ID: 916190023

View in Genome Browser
Species Human (GRCh38)
Location 1:162169386-162169408
Sequence CCTCATTAGCACCCCCAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 145}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916190023 Original CRISPR CCTCATTAGCACCCCCAGCA GGG (reversed) Intronic
901705394 1:11069365-11069387 CCTCATTACCACCTCCTCCATGG - Intronic
902255396 1:15185942-15185964 CCCCATTAGAACCCCAAGCAAGG + Intronic
902878131 1:19353165-19353187 CAGCATCAGCACCCTCAGCAAGG - Intronic
906531124 1:46524660-46524682 CCCCATCTGCACCCCCAGCCAGG - Intergenic
907381839 1:54097060-54097082 CCTCATTAGTAGCCTCAGCATGG - Exonic
907998303 1:59655121-59655143 CCTCAGTAGTACCCACAGCATGG + Intronic
912680073 1:111723425-111723447 CCCCACTAGCATGCCCAGCAGGG + Exonic
915168898 1:153964011-153964033 CCTCACCAGCACCCACAACAAGG + Intronic
915479001 1:156172477-156172499 CCTCCTTTGCACCTCCAGCAAGG - Intronic
916032590 1:160891105-160891127 TCTCATAAGCAACTCCAGCAAGG + Intergenic
916190023 1:162169386-162169408 CCTCATTAGCACCCCCAGCAGGG - Intronic
916677421 1:167075600-167075622 CCTCATTGCCACCTCCACCAGGG - Intronic
917193677 1:172444445-172444467 TATCATGAGCACCCCAAGCATGG - Intronic
917460585 1:175225755-175225777 CCTCATTAGCATCCCCAGAATGG + Intergenic
921081230 1:211739787-211739809 CCTCACCCCCACCCCCAGCAGGG + Intergenic
922223617 1:223627182-223627204 CTCCATTAGCACCCTCAGCAAGG + Intronic
922518882 1:226228796-226228818 CCTCCTGAGCACCTCCAGGATGG - Intergenic
924054759 1:240114435-240114457 CTTTATGATCACCCCCAGCAGGG + Intronic
924625529 1:245694150-245694172 CCTCTTTCTCATCCCCAGCACGG + Intronic
1063284619 10:4671970-4671992 CCTCATTTCCACCCCCACCGGGG - Intergenic
1063924512 10:10964229-10964251 CCCCTTTTGCACCCTCAGCATGG + Intergenic
1065349563 10:24783269-24783291 CCTCATTACCAGGCACAGCAGGG + Intergenic
1067802754 10:49370460-49370482 CCTCATCTGCACCCCAAGCCTGG + Intronic
1072621164 10:97080365-97080387 CCTCACTAGCATCCCCAGCGGGG + Intronic
1074370736 10:112898954-112898976 CCTCATTAGTGCCCGCAGCTCGG + Intergenic
1075204582 10:120435985-120436007 TCTCATTAGCACCCTATGCATGG + Intergenic
1075414493 10:122252440-122252462 CACCGTTAGCAGCCCCAGCAGGG + Intronic
1076672436 10:132130706-132130728 CCACGTCATCACCCCCAGCATGG - Intronic
1079899265 11:26161043-26161065 CATCTTTATCACCCCCAGCATGG + Intergenic
1081991897 11:47342550-47342572 CCTCATGTGCCCCCCCAGCCAGG + Intronic
1083596848 11:63921722-63921744 CCTCTTGAGCACCCCCAGCAGGG + Intergenic
1085347585 11:75778228-75778250 CCTCATTAGAACTCCCTGCAAGG + Intronic
1088145741 11:106674840-106674862 CTTCATTAGCATCCTCTGCATGG - Intronic
1092148480 12:6231005-6231027 CCACATCTGCACCCCGAGCAGGG - Intronic
1094832264 12:34305780-34305802 CCTCCATAGCATCCCCTGCATGG + Intergenic
1095495382 12:42778828-42778850 CCTTATTACCACCACCAGCAAGG + Intergenic
1096227455 12:49875550-49875572 CAACATTTGCACCCCCAGGAGGG + Intronic
1096964279 12:55612654-55612676 CCCCCATTGCACCCCCAGCAAGG + Intergenic
