ID: 916188330

View in Genome Browser
Species Human (GRCh38)
Location 1:162154534-162154556
Sequence CCCCTCCAGCCCTACCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916188330_916188333 -10 Left 916188330 1:162154534-162154556 CCTTCTAGGTAGGGCTGGAGGGG 0: 1
1: 0
2: 1
3: 21
4: 178
Right 916188333 1:162154547-162154569 GCTGGAGGGGCCAAAATGGATGG 0: 1
1: 0
2: 0
3: 32
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916188330 Original CRISPR CCCCTCCAGCCCTACCTAGA AGG (reversed) Intronic
900817324 1:4858543-4858565 CCACTCCAGCCATAGCTAAAAGG + Intergenic
900945230 1:5827502-5827524 CCCCTCTAACCCTGCCTAGACGG + Intergenic
901205607 1:7493979-7494001 CCCCGCTAGCCCTCCCGAGATGG - Intronic
901636097 1:10670857-10670879 CCCCTCCATCCCCTCCGAGAAGG + Intronic
901801558 1:11711269-11711291 CCCCTGCAGGCCAGCCTAGAAGG + Intronic
902059290 1:13628695-13628717 CCCATCCAGCCCATCCCAGATGG + Intergenic
902301280 1:15504569-15504591 CCCCACCAGACCCACCCAGAGGG + Intronic
902975677 1:20086483-20086505 CCCCACAAGCCCTACCCAAATGG - Intronic
905349745 1:37337295-37337317 CCCCTGCAGCCCCACTTACATGG - Intergenic
905472586 1:38204636-38204658 ACCCTCATGCCCTACCTAAATGG - Intergenic
906152771 1:43597749-43597771 CCCCTCCGCCCCTCCCCAGAAGG + Exonic
907706548 1:56837520-56837542 CTCCTGCAGCCCTCCCCAGAGGG - Intergenic
907826062 1:58017831-58017853 GTCTTCCAGCCCCACCTAGAGGG - Intronic
911184032 1:94885984-94886006 CCCCTCCACCCCCACCTCGGTGG - Intronic
911186780 1:94912407-94912429 CCACTCCATCCCCACCCAGAGGG + Intronic
914220364 1:145676130-145676152 ACCCTCCACCCCAACCTACAGGG + Intronic
914523438 1:148439124-148439146 CCACTCCAGCCCTGACTAAAAGG + Intergenic
916188330 1:162154534-162154556 CCCCTCCAGCCCTACCTAGAAGG - Intronic
917455977 1:175186408-175186430 ACCCTCAGGCCCTACCTTGAAGG + Intronic
919781256 1:201222651-201222673 CCCCTCCAGCCCTACCTTGCTGG + Intronic
921819536 1:219601444-219601466 TCTCACCAGCCCTACCTATAGGG + Intergenic
922574408 1:226652499-226652521 CCCCTCCAGCCCTCCCTTGTGGG + Intronic
922977479 1:229797752-229797774 CCCCTCCAGCCCCACAGATAAGG - Intergenic
923997259 1:239509480-239509502 CAACTCCAGCTCTACCTTGAGGG - Intronic
1063593272 10:7411608-7411630 CCCCTCCAGCCCTGCCCAAGGGG - Intergenic
1064577071 10:16757348-16757370 TCCATCCAGCCCTACCAAGAGGG + Intronic
1067440256 10:46305152-46305174 CCCCTGCACCCCCAACTAGATGG + Intronic
1070917231 10:80162630-80162652 CTCCTCCAGCCCTAACAAGGGGG + Intronic
1071503280 10:86218436-86218458 CCACTCCAACCTTTCCTAGAAGG - Intronic
1073207726 10:101777368-101777390 ACCCTCCAGCCCTACCCCCAGGG - Intronic
1075053226 10:119198759-119198781 CCCCTCCAGCCCTAGCTCCAGGG + Intergenic
1075426045 10:122342358-122342380 TCCCTCCATCCCCACCTACAAGG - Intergenic
1076112870 10:127874134-127874156 ACCCTCCACACCTACCCAGAGGG - Intergenic
1077026391 11:441821-441843 CCCCGCCAGCCCCACCTGGAAGG - Intronic
1077343966 11:2037961-2037983 CCCCTCCAGCTCTACCAAGGAGG + Intergenic
