ID: 916180037

View in Genome Browser
Species Human (GRCh38)
Location 1:162075429-162075451
Sequence TAACCTCAGCAGGATATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916180031_916180037 28 Left 916180031 1:162075378-162075400 CCTGGCTTCATTGGTTGATGGTT 0: 1
1: 0
2: 1
3: 11
4: 148
Right 916180037 1:162075429-162075451 TAACCTCAGCAGGATATCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 128
916180033_916180037 4 Left 916180033 1:162075402-162075424 CCCTGATGTGGATTTTAGAGATT 0: 1
1: 0
2: 2
3: 14
4: 247
Right 916180037 1:162075429-162075451 TAACCTCAGCAGGATATCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 128
916180034_916180037 3 Left 916180034 1:162075403-162075425 CCTGATGTGGATTTTAGAGATTC 0: 1
1: 0
2: 0
3: 11
4: 139
Right 916180037 1:162075429-162075451 TAACCTCAGCAGGATATCTGTGG 0: 1
1: 0
2: 0
3: 4
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916180037 Original CRISPR TAACCTCAGCAGGATATCTG TGG Intronic
900583086 1:3418908-3418930 TGGCCTCAGCAGGATGTTTGAGG + Intronic
905568579 1:38986048-38986070 AAAGCTCAGCAAGAGATCTGAGG - Intergenic
911742470 1:101401620-101401642 TTTCCTCAGCAGGATACTTGAGG + Intergenic
916180037 1:162075429-162075451 TAACCTCAGCAGGATATCTGTGG + Intronic
921717784 1:218436048-218436070 TAACATTAGCAGGAGATGTGGGG - Exonic
922067675 1:222159565-222159587 TAACATCTTCTGGATATCTGTGG - Intergenic
922452834 1:225750630-225750652 TTCCCTCAGCAGGATGTTTGTGG - Intergenic
1068287443 10:54958911-54958933 TAAGCTCAGCAGTATGTCTAAGG - Intronic
1070181847 10:74021696-74021718 TAACTTCAGCAGACTAACTGAGG - Intronic
1070503496 10:77093174-77093196 TAGCCACAGCATGATTTCTGGGG + Intronic
1071772562 10:88745406-88745428 GAACCTCATCAGGCTAACTGTGG + Intronic
1077870437 11:6258234-6258256 AAACTTGAGCAGGTTATCTGAGG + Intergenic
1078121410 11:8513756-8513778 TAACCACATCAGGATAAATGGGG + Intronic
1078560074 11:12363692-12363714 TCACCTCAGCATGATAGCTGAGG - Intergenic
1084531622 11:69731043-69731065 TGTGCTCAGCAGGATCTCTGTGG - Intergenic
1090033787 11:123230638-123230660 TAACCAGGGCAGGATTTCTGGGG + Intergenic
1093419439 12:18957790-18957812 TAATCTCATCAGGATAAATGAGG + Intergenic
1097762328 12:63482108-63482130 TTTCCTCATCAGGATATCTATGG - Intergenic
1098696262 12:73559978-73560000 TAACCTCAGCAGATTATCGCAGG + Intergenic
1099915748 12:88891175-88891197 TAATCTCAATGGGATATCTGAGG - Intergenic
1100728339 12:97434738-97434760 TGAACTCATCAGCATATCTGAGG - Intergenic
1102362205 12:112297663-112297685 TAACCTCAGGAGTTTAGCTGGGG + Intronic
1104473917 12:129054798-129054820 TTATCTCAGCTGGATATATGTGG - Intergenic
1105359726 13:19697328-19697350 TAACTTCAGAAGGATGTCTGTGG + Intronic
1105383096 13:19905578-19905600 TAATTTCAGCAGGCTCTCTGGGG - Intergenic
1105743534 13:23354518-23354540 TTACCTCAGCAGAATATCCAAGG - Exonic
1113300196 13:109011161-109011183 CCACCTCAGCAAGTTATCTGAGG - Intronic
1114379496 14:22186328-22186350 TAACCTCATTGGAATATCTGAGG + Intergenic
1115646669 14:35372885-35372907 TCCCCTCATCAGGATATCAGAGG + Intergenic
1116021131 14:39462431-39462453 TAATCTCAGCAGGGTAAATGGGG + Intergenic
1116928781 14:50668994-50669016 TAACGTCAGGAGGAAATATGTGG - Intergenic
1118068787 14:62222593-62222615 GAACCTCATCAGGCTAACTGTGG - Intergenic
1122718676 14:103709999-103710021 GAACCTCAGCACGCTGTCTGTGG - Intronic
1132655620 16:1040640-1040662 GAACCTCAGCAGGACCTCGGGGG - Intergenic
1136297152 16:29310053-29310075 TAATCTGACCAGGAAATCTGTGG + Intergenic