1100456491 12:94756570-94756592 TCTCATTACCACTTCCAGCATGG - Intergenic
1101730875 12:107426031-107426053 CCTCCCTCCCACCCCCAGCAAGG + Intronic
1102381184 12:112468172-112468194 CCTCATTAGCATCCCTGCCAAGG + Intronic
1105205717 13:18221823-18221845 CCTCCTCTGCACCCCCTGCAGGG + Intergenic
1105246132 13:18652021-18652043 CTTAATTAGCACCAGCAGCATGG + Intergenic
1105605950 13:21926677-21926699 TCTCACCAGCACCCCCAGCCAGG - Intergenic
1106218254 13:27722106-27722128 CCTCATGAGTACCCACAGCCTGG + Intergenic
1109906431 13:68847468-68847490 GCTCATTACCACCACCAGGAAGG - Intergenic
1114282182 14:21203550-21203572 CCTCACCAACTCCCCCAGCATGG - Intergenic
1116150980 14:41142346-41142368 ACTAATTACCACACCCAGCATGG - Intergenic
1118001145 14:61525067-61525089 CCTTCTTAGCAGCTCCAGCATGG - Intronic
1118720557 14:68590878-68590900 CCTCTTTAACACCCTCACCATGG + Intronic
1119749121 14:77065066-77065088 CCTCATGTGGACCCGCAGCAGGG - Intergenic
1119916265 14:78405208-78405230 CCTCACTGGGACCCACAGCAGGG - Intronic
1121228617 14:92340217-92340239 CCTCATTAGTACCCCACCCACGG - Intronic
1121368724 14:93337706-93337728 CCTCCTTGTCACCCACAGCATGG - Intronic
1123410792 15:20057139-20057161 CCTCCTCAGCATCCCCACCATGG + Intergenic
1123520122 15:21063845-21063867 CCTCCTCAGCATCCCCACCATGG + Intergenic
1125608493 15:40955785-40955807 CCACATGAGCACTCCCCGCAGGG - Exonic
1125974516 15:43939256-43939278 CCTCATCAGCTCCCCCATCTGGG - Intronic
1127614731 15:60672627-60672649 CCTCGTTAGCTCACCCAGCTGGG - Intronic
1128144956 15:65327908-65327930 CCTCATGGGCATCCCCATCAAGG + Exonic
1130339236 15:82985409-82985431 TCTCATTACCATCCCCTGCACGG - Intronic
1131378889 15:91947791-91947813 CCTCGTTAGTACCCCCTGCTTGG + Intronic
1132311573 15:100861546-100861568 CCTCATTAACAATGCCAGCAGGG - Intergenic
1132840964 16:1978376-1978398 CCTCAAGAGCACACCCAGCACGG - Exonic
1133785828 16:8972444-8972466 ACTCATTAGGAACTCCAGCAGGG - Intergenic
1134678400 16:16106654-16106676 CCACAATAGCAGTCCCAGCAGGG + Intronic
1136748092 16:32609825-32609847 GTTCATGAGCACCACCAGCAAGG + Intergenic
1139451465 16:67030543-67030565 CCTCATCAGCACCTCCAACAAGG - Intronic
1141193216 16:81840086-81840108 CACCACTAACACCCCCAGCATGG - Intronic
1203050229 16_KI270728v1_random:869032-869054 GTTCATGAGCACCACCAGCAAGG + Intergenic
1203123403 16_KI270728v1_random:1557952-1557974 CCTCAATAGCGCCCCCACCTCGG - Intergenic
1143338601 17:6191860-6191882 CCTCACAAACACCCCCAGCCCGG + Intergenic
1147722404 17:42547217-42547239 CCTCAGCATCACCCTCAGCACGG - Intergenic
1147723590 17:42553387-42553409 CCTCAGCATCACCCTCAGCACGG - Intronic
1147823710 17:43257141-43257163 CCGCATAAGACCCCCCAGCAAGG + Intergenic
1150010055 17:61494939-61494961 CCTCACTAGTGCCCCCAGGAAGG + Intergenic
1151374910 17:73681528-73681550 CCTCATGAGCATCCCAAACATGG - Intergenic
1152247558 17:79193057-79193079 CCTCATTAGCATCTCCTGAAAGG + Intronic
1152768254 17:82152445-82152467 CCCCCTTAGCACCCCAAGCCTGG + Intronic
1154442785 18:14407645-14407667 CTTAATTAGCACCAGCAGCATGG - Intergenic