1079331316 11:19535309-19535331 CCCCTGCAGCCTTACTCAGAGGG - Intronic
1079652142 11:22942782-22942804 CCACTCCAGCCCTGACTAAAAGG - Intergenic
1081551306 11:44115014-44115036 CCCCTCCACCCCATCCCAGAAGG - Intronic
1082030128 11:47597808-47597830 CACCTCCAGGCCTACCAGGAGGG + Intergenic
1082909442 11:58353859-58353881 CCCCTCCAGCAATAGCTACAGGG - Intergenic
1083624832 11:64067130-64067152 CCCCACCAGCCCTGCCTACTTGG - Intronic
1084148002 11:67275224-67275246 CCACTGCAGCCCTTCCTGGAAGG + Intronic
1085769201 11:79309969-79309991 CACATCCAGCCCTGCCTGGAAGG - Intronic
1088884939 11:113999029-113999051 TCCCTCCACCCTTACCCAGAAGG + Intergenic
1089041517 11:115454976-115454998 CCTCTCCAGCACTTCCAAGAAGG - Intronic
1089160240 11:116431822-116431844 CACGTTCAGCCTTACCTAGAGGG + Intergenic
1089634455 11:119803456-119803478 TCCCTCCACCCCAAACTAGAGGG + Intergenic
1090886700 11:130883476-130883498 TCCCTCCAGGCCTACAAAGAGGG + Intronic
1202826952 11_KI270721v1_random:93150-93172 CCCCTCCAGCTCTACCAAGGAGG + Intergenic
1093277958 12:17152770-17152792 CCACTCCAGCCATAGCTAAAAGG - Intergenic
1097170034 12:57107590-57107612 CCCCTCCTGCCCCACCTCAAGGG + Exonic
1099214581 12:79838615-79838637 CTACTCCAGCCCTAGCTAAAAGG + Intronic
1099996674 12:89786437-89786459 CACCTCCAGCCATGGCTAGAAGG + Intergenic
1100213762 12:92426462-92426484 CCACTCCAGTCCTGCCCAGAGGG - Intronic
1100657991 12:96667553-96667575 CTGCTCCAGCCATAGCTAGAAGG - Intronic
1101583405 12:106064344-106064366 TCCCTCCAGCCCTCACTGGAAGG + Exonic
1101787039 12:107893309-107893331 CTCCTCCAGCCCTCCCAATAAGG - Intergenic
1103906591 12:124330818-124330840 CCCATCCAGCCCTTGCTATATGG - Intronic
1104013556 12:124948270-124948292 CCCCACCAGCCCCACCCAGGAGG + Intronic
1107332510 13:39316954-39316976 GCCCTCCAGCCCTTCCCAGGAGG - Intergenic
1107338750 13:39383680-39383702 GACCTCTAGCCCTACCTAAAAGG - Intronic
1110406889 13:75160773-75160795 CCTCTGCATCCCTCCCTAGAGGG + Intergenic
1111045882 13:82812684-82812706 CCACTCCAGCCATAGCTAAAAGG + Intergenic
1114921955 14:27343284-27343306 CCACTCCAGCCCTGGCTAAAAGG + Intergenic
1115307895 14:31951162-31951184 CCCCCACAGCCCCAGCTAGAGGG - Intergenic
1115968233 14:38915952-38915974 CCACTCCAGCCCTGACTAAAAGG - Intergenic
1117070741 14:52053731-52053753 AGCATCCAGCCCTACCCAGATGG - Exonic
1118468848 14:66056321-66056343 CCCCTCCTGCCCACCATAGAAGG - Intergenic
1118803147 14:69209509-69209531 CCCCTACAGCCACACCCAGAAGG - Exonic
1119123760 14:72104203-72104225 CCCCGACAGCGCCACCTAGAGGG - Intronic
1119305807 14:73607355-73607377 CCACTCCAGCCCTGGCTAAAAGG - Intergenic
1119312972 14:73665833-73665855 CACTGCCAGCCCTACATAGAAGG - Intronic
1119442393 14:74637125-74637147 CCCCTGCAGCCCTGCTTAGAGGG - Intergenic
1119460945 14:74803122-74803144 CACATCTAGCCCTGCCTAGATGG - Intronic
1120457757 14:84754409-84754431 CCACTCCAGCCATAACTAAAAGG + Intergenic
1121259208 14:92553889-92553911 CCCCTACAGCCCTGCCTTCAGGG + Intronic
