergenic
1149147459 17:53513155-53513177 CACTTGCCACTATTGTCCCTAGG + Intergenic
1149214860 17:54342344-54342366 CACTTCCTAATATTGTCCCTTGG - Intergenic
1149426227 17:56557423-56557445 CACTTCCCAATCATGGGACTCGG - Intergenic
1157737965 18:50067507-50067529 CAATCCCCAATATTGGAGATGGG + Intronic
1158162761 18:54504249-54504271 CACTTACCAATATGTGTCCTTGG + Intergenic
1158279707 18:55810595-55810617 CACTGCCCAAAAATGGAACTAGG - Intergenic
1162217397 19:9147864-9147886 TAATTCCCAATATTGGAGGTGGG + Intronic
1166752118 19:45169227-45169249 CACTTACCAGTGTGGGACCTGGG + Intronic
1168407761 19:56119942-56119964 CACTGCGCAACATGGGACCTGGG + Intronic
925991710 2:9259926-9259948 CCATTCCCAATTTTAGACCTGGG - Intronic
927136909 2:20103987-20104009 CACTTCCCCATCTAGGTCCTGGG - Intergenic
928424180 2:31164480-31164502 CACTTCCCAGTCTAGGAGCTTGG + Intergenic
928456078 2:31423719-31423741 AACTACCAAATATTTGACCTAGG - Intergenic
928488649 2:31758144-31758166 TAATTCCCAATATTGGAGGTGGG + Intergenic
930245432 2:48979022-48979044 CAATTCCCAATATTGGTCCTAGG + Intronic
933607018 2:84393859-84393881 CAGTTGCAAATATTAGACCTAGG - Intergenic
934079643 2:88456836-88456858 CAAATCCCAAAATGGGACCTGGG + Intergenic
934629180 2:95897053-95897075 CACTTCCCCATATTGAAATTGGG - Intronic
934629596 2:95902669-95902691 CACTTCCCCATATTGAAATTGGG - Intronic
934630008 2:95908285-95908307 CACTTCCCCATATTGAAATTGGG - Intronic
935431740 2:102983425-102983447 CACTTCCCAATAGTAGCCTTGGG - Intergenic
938119032 2:128620933-128620955 CACATCCCAATCTTGGATTTGGG + Intergenic
939139924 2:138342796-138342818 TAATTCCCAATATTGGAGGTGGG + Intergenic
939376538 2:141375690-141375712 AAATTCCCAATATTGCACTTTGG + Intronic
943337762 2:186639577-186639599 CACTTCCCAATAGTGGAAGGAGG - Intronic
943393817 2:187306748-187306770 TAATTCCCAATATTGGAGGTGGG - Intergenic
1168944269 20:1738657-1738679 CAATCCCCAATATTGGAGGTAGG + Intergenic
1169279800 20:4257246-4257268 CACTTCCTAATATTTTTCCTGGG - Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1173734112 20:45347741-45347763 CTCTTCCCAATACTGCACCAAGG - Intronic
1174078462 20:47954433-47954455 CACTTGCCAATCTTGGAGCTGGG - Intergenic
1176964426 21:15195587-15195609 CAATTCCATATATTGGAACTGGG - Intergenic
1177089371 21:16747970-16747992 CAGTTCCCAATGTTGGAGGTGGG + Intergenic
1177254534 21:18644064-18644086 CACTTCACAATATTCCACTTTGG + Intergenic
1181774482 22:25149574-25149596 CCCTCCCCAAGATTGGACCCTGG + Intronic
1181959268 22:26611188-26611210 CACTTACCAATAGGTGACCTTGG + Intronic
1181995213 22:26873257-26873279 CACTTCCCAGTATTGTTCATGGG - Intergenic
1184517456 22:44971476-44971498 CACTTTCCACTCTTGGACTTTGG + Intronic
955510511 3:59676105-59676127 CACTTCACAAAATTGGAGTTGGG - Intergenic
958841603 3:99211261-99211283 TAATTCCCAATATTGGAGGTGGG - Intergenic
959806852 3:110564636-110564658 CTCTTCCTAAGATAGGACCTTGG + Intergenic
967823013 3:193855736-193855758 TTCTTCCCAAAATTAGACCTTGG - Intergenic
967933639 3:194708899-194708921 CACTTACCAACAGCGGACCTTGG + Intergenic
971113099 4:23612072-23612094 TACTTCCTAATTTTGGTCCTTGG - Intergenic
974529089 4:63083431-63083453 CACCTCCCAAGTTTGAACCTAGG - Intergenic
