ID: 916191405

View in Genome Browser
Species Human (GRCh38)
Location 1:162182064-162182086
Sequence TAGTACATGAAGAAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 498
Summary {0: 1, 1: 0, 2: 6, 3: 43, 4: 448}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916191405_916191409 -8 Left 916191405 1:162182064-162182086 CCATCTTCCTTCTTCATGTACTA 0: 1
1: 0
2: 6
3: 43
4: 448
Right 916191409 1:162182079-162182101 ATGTACTAGAGGAGGAAGCCAGG 0: 1
1: 0
2: 1
3: 11
4: 195
916191405_916191411 -2 Left 916191405 1:162182064-162182086 CCATCTTCCTTCTTCATGTACTA 0: 1
1: 0
2: 6
3: 43
4: 448
Right 916191411 1:162182085-162182107 TAGAGGAGGAAGCCAGGGTCTGG 0: 1
1: 1
2: 4
3: 48
4: 429
916191405_916191413 24 Left 916191405 1:162182064-162182086 CCATCTTCCTTCTTCATGTACTA 0: 1
1: 0
2: 6
3: 43
4: 448
Right 916191413 1:162182111-162182133 GATTTGAACACAAAGTCACATGG 0: 1
1: 0
2: 1
3: 33
4: 362
916191405_916191410 -7 Left 916191405 1:162182064-162182086 CCATCTTCCTTCTTCATGTACTA 0: 1
1: 0
2: 6
3: 43
4: 448
Right 916191410 1:162182080-162182102 TGTACTAGAGGAGGAAGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916191405 Original CRISPR TAGTACATGAAGAAGGAAGA TGG (reversed) Intronic
902444210 1:16451835-16451857 TAGAACATGAAGAAGAAGGAAGG + Exonic
902681466 1:18046835-18046857 TAGTTGATGAAAAAGTAAGAAGG + Intergenic
902744000 1:18460973-18460995 CAGTAGATGAAGAAGACAGAAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905139959 1:35835408-35835430 TAGTACTTAAAGAAAGAAAAAGG + Intronic
905409563 1:37759072-37759094 CAGAAGATGAAGAAGGAAGATGG - Intronic
905766652 1:40607323-40607345 CTGGACATGAAGTAGGAAGAGGG - Intergenic
905997139 1:42391060-42391082 TAGTACTAGAAGAAGCAAGCTGG + Intronic
906180817 1:43817339-43817361 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
906180840 1:43817557-43817579 AAGGAGAAGAAGAAGGAAGAAGG - Intronic
906927043 1:50128830-50128852 TAGTGGGTAAAGAAGGAAGATGG + Intronic
907276192 1:53317815-53317837 GAGTGCAGGAAGAAGGCAGAAGG + Intronic
907371878 1:54009067-54009089 CAGTACTTGAAGAAGGTTGAAGG + Exonic
907475992 1:54706006-54706028 TCGTACATTAGGAAAGAAGAAGG - Intronic
907858890 1:58331410-58331432 TAGTAGATAAAGCAGGAACAGGG + Intronic
907971810 1:59390462-59390484 CAGTCCATGTAGCAGGAAGAAGG + Intronic
908034976 1:60042052-60042074 GAGGACCTCAAGAAGGAAGAAGG - Intronic
908295625 1:62709745-62709767 TAAGACATGAAGAAGGGAGCTGG - Intergenic
908413695 1:63891691-63891713 TAGAACAGAAAGATGGAAGATGG + Intronic
908883769 1:68763703-68763725 TAGTTCGTGAAGAATGATGATGG - Intergenic
909366491 1:74829449-74829471 CAGCACATGAAGAGGGATGAGGG - Intergenic
909550132 1:76889399-76889421 TATTTCAAGAAGAAGGATGATGG - Intronic
909584676 1:77276458-77276480 AGGTACATAAATAAGGAAGAAGG + Intergenic
909621024 1:77667482-77667504 TAGTCAATAAAGAAGAAAGAAGG - Intronic
909990284 1:82215304-82215326 TAGCAAATGAATAAGGAAAATGG - Intergenic
910386757 1:86692563-86692585 TAGGCCAGGAAGAAGGAAGAAGG + Intergenic
910662365 1:89687570-89687592 GAGTAAATGGAGAAGGAAGTGGG + Intronic