1122609280 14:102970136-102970158 CCCGCCCAGCACTACCTTGAGGG + Exonic
1124013609 15:25859186-25859208 CTCCTCCAGCCCTGCCCAGCAGG + Intronic
1125437298 15:39660207-39660229 CCTCTCTAGCCTCACCTAGAAGG - Intronic
1128510837 15:68313185-68313207 CCACGCCAGCCATCCCTAGAGGG - Intronic
1128736939 15:70058710-70058732 CCCCACCAGCCCTGCCTCGGTGG - Exonic
1129117315 15:73371785-73371807 CCTTTCCAGCACTGCCTAGAAGG + Intergenic
1129426825 15:75469462-75469484 CCCATCCAGCCCTCCCTGGAGGG - Intronic
1132049061 15:98591968-98591990 CCCATACAGCCCTGCCTGGAGGG + Intergenic
1132805781 16:1774436-1774458 CCCCTCCAGCCCCGTCTACAGGG - Intronic
1133018437 16:2955485-2955507 CCCCGCCATCCCCACCTCGAGGG - Intergenic
1135023834 16:18984123-18984145 TCCCTGCCGCCCTACCTGGATGG - Exonic
1141480791 16:84305315-84305337 CGCCTCCAGCCCTCCCCAGTAGG - Intronic
1141518011 16:84559350-84559372 CCTCTCCTGCCCCACCCAGAGGG + Intergenic
1142065085 16:88057740-88057762 CCCCCCCCGCCCCACCCAGATGG - Intronic
1142854623 17:2722885-2722907 CACCCCCAGCCCAGCCTAGAAGG - Intergenic
1144085722 17:11806955-11806977 GCCCTCCAGCCCTTCCTCAAAGG - Intronic
1148075653 17:44933976-44933998 CCCCTCCAGCCTGACCTACGAGG - Exonic
1148699636 17:49579797-49579819 GCTCTCCAGCCCTGCCTAGTGGG + Exonic
1149083606 17:52687230-52687252 CTCCTACAGCTCTACTTAGAGGG - Intergenic
1149446684 17:56718636-56718658 CCTCTCCAGCCCTAGCTGGAGGG - Intergenic
1151802368 17:76385667-76385689 CCCCTACAGCCCTTCCCAGCAGG - Intronic
1152531691 17:80922783-80922805 CCCCGCCAGCCCCACCAACAAGG + Exonic
1155491403 18:26405152-26405174 CCCCACCAACCCTACCAAGGAGG - Intergenic
1156453991 18:37282610-37282632 CCACTGCATCCCTACTTAGAAGG - Intronic
1160812727 19:1019978-1020000 CCCCTCCCGCCCTCCTCAGATGG - Intronic
1161297392 19:3526783-3526805 CCCCTCCCGCCCTCTCTCGAGGG - Intronic
1163529515 19:17841598-17841620 CCCCTTCAGCCTTACCCCGAGGG - Intronic
1165617293 19:37213123-37213145 CTTCTCCAGCCCTCCCTACATGG - Intronic
1167467789 19:49659217-49659239 CCCCTCCAGCCCCACGTGGAGGG + Intergenic
1167504501 19:49863949-49863971 CCCTTCCAGCCATACCTGGAAGG + Exonic
1167692595 19:50995965-50995987 CCCATCCAGCCCTCCCCACAGGG + Intergenic
928251777 2:29687128-29687150 CCCCTGCAGACTTACCAAGAGGG - Intronic
929818918 2:45258119-45258141 CCCATCCGGACCTAGCTAGAGGG + Intergenic
930960328 2:57253072-57253094 CCACTCCAGCCCTGGCTAAAAGG + Intergenic
933268159 2:80204021-80204043 CCACTCCAGCCATAACTAAAAGG - Intronic
936258664 2:110938163-110938185 GTCCTCCAGCCCCACCTGGAAGG - Intronic
937120087 2:119434883-119434905 CCCTTACAGCCCTCCCTACATGG - Intronic
940638531 2:156326101-156326123 CCCCTCCAGAACTGCCTAGCAGG - Intronic
943303256 2:186229769-186229791 CAGCTCCAGCCCTAGCTAAAGGG + Intergenic
945428163 2:209733383-209733405 CTTCTCCAGCCGTACCTAGCTGG - Exonic
947351493 2:229250728-229250750 CCCCTCGAGTCCTACCCAGAAGG - Intronic
