ID: 916187530

View in Genome Browser
Species Human (GRCh38)
Location 1:162147514-162147536
Sequence CACATTATGATTCGTGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 33}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916187530 Original CRISPR CACATTATGATTCGTGTACC AGG Intronic
911645035 1:100328745-100328767 CACCTGATGTTTCCTGTACCTGG + Intergenic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
918231214 1:182534316-182534338 CACATTATTTTTCATTTACCAGG - Intronic
1064458778 10:15513118-15513140 CTCAGTATGTTTCGTATACCTGG - Intergenic
1065520143 10:26564432-26564454 CTCATTATGACTCGTGTCTCAGG - Intronic
1069103358 10:64351821-64351843 CACAATATGGTTAGTGTCCCAGG - Intergenic
1078472513 11:11602889-11602911 CCCATTTTGACTCCTGTACCTGG - Intronic
1092059106 12:5534179-5534201 CACATTATGATTTGTGGCACTGG - Intronic
1094592940 12:31838226-31838248 CACATGAGGGTTCGTGGACCAGG - Intergenic
1097011400 12:55955884-55955906 CAAATTAGGATTCCTCTACCTGG + Intronic
1100687006 12:96997467-96997489 CACATACTCATTCGAGTACCTGG + Intergenic
1101551396 12:105765693-105765715 CAAAGAATGATTCGTGTATCAGG + Intergenic
1103140436 12:118543392-118543414 CACATTATGATTTGTTTTTCAGG - Intergenic
1156317322 18:35982283-35982305 AACATTATGATGGGTTTACCAGG + Intergenic
1164128703 19:22342193-22342215 CAGATTGTGATTCATGTACTTGG + Intergenic
937706824 2:124930750-124930772 CATATTATCATTCGTGTAAGTGG - Intergenic
939636850 2:144592451-144592473 CACATTAAGATTCCTCTCCCAGG - Intergenic
1170012680 20:11743577-11743599 CACATTATGATTTCTTTACATGG - Intergenic
1177751078 21:25284616-25284638 TACATTATGATTCGTCCACAAGG - Intergenic
971432859 4:26586870-26586892 TTCATTATGATACATGTACCTGG - Intronic
978347137 4:107783204-107783226 CACATTATAATTCTTGTTCTTGG - Intergenic
981242670 4:142496721-142496743 CACATTATGTTTCCTATAGCTGG - Intronic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
997281319 5:132648725-132648747 CTCATTATGATTGGTATACTTGG - Intergenic
1001774021 5:174315343-174315365 CACCTTCTGTTTCCTGTACCCGG - Intergenic
1002525570 5:179813992-179814014 GACATTTTTATTCGTGTACTAGG - Intronic
1004021752 6:11782288-11782310 CACATCATAATTTGTGTTCCTGG + Intronic
1004330174 6:14714060-14714082 CAAATAATGATTCGTGGATCAGG + Intergenic
1011940933 6:92842300-92842322 CACATTATACTTCCTCTACCCGG + Intergenic
1013859986 6:114624147-114624169 CACAGTATGATTCATGGTCCAGG + Intergenic
1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG + Intronic
1031454372 7:121961245-121961267 CAGATTATGATCCATGTGCCTGG - Intronic
1036215892 8:6879481-6879503 CACACTATGATTCTTTGACCAGG + Intergenic
1038353588 8:26805741-26805763 CTCATCAAGATTCTTGTACCAGG - Intronic