910773761 1:90854480-90854502 TTCTACATGAAGGAGGAAAAAGG - Intergenic
910774852 1:90864516-90864538 TAGAAGAAGAAGAAGAAAGAAGG - Intergenic
911328931 1:96503116-96503138 TAGAACATGAGGTATGAAGAGGG - Intergenic
911341504 1:96644262-96644284 TAGGACAGGAAGAATGAAAAGGG - Intergenic
912128056 1:106564973-106564995 ATGAACATGAAGAAGGTAGAAGG + Intergenic
912838205 1:113015471-113015493 TAGTAGATGAAGACGGGGGATGG - Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
916191405 1:162182064-162182086 TAGTACATGAAGAAGGAAGATGG - Intronic
916616378 1:166445534-166445556 TAGAAGAAGAAGAAGGAAGGAGG + Intergenic
916879237 1:169003276-169003298 TAATACAAAAAGAAGAAAGAAGG + Intergenic
916961992 1:169897598-169897620 GAGTAGATGAAGAGTGAAGAGGG - Intergenic
918528448 1:185490159-185490181 AAGTACATGAGGAAGGATTAAGG + Intergenic
919005390 1:191892357-191892379 TAGTAAATGTAATAGGAAGATGG + Intergenic
919424871 1:197417496-197417518 GAGTTGATAAAGAAGGAAGAAGG + Intronic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920612713 1:207457092-207457114 AGGTACATAAATAAGGAAGAAGG - Intronic
921734512 1:218612031-218612053 AAGCAGATGAAGAAGGAAAAAGG - Intergenic
921911563 1:220554592-220554614 TAGTAAATGAAGCAGCAAGCTGG + Intronic
922871446 1:228905186-228905208 AAGTAGATGAGGAAGGCAGAAGG + Intergenic
922922696 1:229320027-229320049 TGATACATGAAGAAGAAAAAAGG + Intergenic
923469149 1:234274951-234274973 TGGTATATGAAGAAAGAAGTAGG - Intronic
924082211 1:240411062-240411084 TAATACAAGAAGAAGTAGGATGG - Intronic
924450118 1:244170935-244170957 TAATAAATGAATCAGGAAGAGGG + Intergenic
924827937 1:247561623-247561645 TAATAAATGGAGAAGGAAAATGG - Intronic
1063900026 10:10723027-10723049 TAGTACATAATGATGGATGAGGG - Intergenic
1064151709 10:12871125-12871147 TGGAAAATGAGGAAGGAAGAAGG + Intergenic
1064445145 10:15386434-15386456 TATTATATGGAGAAAGAAGATGG + Intergenic
1064623235 10:17236081-17236103 TAGTACTTGCAGCAGGAAGAAGG - Intronic
1067990776 10:51209579-51209601 TAGTACTTGAAAAAGTAACATGG + Intronic
1068007268 10:51406360-51406382 TAGTACAGCAATGAGGAAGACGG - Intronic
1069901798 10:71710707-71710729 CAGTACATGAAGAAGCAGGGAGG + Intronic
1070676635 10:78416220-78416242 TAGTTTCTGAAGAAGGAAGATGG - Intergenic
1070780527 10:79135128-79135150 AAGTACATAAAGAATTAAGATGG + Intronic
1070942826 10:80361636-80361658 AAGTAGATTAAGAAGGGAGAAGG - Intronic
1071092936 10:81941212-81941234 GAGAATATGAAGTAGGAAGATGG + Intronic
1071362332 10:84861272-84861294 TGGTAAACGAAGAAGGAAGCAGG + Intergenic
1071858243 10:89646878-89646900 GAGTACAAGGAGTAGGAAGAGGG - Intergenic
1071951771 10:90711418-90711440 TCCTACATAAGGAAGGAAGAAGG + Intergenic
1072850609 10:98887474-98887496 TAGTAAATGAGGAAGCAAGAAGG + Intronic
1073673626 10:105619919-105619941 AAATATATGATGAAGGAAGAAGG + Intergenic
1074390417 10:113053011-113053033 TAGCAGATGAATCAGGAAGAAGG - Intronic
1074733158 10:116398760-116398782 TATTACCACAAGAAGGAAGAAGG + Intergenic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1076358534 10:129870188-129870210 AAATACAGGCAGAAGGAAGATGG - Intronic