1155341011 18:24814182-24814204 CCCCATTAGAACCTCCAGAAGGG - Intergenic
1158266271 18:55664155-55664177 ACACATGAGCACCCCCAGCCAGG + Intronic
1159296462 18:66496056-66496078 CCGCATGATCTCCCCCAGCAGGG - Intergenic
1160001689 18:75030696-75030718 TCTCAGAAGCACGCCCAGCATGG - Intronic
1160160099 18:76464569-76464591 CCTCCCTGGCACCCCCAGCCTGG + Intronic
1160160134 18:76464695-76464717 CCTCCCTGGCACCCCCAGCCTGG + Intronic
1160831543 19:1106862-1106884 CCTCCATGGCACCCCCAGCCTGG - Intergenic
1161119284 19:2516634-2516656 CCTCATTCTCACCCCAAGGAAGG + Intronic
1161802782 19:6425030-6425052 CTTCATTTGCCCGCCCAGCACGG - Intergenic
1163063543 19:14776688-14776710 CCTCGCTACCACCCCCAGCGGGG + Intronic
1166986543 19:46663400-46663422 CTTCATTAACAGCCCCTGCATGG - Intergenic
1167422715 19:49413534-49413556 CCTCATTAGTAGCCGCAGCTGGG - Intronic
930396764 2:50831469-50831491 ACTCATTAGCTCCCACAGTAAGG - Intronic
933176626 2:79180860-79180882 CCTCATGACCACCCCCACCTTGG - Intergenic
936529572 2:113266500-113266522 CATCAGTAGGATCCCCAGCATGG - Intronic
938302032 2:130222703-130222725 CCTCATTAGCATGCAAAGCAGGG + Intergenic
938454668 2:131451749-131451771 CCTCATTAGCATGCAAAGCAGGG - Intergenic
945431524 2:209771489-209771511 CATCATTCTCACCTCCAGCAAGG - Intergenic
948705974 2:239792719-239792741 CCGCATTAGGACCCCTGGCAAGG - Intronic
1168870281 20:1121626-1121648 CCTTCTTATCACCCCCAGAAGGG - Intronic
1170942141 20:20857154-20857176 CCTCAGTGGCACCTCCTGCATGG - Intergenic
1172228040 20:33318235-33318257 CCTGAGTAGCTCCCACAGCAGGG - Intergenic
1173330121 20:42068846-42068868 CCTCATTATAACCCGGAGCAGGG + Intergenic
1175911741 20:62408351-62408373 CTTCATCACCACCCCTAGCATGG + Intergenic
1176453301 21:6883548-6883570 CTTAATTAGCACCAGCAGCATGG + Intergenic
1176831475 21:13748596-13748618 CTTAATTAGCACCAGCAGCATGG + Intergenic
1178304035 21:31475512-31475534 CCTCCTTTGCACCCCAAGGAAGG - Intronic
1179937990 21:44617117-44617139 CCTCCTCCACACCCCCAGCATGG + Intronic
1180760251 22:18196893-18196915 CCTCCTCTGCACCCCCTGCAGGG - Intergenic
1180770563 22:18381191-18381213 CCTCCTCTGCACCCCCTGCAGGG - Intergenic
1180775417 22:18427803-18427825 CCTCCTCTGCACCCCCTGCAGGG + Intergenic
1180808487 22:18738858-18738880 CCTCCTCTGCACCCCCTGCAGGG + Intergenic
1180828506 22:18884149-18884171 CCTCCTCTGCACCCCCTGCAGGG - Intergenic
1180984976 22:19898780-19898802 CCTCAAGAGCAGCCCCAGCCTGG - Intronic
1181071417 22:20343822-20343844 CCTCCTCTGCACCCCCTGCAGGG + Intergenic
1181194489 22:21172772-21172794 CCTCCTCTGCACCCCCTGCAGGG + Intergenic
1181214953 22:21320006-21320028 CCTCCTCTGCACCCCCTGCAGGG - Intergenic
1182740952 22:32567153-32567175 CCTCATCTCCAACCCCAGCAGGG - Intronic
1183673116 22:39284423-39284445 CATCATTAGCAGAGCCAGCAAGG - Intergenic
1184095729 22:42315285-42315307 CCTCTCCTGCACCCCCAGCATGG - Intronic
1203232398 22_KI270731v1_random:122363-122385 CCTCCTCTGCACCCCCTGCAGGG - Intergenic
950145966 3:10650028-10650050 CTTCAGTAGCACCCCAAGCCTGG - Intronic