1137678224 16:50315058-50315080 AAACCTCAGTATGACATCTGGGG + Exonic
1142058703 16:88016156-88016178 TAATCTGACCAGGAAATCTGTGG + Intronic
1142188761 16:88707414-88707436 AAACCTCATCAGGGGATCTGTGG - Intronic
1146960327 17:36969591-36969613 TAACCTAAGCAAGATGACTGGGG - Intronic
1155651762 18:28151715-28151737 TACCCTCAACAAGTTATCTGTGG + Intronic
1157242898 18:46027826-46027848 TAACCTCAGAAAGATCTTTGAGG - Intronic
1158321438 18:56268482-56268504 ACACCTCAGCAGGAGATCAGAGG + Intergenic
1159499222 18:69247683-69247705 TCAAGTCAGCAGCATATCTGAGG - Intergenic
1159505575 18:69330903-69330925 TTAACCCAGCAGGATATCAGAGG - Intergenic
1162227347 19:9234624-9234646 TAATCACATCAGGGTATCTGAGG - Intergenic
1163227306 19:15973292-15973314 AAATCCCAGCAGGATATTTGTGG - Intergenic
926979487 2:18552795-18552817 CACCCTCAGCAGTATATCAGAGG - Intergenic
930273884 2:49289018-49289040 TAACCTCAGCAGGATGTGGTTGG - Intergenic
930473270 2:51847377-51847399 TAACCTGAGCCTTATATCTGGGG + Intergenic
930921171 2:56755741-56755763 TCACCTCAACAGGCTGTCTGAGG + Intergenic
933247349 2:79990350-79990372 TAACCTCACCAGGTTTTCTGTGG + Intronic
936705294 2:115065447-115065469 CAACCTTAGCAGAAGATCTGAGG + Intronic
937503423 2:122508860-122508882 TTACCACAGGAGGATCTCTGGGG - Intergenic
942197661 2:173537792-173537814 AAACCCCAGAAGAATATCTGAGG + Intergenic
945588634 2:211699437-211699459 AAACATCAGCAGCATCTCTGAGG + Intronic
947510895 2:230753433-230753455 AAACCTCAGCAGGATTCCTTGGG - Intronic
1170365937 20:15598454-15598476 TAACCTCAGTCGGGCATCTGAGG - Intronic
1170388290 20:15844448-15844470 TTACCTCACTAGGCTATCTGGGG - Intronic
1173877379 20:46382738-46382760 TTACCTCACAAGGATGTCTGAGG - Intronic
1175839948 20:62020314-62020336 TAGCCTCAGGAGGAGAGCTGGGG - Intronic
1179486919 21:41716442-41716464 TCACATCTGCAGGATCTCTGCGG - Intergenic
1183218450 22:36496406-36496428 TAACCTGAATGGGATATCTGGGG + Intronic
1183454027 22:37911817-37911839 CAACCTCAGCAGGGTTGCTGGGG - Intronic
949313648 3:2728271-2728293 TAAGATCAGCAGCATCTCTGTGG - Intronic
952817759 3:37460494-37460516 TAACCACAGCAGGGTAAATGGGG - Intronic
953392363 3:42540924-42540946 TAATGTCTGCAGGACATCTGAGG + Intergenic
953777524 3:45833872-45833894 TACCTTGAGCAGGTTATCTGAGG - Intronic
954844873 3:53546574-53546596 TAAATGCAGCAGGATCTCTGTGG - Intronic
957513357 3:81218736-81218758 CAAACACAGCAGGATATTTGGGG - Intergenic
958011919 3:87890289-87890311 TAATCTCAGCAATATACCTGAGG + Intergenic
959354210 3:105304756-105304778 TAAGCTGAGGAGGAGATCTGTGG - Intergenic
959657504 3:108825975-108825997 TAATCTCAGTAGAATTTCTGAGG + Intronic
960225981 3:115169100-115169122 TAGCCACAGAAGCATATCTGTGG + Intergenic
960267684 3:115639486-115639508 AAACCTCACCAGGATTCCTGTGG - Intronic
961772053 3:129257262-129257284 AAACCACAGAAGTATATCTGTGG - Intronic
962621179 3:137181337-137181359 TAAACCCAGCAGCAAATCTGGGG - Intergenic
963016122 3:140825799-140825821 TAAACACATCAGGATATCTCAGG - Intergenic
963967579 3:151389892-151389914 TAACTTCAGTAAGCTATCTGAGG - Intronic
966830738 3:184006165-184006187 TTACCTCAGCCGGAGATCTCTGG + Intronic
968646507 4:1743837-1743859 TGACCTCCGCAGGACATCAGGGG + Intronic
969129624 4:4981986-4982008 CGACATCAGCAGGAGATCTGAGG + Intergenic
971677888 4:29657448-29657470 TGGCCTCTGCAGGCTATCTGTGG - Intergenic
973835117 4:54801885-54801907 TAACCACAACAAGATATCTTTGG - Intergenic
974907984 4:68080638-68080660 TAGCCTCAGCATGATTTCTCTGG - Intronic