1076870882 10:133193569-133193591 AAGAACAAGAAGAAGGAAAAAGG + Intronic
1077651353 11:3975624-3975646 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1078410640 11:11114081-11114103 TAGTACATAAGAAAGGAGGAGGG - Intergenic
1079191559 11:18281899-18281921 TAGTGCTTGGAGAAGGTAGAAGG - Intronic
1079448114 11:20574695-20574717 AAGTACAGGAAGAAGGCTGAAGG - Intergenic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1080290546 11:30666053-30666075 TAGAACAAGAAGAAGGAGAAGGG + Intergenic
1080557365 11:33429900-33429922 TAGGAGAAGAAGCAGGAAGAGGG - Intergenic
1081165931 11:39809307-39809329 TAGTAAAAGAAGAGAGAAGAAGG + Intergenic
1081447404 11:43144217-43144239 TAGTACTAGAAGAAGGAAGTGGG + Intergenic
1082182246 11:49133707-49133729 TAGGAAAACAAGAAGGAAGATGG - Intergenic
1082920605 11:58488606-58488628 TACAACATGAAGACAGAAGAAGG + Intergenic
1083001800 11:59299046-59299068 AAGAACAAGAAGAAGAAAGAAGG + Intergenic
1084551456 11:69845566-69845588 CAGTCCATGCAGAGGGAAGAAGG + Intergenic
1086178194 11:83917953-83917975 AAGTGCATGAAGAAGAATGAAGG + Intronic
1086233617 11:84599567-84599589 TAGTTCATGAAGAAGGAAATAGG + Intronic
1086683262 11:89701239-89701261 TAGGAAAACAAGAAGGAAGATGG + Intergenic
1088616307 11:111632653-111632675 TAGTACATGAAGTCAGAATATGG - Intronic
1088751882 11:112849191-112849213 AAGGACAAGAGGAAGGAAGAAGG - Intergenic
1089870926 11:121672045-121672067 TAGGACATGAATGAAGAAGAGGG - Intergenic
1090720237 11:129466132-129466154 GAGGCCATGAAGAAGGCAGAGGG + Intergenic
1090988693 11:131796399-131796421 TAGTAGGTGTTGAAGGAAGATGG + Intronic
1090992181 11:131827864-131827886 TAGTACCTGATGATGGTAGAGGG - Intronic
1091245757 11:134093126-134093148 TAGAACATGATGAATAAAGAGGG - Intronic
1091472988 12:746202-746224 TAATATATGAAGAAGTAAGCGGG - Intergenic
1091751392 12:3023253-3023275 TAGTAAAGGCAGAAGGAAGTGGG + Intronic
1092438350 12:8472909-8472931 TAGTAGAGGAGGAAGGGAGAGGG - Intronic
1094494038 12:30978424-30978446 TGGTACATCCAGGAGGAAGATGG + Intronic
1095772081 12:45971147-45971169 CATTAAATGAAGAAGGAAGCAGG - Intronic
1095839867 12:46681500-46681522 TAATTAATGCAGAAGGAAGATGG - Intergenic
1096099613 12:48961832-48961854 TAGTGTATGTGGAAGGAAGAGGG - Intergenic
1096320617 12:50609475-50609497 CAGTAGATGATGAAGGAACAGGG - Intronic
1096948609 12:55439358-55439380 TAGTAAATGTAGAAGGAATGAGG + Intergenic
1097091390 12:56508153-56508175 GAGGAGAAGAAGAAGGAAGAAGG - Intergenic
1099163838 12:79276934-79276956 GAGAAGAAGAAGAAGGAAGAAGG + Intronic
1099284351 12:80697640-80697662 GAGTAAAAGAAGGAGGAAGAGGG - Intergenic
1099843775 12:88002961-88002983 TAGCACAGAAAGGAGGAAGAGGG - Intronic
1100037937 12:90276351-90276373 TAATAAAGGAAGAAGTAAGATGG - Intergenic
1100153291 12:91768075-91768097 TGGCACATTAAGAAGGAAGAGGG + Intergenic
1100211450 12:92402583-92402605 AAGAACATGAAGAAGAAGGAGGG - Intergenic
1100273843 12:93052534-93052556 TAATAAATGTAGAAAGAAGATGG - Intergenic
1100502156 12:95184405-95184427 TAGAATCTGAAGAAGAAAGATGG - Intronic
1101541954 12:105673379-105673401 TAGTACTTAGAGTAGGAAGAAGG + Intergenic