948787098 2:240358443-240358465 AGGCTCCAGCCCTGCCTAGACGG + Intergenic
1168808045 20:684431-684453 CCCCTACAGCCCTACTTAGCAGG - Intergenic
1169732574 20:8802166-8802188 CCCATCCAGTCCTACCTGGCCGG - Intronic
1171031264 20:21678665-21678687 CACCTCCAGCCCACCCTATAAGG - Intergenic
1171382765 20:24746024-24746046 ACCCTCCAGCTCCTCCTAGATGG + Intergenic
1172357141 20:34288087-34288109 CACCTCCATCTCTGCCTAGAAGG - Intronic
1172529711 20:35621455-35621477 CCCCTCCACCGGTACCTAGCAGG - Intergenic
1173658279 20:44715920-44715942 ACCCGCCCGCCCTAGCTAGAGGG + Intronic
1174299485 20:49571064-49571086 TCCCTTCAGCCATATCTAGAAGG - Intergenic
1175806063 20:61830046-61830068 CCCCCACAGCCCTACCTTCATGG + Intronic
1175997570 20:62818361-62818383 GCCCCCGATCCCTACCTAGAGGG - Intronic
1181002826 22:19995847-19995869 CCCCTCCACCCTTCCCTACAAGG + Intronic
1182740264 22:32562438-32562460 TCCCTCCAGGCCAACCCAGATGG - Intronic
1185335522 22:50269542-50269564 CCCCTCCAGCCCTGGCTACCCGG + Intronic
1185402482 22:50626098-50626120 CCCCACCACCCCAACCTTGATGG - Intronic
950501195 3:13365024-13365046 GCTCTCCAGCCCTCCCTGGAAGG + Intronic
951916721 3:27808756-27808778 CCACTCCAGCCCTTCCTAGTTGG - Intergenic
952350261 3:32528482-32528504 CACCTCCAGCCCCACCTGCAGGG + Exonic
953376794 3:42435587-42435609 CCCATCCAGAGCTACCTGGAGGG - Intergenic
954444063 3:50537212-50537234 CCCCTCCAGCCCTGTCCCGAAGG - Intergenic
954715334 3:52524010-52524032 CCAACCCAGCCCTACCTGGAAGG - Exonic
956539082 3:70314020-70314042 CATCTCCACCCCTACCTTGAAGG + Intergenic
958605283 3:96350483-96350505 CTCCTCCACCACCACCTAGAGGG + Intergenic
960255352 3:115505761-115505783 CTGCTCCAGCCATACCTAAATGG + Intergenic
961640733 3:128363420-128363442 CACCCCCAGCCCTGCCTATAAGG - Intronic
962740073 3:138357034-138357056 TCCCTCCAGCCATACCCAGTTGG - Intronic
963363245 3:144303372-144303394 CCACTCCAGCCATAGCTAAAAGG - Intergenic
964110148 3:153079130-153079152 CCCCTCCAGCGCTGCCTAGGGGG + Intergenic
966314840 3:178633521-178633543 CCCCTCCAGCCTTGGCTACAAGG - Intronic
967313318 3:188127133-188127155 CACCTCCAGCCCCACCTGGCAGG + Intergenic
968500808 4:949044-949066 CCGCTCCCGCCCTCCCTAGGGGG + Intronic
969646225 4:8431027-8431049 ACCCTCCAGCTCCACCAAGATGG - Intronic
971481606 4:27119675-27119697 CCCCTCCAGCCTCTCCCAGAGGG + Intergenic
972718529 4:41673349-41673371 CCTCTCCACCCCTACCCAGGGGG - Intronic
982065956 4:151654616-151654638 CCCCTCTAGATCTACCTTGAAGG + Intronic
990033638 5:51292450-51292472 TCCCTCCAGCCTCAGCTAGAAGG + Intergenic
990251504 5:53920251-53920273 ACCCTCCAACCCTACATATATGG - Intronic
997222034 5:132177326-132177348 CAGCTCCAGCTCTACTTAGATGG - Intergenic
1002194908 5:177496483-177496505 CCCCTCCAGCACTACTTTGAAGG + Exonic
1002759521 6:190951-190973 CCCCTCCCGTCCTACCTGGGAGG + Intergenic
1003226918 6:4214313-4214335 CCACTCCAGCCATAACTAAAAGG - Intergenic
1003733384 6:8850944-8850966 CTGCTCCAGACCTACCTAGTTGG - Intergenic