979307112 4:119159007-119159029 TAACCACATCAGGATAAATGGGG - Intronic
980388508 4:132117583-132117605 TAACTACAGTAGCATATCTGGGG - Intergenic
981158150 4:141464397-141464419 TAAGCTCAGCAGTACATGTGTGG - Intergenic
981453269 4:144924048-144924070 TAATCTCATCAGGATAAATGGGG + Intergenic
981894675 4:149784343-149784365 TGAGCTAAGGAGGATATCTGGGG - Intergenic
994345975 5:98686938-98686960 TAACCACATCAGGATAAATGGGG - Intergenic
994508796 5:100676943-100676965 GAACCTCAGAAGAAAATCTGTGG - Intergenic
1000866704 5:166523223-166523245 CAGCCTCAGCAGGATTTCTCAGG + Intergenic
1001756991 5:174178169-174178191 GGACCACAGCAGGATCTCTGGGG + Intronic
1002351628 5:178588011-178588033 TAATCCCAGCTGGGTATCTGAGG - Intronic
1004049711 6:12064350-12064372 TAACCTCAGCAGGCTGTTTTGGG + Intronic
1007150717 6:39688191-39688213 AAACCCCAGCAGGAGATCAGAGG - Intronic
1010921901 6:81692412-81692434 GAGCCTCAGCAGGAGATCAGAGG + Intronic
1011941341 6:92847049-92847071 TATCCTCAGCAGTAAAACTGGGG + Intergenic
1013567784 6:111385300-111385322 TAACCACATCAGGATAAATGGGG - Intronic
1015936207 6:138407794-138407816 TAACCTCAGCAGCATCCATGTGG - Intronic
1016755012 6:147675369-147675391 TAACCTCAACAGGAAAGCAGAGG - Intronic
1018022752 6:159777241-159777263 TAACCTCAGTTACATATCTGTGG - Intronic
1018711958 6:166503654-166503676 TGACCTCAGCAGTATCCCTGAGG - Intronic
1021023073 7:15628540-15628562 TCACCTTAGCAGGGTATGTGGGG + Intronic
1024903351 7:54347644-54347666 GGAACTCAGCAGGATTTCTGTGG - Intergenic
1027339236 7:77188238-77188260 TAATCACACCAGGATAACTGGGG - Intronic
1029100694 7:98127753-98127775 TAACCACATCAGGGTATTTGGGG - Intronic
1030755320 7:113280830-113280852 TACCCTCAGAAAGATATCTGCGG - Intergenic
1030946408 7:115727288-115727310 GAATCTCATCAGGATATCTCGGG - Intergenic
1031089514 7:117337603-117337625 GAACCCCAGCAGAATATCCGAGG - Intergenic
1039304619 8:36248183-36248205 TCACTGCAGTAGGATATCTGTGG + Intergenic
1041150949 8:54933752-54933774 TATCATGAGCAGGATATATGAGG - Intergenic
1041569731 8:59323907-59323929 TCACCTTAGCATGATATGTGTGG + Intergenic
1042358442 8:67855070-67855092 GAGCCTCAGCAGGAGATCTCTGG + Intergenic
1043732123 8:83695628-83695650 TAATCCCAGCAGATTATCTGAGG - Intergenic
1053007634 9:34614589-34614611 TAACCTCAGCAGAAACTTTGGGG - Intronic
1053426213 9:38011885-38011907 TCACCCCAGCAGCATCTCTGGGG - Intronic
1054987422 9:71279014-71279036 TAACCTAAGCAGGATAAGTTTGG - Intronic
1055601360 9:77922437-77922459 TCCTCTCAGCAGGCTATCTGGGG - Intronic
1057406886 9:94780330-94780352 TAACCCCAGGAATATATCTGTGG + Intronic
1186363921 X:8872193-8872215 TAAAATAAGCAGCATATCTGAGG + Intergenic
1187925582 X:24247039-24247061 TAACCTCATCTGAATCTCTGTGG + Intergenic
1188239270 X:27765380-27765402 AAAATTCAGCAGGATATCAGGGG + Intergenic
1188264894 X:28060950-28060972 TAATCACATCAGGATATTTGAGG + Intergenic
1192492470 X:71588277-71588299 TAACATGATTAGGATATCTGTGG - Intronic
1193598179 X:83474291-83474313 GAACCTCAGCAGGCTAACAGTGG + Intergenic
1194773926 X:97939508-97939530 CAACACTAGCAGGATATCTGAGG + Intergenic
1196042879 X:111224784-111224806 GAAACTAAGCAGCATATCTGAGG - Intronic
1196131725 X:112164352-112164374 GAACTTCAGCAGGATGACTGTGG - Intergenic
1197019794 X:121673245-121673267 TAATCACATCAGGATATATGAGG + Intergenic
1198230583 X:134685326-134685348 TAACCTAAGCAGTAGAACTGTGG - Intronic
1198725999 X:139677523-139677545 TAAACTCAGCATGTTACCTGTGG - Intronic
1199194552 X:145012611-145012633 AAACCTCATCAGGGTACCTGCGG - Intergenic