1102231257 12:111264025-111264047 GACAACATGATGAAGGAAGATGG - Intronic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1102940967 12:116941275-116941297 TAGAACCTGAAGAATCAAGAGGG - Intronic
1103235346 12:119368066-119368088 AAGAACAAGAAGAAGGAGGAGGG + Intronic
1105740945 13:23322671-23322693 TAGTACAACAAGAAGGCACATGG + Intronic
1107173337 13:37370036-37370058 TAATACATGTAGAAGTAACAAGG - Intergenic
1107315209 13:39123989-39124011 TAGTCCAGGAAGATGGAAGAAGG - Intergenic
1107374149 13:39784102-39784124 TAATACATTAAGAAGGGATAAGG + Intronic
1107526109 13:41233280-41233302 GAGTAGAGGAAGTAGGAAGAGGG + Intronic
1107649466 13:42529615-42529637 TAGTAAATGTAGAAGGAGCAAGG - Intergenic
1108275157 13:48800831-48800853 TGGAACATGAAGAATGAAGAGGG + Intergenic
1109489766 13:63082014-63082036 TTGGACATGATGAATGAAGATGG + Intergenic
1110079784 13:71295677-71295699 TGGTAAATGAAGAAAGAAAATGG - Intergenic
1110403389 13:75120596-75120618 AAGGAAATGAAGAAGGAAAAAGG + Intergenic
1110622351 13:77610757-77610779 TAATACATGATGGAAGAAGAAGG - Intronic
1112510329 13:100003167-100003189 TGGTACATAAAGAAAAAAGAAGG - Intergenic
1112806254 13:103166746-103166768 TAGAACAGGAAGATGGGAGATGG - Intergenic
1112814126 13:103252137-103252159 CAGTAGATGAAGGAGCAAGAAGG + Intergenic
1114038133 14:18648848-18648870 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1115195639 14:30796055-30796077 TAGAACATGAAAGAGAAAGAAGG - Intergenic
1116052035 14:39815611-39815633 TATTACATGAAGATGTAAGAAGG - Intergenic
1116141176 14:40995874-40995896 TAGAAGATGTAGAAGGAAAATGG + Intergenic
1119147200 14:72328129-72328151 TAGAACAAAAAGAAGGAGGAGGG - Intronic
1119668843 14:76503642-76503664 TGCTCCATGAAGAATGAAGATGG - Intergenic
1120385076 14:83834582-83834604 CTATCCATGAAGAAGGAAGAGGG - Intergenic
1125332347 15:38594629-38594651 TATGACTTGAGGAAGGAAGAGGG - Intergenic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127462741 15:59214196-59214218 TAGAATAGGATGAAGGAAGAGGG + Intronic
1127489334 15:59447677-59447699 TGGTAAAAGAAGGAGGAAGAGGG - Intronic
1127804417 15:62505749-62505771 TGGTACATGAGGAAGGTGGAAGG + Intronic
1128095707 15:64953287-64953309 AAGTAAAAGAAGAAGAAAGAAGG - Intronic
1128155465 15:65389047-65389069 TGTTCCATGAAGGAGGAAGAAGG - Intronic
1128955286 15:71935248-71935270 AAAAAAATGAAGAAGGAAGATGG - Intronic
1128962138 15:72017467-72017489 TAGTACGTGAAAAAGGAAAAGGG + Intronic
1130024508 15:80259951-80259973 GAGCCCAAGAAGAAGGAAGAAGG - Intergenic
1130423184 15:83768868-83768890 TAATACATTAAAAAGGCAGAAGG + Intronic
1130433998 15:83878217-83878239 TATTACATTAAAAAGGAAAAAGG - Intronic
1130644616 15:85713288-85713310 TAGAAGATGAAGCAGGTAGAAGG - Intronic
1130882999 15:88071060-88071082 TAGGACATGAAGAATGCAGTAGG - Intronic
1132412885 15:101598243-101598265 TAGAACATCAGGAAAGAAGAAGG - Intergenic
1132417541 15:101633553-101633575 CAGTCCTTGAAGAAGAAAGATGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1135928096 16:26712842-26712864 TTTTACCAGAAGAAGGAAGATGG + Intergenic
1137322707 16:47401435-47401457 TATTACATAAAAAAGGAAAAGGG + Intronic
