ID: 916177179

View in Genome Browser
Species Human (GRCh38)
Location 1:162052115-162052137
Sequence TATAGGCATGAGCCACCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916177173_916177179 6 Left 916177173 1:162052086-162052108 CCTGCTTCAGCTTCCCAAAGTGC 0: 151
1: 5974
2: 76451
3: 195454
4: 244960
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data
916177177_916177179 -7 Left 916177177 1:162052099-162052121 CCCAAAGTGCTGGGACTATAGGC 0: 283
1: 23563
2: 251243
3: 277439
4: 221915
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data
916177170_916177179 29 Left 916177170 1:162052063-162052085 CCAGGCTGGCCTCAAGTGATCCA 0: 12
1: 93
2: 274
3: 524
4: 1213
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data
916177171_916177179 20 Left 916177171 1:162052072-162052094 CCTCAAGTGATCCACCTGCTTCA 0: 177
1: 3755
2: 18256
3: 46408
4: 79377
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data
916177172_916177179 9 Left 916177172 1:162052083-162052105 CCACCTGCTTCAGCTTCCCAAAG 0: 88
1: 3035
2: 33610
3: 90938
4: 170360
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data
916177178_916177179 -8 Left 916177178 1:162052100-162052122 CCAAAGTGCTGGGACTATAGGCA 0: 171
1: 12268
2: 117287
3: 251795
4: 285561
Right 916177179 1:162052115-162052137 TATAGGCATGAGCCACCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916177179 Original CRISPR TATAGGCATGAGCCACCACC TGG Intergenic
No off target data available for this crispr