950967365 3:17155594-17155616 CGTCAGTAGCTCCTCCAGCAGGG + Intergenic
952054369 3:29426732-29426754 GCTCTTTAGCACCCCCTTCAAGG + Intronic
953414247 3:42706424-42706446 CCTCATTGGAACCCTCTGCAGGG - Intronic
954499132 3:50993544-50993566 CCTCCTCTGCACCCCCAGCATGG + Intronic
954516500 3:51182437-51182459 ACTCAATAGCACCTCCAGGATGG - Intronic
961647723 3:128401299-128401321 CCTCACAAGCACTCACAGCAGGG - Intronic
969535693 4:7755079-7755101 CCTCCTTGCCACCCCCAGCCAGG - Intergenic
971146249 4:23979929-23979951 CCTGATTAGCAGCCCCAATAAGG - Intergenic
971460373 4:26889660-26889682 CCTCATTAGCACCTGTAGCCAGG + Intronic
974087658 4:57278567-57278589 CCTCATCAGTGCCCCCATCAGGG + Intergenic
980956126 4:139430913-139430935 CCTCACAAGAACCTCCAGCATGG + Intergenic
981073068 4:140565548-140565570 ACTCCTTAGCACCGCCTGCAAGG + Intronic
991422109 5:66452480-66452502 CCCCACTGGCATCCCCAGCATGG + Intergenic
994728053 5:103459697-103459719 CCTGAATAGCACACCCTGCAGGG - Intergenic
999719725 5:154390699-154390721 CCTCTTCAGAACCCCCACCATGG + Intronic
1000816050 5:165923055-165923077 CCTCCTTAGAACCTCCAGAAAGG + Intergenic
1001300094 5:170527151-170527173 GCTCCTAAGCAGCCCCAGCATGG + Intronic
1004035154 6:11916655-11916677 CCTCTTTAACACCCCCATCTTGG - Intergenic
1007110528 6:39310950-39310972 CCTCAGCAACACCACCAGCATGG - Exonic
1007661064 6:43486676-43486698 CCTAATTAGCATCCCTAGAAAGG + Intronic
1009931464 6:70181474-70181496 CCTCATTCCCATCCCCTGCAAGG + Intronic
1013174883 6:107668722-107668744 ACTCATTAACCCCCCCAGAAAGG + Intergenic
1019962165 7:4469888-4469910 CTCCATTAGCACAACCAGCAGGG - Intergenic
1022418268 7:30196940-30196962 CCTCATTTGCTCCCCCTTCATGG - Intergenic
1025108800 7:56195299-56195321 CCTCATTATCACCATCATCATGG + Intergenic
1029160049 7:98545054-98545076 CCTCAGTGTCACCCCCAGCAAGG + Intergenic
1029866626 7:103638308-103638330 CCTCATTAGCATCTCTAACAGGG + Intronic
1030870294 7:114747422-114747444 CCTCATTAGCACCGAGAGAATGG + Intergenic
1031944176 7:127821244-127821266 CATCATTAGAGCACCCAGCAAGG - Intronic
1032348500 7:131139067-131139089 CCTCATTATCACCCCCAACCAGG + Intronic
1033374573 7:140745664-140745686 TTTCAGTATCACCCCCAGCACGG + Intronic
1034380179 7:150685339-150685361 CCTCATTGACACCAGCAGCAGGG - Intergenic
1035557770 8:579363-579385 ACTCAGTACCACCCCCAGCACGG + Intergenic
1035882901 8:3261702-3261724 CCCCATCAGCACCCACAGAAAGG + Intronic
1045025837 8:98085710-98085732 ACTCTTTAGCACCACCTGCAGGG + Intronic
1048437777 8:134433748-134433770 TCTCATTAGCAGCCCCTGCAGGG + Intergenic
1049204771 8:141358652-141358674 CCTCATGAGGACCCCCATCCAGG - Intronic
1049426407 8:142539843-142539865 CCTCATTGCCAGTCCCAGCAGGG + Intronic
1053285928 9:36849607-36849629 CGTTATTAGCACCCACAGCCAGG + Intronic
1056830350 9:89911991-89912013 CCTCATTTCCACCTCCTGCAAGG + Intergenic
1062261568 9:135665595-135665617 CTTCCTGAGCACCCCCAGCAAGG + Intronic
1203515880 Un_GL000213v1:967-989 CTTAATTAGCACCAGCAGCATGG - Intergenic
1193762946 X:85489460-85489482 CCTCATGAACCCCCCCACCAGGG - Intergenic