1137449337 16:48556324-48556346 TAGGACTTGAAGTAGGAAGAAGG - Intronic
1137968902 16:52964235-52964257 AAGTACAAGAATAAGAAAGATGG + Intergenic
1138039788 16:53650756-53650778 AAGTATTTGAAGAAGGAAGGAGG - Intronic
1138124928 16:54430860-54430882 GCGAGCATGAAGAAGGAAGAAGG - Intergenic
1140598080 16:76439760-76439782 TAATACAATAAAAAGGAAGAAGG - Intronic
1142200814 16:88760309-88760331 TTGTCCATGAGGCAGGAAGAGGG - Intronic
1142250117 16:88987769-88987791 TAATACATGAAGAAAGAGGCAGG + Intergenic
1143473119 17:7188516-7188538 AAACACATGAAGAAGGCAGAAGG + Intergenic
1143743505 17:8972519-8972541 GAATACATGTAGAAGGAAGATGG + Intergenic
1144766625 17:17736491-17736513 TAGGAGATGTAGAAGGAAGTGGG + Intronic
1145931779 17:28691172-28691194 AAGTACACAAAGAAGGAAGACGG + Intronic
1146208739 17:30925541-30925563 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1146770750 17:35567043-35567065 AAGGACATGAAGAAGTAAAATGG - Intergenic
1147548176 17:41419313-41419335 ATGTACATGAACAAGGAATATGG + Intergenic
1147606316 17:41775739-41775761 AAGGACAGGAAGAAGGAAGACGG + Intronic
1147643380 17:42018705-42018727 TAGAACATAAAGTGGGAAGATGG - Intronic
1147750064 17:42725796-42725818 TAGTACATGGAGAAGCAAAGTGG + Intronic
1149343339 17:55709461-55709483 GAGAAAATGAAGAAGGCAGAAGG - Intergenic
1149797906 17:59538419-59538441 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1152496778 17:80678730-80678752 TAATGCATGAAGAAGGTGGAAGG + Intronic
1153752820 18:8250990-8251012 TAGTACATGCATATGGAAGAGGG - Intronic
1155232708 18:23790184-23790206 TAGGACATCAAGAAGCATGAGGG + Intronic
1155280242 18:24231934-24231956 TAGTACACAAAGCAGCAAGATGG + Intronic
1156449027 18:37256127-37256149 TAGCTCTGGAAGAAGGAAGACGG - Intronic
1156856884 18:41792367-41792389 TAGCACATGGAGCAGGAAGTGGG - Intergenic
1157186993 18:45549189-45549211 TAGTTCATGAAGTAGGAATTTGG + Intronic
1157577657 18:48754471-48754493 TTGTGCAGGAAGAAGGAAAAGGG + Intronic
1157895304 18:51460886-51460908 AAGTTCATGAAGGAGGCAGAAGG - Intergenic
1158014770 18:52771206-52771228 TGGTACATGAAGCAGGCAGAAGG + Intronic
1158021068 18:52842449-52842471 TAGAACAAAAAGAAGTAAGAAGG - Intronic
1158066525 18:53416712-53416734 TAGTAAATAAATAAGGAAAAGGG - Intronic
1158444415 18:57506777-57506799 TATTCCAGAAAGAAGGAAGAGGG - Intergenic
1159020330 18:63138080-63138102 AAGGACATGAAGGAGGAAGTGGG + Intronic
1161933711 19:7357967-7357989 AAGCACATATAGAAGGAAGAGGG - Intronic
1162543109 19:11310223-11310245 AAGTGCAGGAAGAAGGAAGAAGG + Intronic
1164649906 19:29884233-29884255 AAGGAAAGGAAGAAGGAAGAAGG - Intergenic
1164838330 19:31373371-31373393 TAGAAAATGAAAAAGGAAAATGG + Intergenic
1165792799 19:38502173-38502195 TATTACAGGAAGAAAGATGAGGG + Intronic
1166043495 19:40216631-40216653 GAGCCAATGAAGAAGGAAGAGGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1167485882 19:49762788-49762810 TAGTGAATGAAGAAGAAAGTAGG - Intronic
925053314 2:834228-834250 TAGAACAGGGAGAAGGGAGAAGG + Intergenic
925773435 2:7307285-7307307 TAGAACACAAAGAAGGAGGAAGG + Intergenic