976378529 4:84373412-84373434 AACTACCAAATATTTGACCTAGG + Intergenic
981283205 4:142984897-142984919 CAGTTCCCAATTTTCTACCTGGG + Intergenic
984817111 4:183849166-183849188 CAGTTACCAAAATTGGAGCTTGG + Intergenic
995698121 5:114902678-114902700 CCCTTCCCAACATTGGCCTTGGG - Intergenic
996042920 5:118836667-118836689 CACTTCCTAATACTATACCTCGG - Intergenic
998052437 5:139047090-139047112 CACTATACCATATTGGACCTTGG + Intronic
998599401 5:143569555-143569577 TACTATCCAATATTGGACTTTGG + Intergenic
999308844 5:150538466-150538488 CACATCCCAACATTGGGCCCTGG - Intronic
1000487328 5:161863593-161863615 TAATTCCCAATTTTGGAGCTGGG - Intronic
1002317529 5:178353149-178353171 CATTTCCCATTATTGGGCATTGG - Intronic
1002449822 5:179312309-179312331 CACTTCCTAATATATCACCTTGG - Intronic
1002696606 5:181096226-181096248 TAATTCCCAATATTGGAGGTGGG - Intergenic
1002698016 5:181103147-181103169 TAATTCCCAATATTGGAGGTGGG + Intergenic
1005113567 6:22312941-22312963 CAATTCCCAATGTTGGAGGTGGG - Intergenic
1005595005 6:27370650-27370672 CAATTCCCAATGTTGGAGGTGGG + Intergenic
1008925253 6:56885320-56885342 CACTTCTGAATATTGAACCCTGG - Intronic
1011911193 6:92441581-92441603 AACTTCCCAATATGTGAGCTAGG - Intergenic
1012021994 6:93934356-93934378 CACTTCCCTCTTTTGCACCTTGG - Intergenic
1016913406 6:149221805-149221827 CATTTCCCAACATCAGACCTGGG - Intronic
1024934266 7:54697512-54697534 CACTTCCACATATAGGACTTTGG + Intergenic
1030898128 7:115086686-115086708 ACTTTCCCAATATTTGACCTTGG - Intergenic
1031417917 7:121515400-121515422 CACTTCCTAATATATTACCTTGG + Intergenic
1034355046 7:150444972-150444994 CATTTCCCACTATAGGACCAGGG + Intergenic
1038342664 8:26700303-26700325 CACTTCCTAAGATTAGAACTAGG + Intergenic
1041222173 8:55662956-55662978 CATTTCCCAATGTGTGACCTTGG + Intergenic
1042865676 8:73355088-73355110 CATTTCCCAATTCTGGAGCTGGG + Intergenic
1046793954 8:118350249-118350271 CACTCCCTACTATGGGACCTTGG - Intronic
1048676139 8:136783369-136783391 TAATTCCCAATATTGGAAGTGGG + Intergenic
1048823709 8:138402638-138402660 CCCTTCCTACTTTTGGACCTTGG - Intronic
1050111696 9:2223326-2223348 TAATTCCCAATGTTGGACGTGGG - Intergenic
1050342022 9:4649817-4649839 CATTTCCCAATATTAACCCTGGG - Intronic
1050494750 9:6229247-6229269 CCCTTCCCAAGCTTAGACCTAGG - Intronic
1050935000 9:11385533-11385555 CATTTCCCAATGTTGGAGGTGGG + Intergenic
1051073672 9:13204541-13204563 CACTTCCCAATATTAAATCTTGG + Intronic
1052455903 9:28697993-28698015 CACTTCCAAATATTGGTAATTGG + Intergenic
1054952521 9:70868930-70868952 AACTTCTCAATATTGGATCTGGG - Intronic
1055639718 9:78310253-78310275 CACTTCCTAAAATATGACCTCGG - Intronic
1057359239 9:94358152-94358174 TTCTTCCAGATATTGGACCTAGG - Intergenic
1057648525 9:96899438-96899460 TTCTTCCAGATATTGGACCTAGG + Intronic
1059216181 9:112565466-112565488 CACTTCCCCATATCTGACATGGG - Intronic
1061827620 9:133271233-133271255 CACTTGCCATCATTTGACCTTGG + Intronic
1192067449 X:67901747-67901769 TAATTCCCAATGTTGGAGCTAGG + Intergenic
1193218584 X:78895517-78895539 AACTTCCCAAGATTGAACCAGGG - Intergenic
1199189219 X:144951020-144951042 TAATTCCCAATATTGGAGGTGGG - Intergenic