1003747542 6:9019945-9019967 CTCGTCCAGCCCTGCCTAAATGG - Intergenic
1005030143 6:21500921-21500943 GCCCTCCAGCCTTCCCTGGAAGG + Intergenic
1006151377 6:31991962-31991984 CCCCCCCAGCCCCACCCAGAGGG - Intronic
1006157678 6:32024700-32024722 CCCCCCCAGCCCCACCCAGAGGG - Intronic
1007703641 6:43778401-43778423 CCCAGCCAGCCATACCCAGATGG - Intronic
1007775435 6:44222229-44222251 CCCCGCCAGCCCTAACCAGAGGG - Intronic
1009292710 6:61904115-61904137 TCTCTCCAGCCCTGCCTAGAGGG + Intronic
1009772457 6:68161015-68161037 CCACTCCAGCCCTGGCTAAAAGG + Intergenic
1009945940 6:70341768-70341790 CTGCTCCAGCCATGCCTAGAAGG - Intergenic
1010183884 6:73120560-73120582 CACCTGCAGCCCTACCAAGTAGG + Exonic
1012444531 6:99294385-99294407 CCCCTCCTGCCCTAGCAGGATGG - Intronic
1018047512 6:159978534-159978556 CCTCTCCAGGCCTCCCTGGAGGG + Intronic
1018330410 6:162721525-162721547 CCCCTCCATGCCTGTCTAGAAGG + Intronic
1019283778 7:213851-213873 CCCCTCCACCCCCACCGGGACGG - Intronic
1021197305 7:17687873-17687895 CACCTCCCCCCCTCCCTAGAAGG - Intergenic
1021537677 7:21723747-21723769 CCCCTCCACCCCCAGCTACAGGG + Intronic
1026968692 7:74455052-74455074 CCCCTCCAGCACTGCCAGGAGGG - Intronic
1031642989 7:124188769-124188791 CCCCTCCAGCACTAGCAGGAGGG - Intergenic
1032196019 7:129789000-129789022 CCCCTCCAACCCTACTTCAATGG + Intergenic
1039792995 8:40890702-40890724 CCCCTCCCTCCCTACCTGGTGGG + Intronic
1040007038 8:42629486-42629508 CCCCTCCAGCAGTGCCTAGCAGG - Intergenic
1041339063 8:56822782-56822804 CCACTCCAGCCCTGACTAAAAGG + Intergenic
1044071954 8:87772054-87772076 GCCTTTCAGGCCTACCTAGAAGG - Intergenic
1049062469 8:140286746-140286768 CACCTCCAGCCCTTCCCAGCTGG - Intronic
1049348891 8:142153559-142153581 CTCCCCCAGCCCTAGCCAGAAGG - Intergenic
1049462266 8:142735661-142735683 CCCATCCATCCCCACCTTGAGGG - Exonic
1060550880 9:124484863-124484885 CCCCTCCACCCCTCCCCAAAGGG - Intronic
1061363350 9:130157483-130157505 CCCCTCCCGCCCCACCTACTAGG + Intergenic
1061993983 9:134174877-134174899 CCCCAACAGCCCTACCAAGCAGG - Intergenic
1062030391 9:134359560-134359582 CCCTTCCAGCCCTCCCCAGGCGG - Intronic
1062081077 9:134623754-134623776 CCCCTCCACCCCTGCCTAATGGG + Intergenic
1062432251 9:136531445-136531467 CACCCCCAGCCCCACCCAGACGG + Intronic
1185797714 X:2981239-2981261 CCCCTCCAGCCATGGCTAAAAGG + Intergenic
1187257329 X:17655165-17655187 CCCCTCCAGCCCGGGCAAGAGGG - Intronic
1187667418 X:21628654-21628676 CCACTCCAGCCATAACTAAAAGG - Intronic
1190700302 X:52983274-52983296 CCCCTCCAGCCTTCCCTGAAGGG + Intronic
1192549910 X:72045469-72045491 CCCCTCCACCCCTGCCACGAGGG - Intergenic
1193256501 X:79355159-79355181 CCCCTGCAGCACTGCCTAGTGGG + Intergenic
1193585655 X:83318513-83318535 CACCTCCAGCCGTAACTAAAAGG + Intergenic
1194843595 X:98775969-98775991 CCACTCCAGCCATAGCTATAAGG + Intergenic
1196313523 X:114196716-114196738 CAGCTCCAGCCCTAGCTAAAAGG - Intergenic
1199619396 X:149685995-149686017 CCCCTCCAGCCGTGTCTACAAGG + Intergenic