926318222 2:11727214-11727236 TAGTACATGTAGAAAGAAAGAGG - Intronic
926455927 2:13068848-13068870 TCGTAAATAAAGAAGGAAAACGG + Intergenic
926903045 2:17777456-17777478 TAATACAGGCAGAAGGAAGATGG + Intronic
926918509 2:17916329-17916351 GAGGCCATGAAGGAGGAAGAGGG + Intronic
928713518 2:34034225-34034247 TAGAACATAAAGGAAGAAGAAGG + Intergenic
930463026 2:51708078-51708100 AAGTATAAGAAGAGGGAAGAAGG - Intergenic
930535268 2:52637988-52638010 AAGTGGAAGAAGAAGGAAGAAGG - Intergenic
930885229 2:56317936-56317958 TACTACAAGAATAAAGAAGATGG - Intronic
930936634 2:56960616-56960638 GAGTGCATGAGGAAGGAGGAAGG + Intergenic
931933604 2:67169797-67169819 TAGTTCATGAAGACATAAGACGG + Intergenic
933629137 2:84636363-84636385 TGGGACCTGAAGAAGGAAGAAGG - Intronic
934654947 2:96112531-96112553 GAGTACACCAAGAAGCAAGATGG - Intergenic
936490489 2:112967454-112967476 TAATAAATGAAGAAGGAATTAGG - Intergenic
936692534 2:114908574-114908596 TAGCACAAAAAGAAGAAAGAAGG - Intronic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
937611171 2:123863510-123863532 TCGAACATTAAGAAGGTAGAGGG - Intergenic
937616160 2:123924262-123924284 GAATACAGGAAGAAGAAAGAAGG - Intergenic
937629707 2:124087276-124087298 TGGAACATCAAGAAGGTAGAAGG - Intronic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
938675702 2:133631828-133631850 TAGTAAATGAAAACTGAAGAGGG + Intergenic
939185800 2:138859123-138859145 TAATACAAAAAGAAAGAAGAAGG + Intergenic
939902841 2:147870820-147870842 AAGTATATAAAGAAGGAAGAGGG - Intronic
939959615 2:148554747-148554769 AAGTGCCTGAAGAAGTAAGAGGG - Intergenic
940118705 2:150239043-150239065 TAGCTCATGAAGGAGGAAAATGG - Intergenic
941454559 2:165700053-165700075 TAGCACCTGAAAAAGGATGATGG - Intergenic
941953316 2:171178469-171178491 GAGTCAATGAAGAGGGAAGATGG - Intronic
942598067 2:177611227-177611249 TAGTACAAAAAGAAAAAAGAAGG + Intergenic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
942841417 2:180366218-180366240 GATTTCATGAAGAAGAAAGAAGG + Intergenic
942853807 2:180522584-180522606 TAGAACATGCAGAAGGAATGAGG - Intergenic
943585469 2:189734363-189734385 TAATAAACGTAGAAGGAAGAAGG - Intronic
944037420 2:195311891-195311913 TACTATTTGAAGAAGAAAGATGG - Intergenic
944058617 2:195548305-195548327 AAGGAAAGGAAGAAGGAAGAGGG + Intergenic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
945863872 2:215155038-215155060 TAGTAACTGTAGAAGGAAGGTGG - Intergenic
946040564 2:216779946-216779968 AAGTAGATTATGAAGGAAGAGGG + Intergenic
947352904 2:229264865-229264887 TAGTAGATGGACAAGAAAGATGG + Intronic
947418265 2:229920850-229920872 TAGTACAGGAACAAGTTAGAGGG - Intronic
947629716 2:231644269-231644291 GAGAACATGAAGCAGGATGAGGG - Intergenic
949081626 2:242105229-242105251 TAATAAATGTAGAAGGAATAAGG + Intergenic
1169515812 20:6315432-6315454 GAGTTGATGAAGAACGAAGAAGG + Intergenic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170350591 20:15436682-15436704 TGGTTAATGAAGGAGGAAGAGGG - Intronic
1170838031 20:19901683-19901705 AAGTAATTGAATAAGGAAGAAGG - Intronic
1172038690 20:32028773-32028795 TAGTAGAGGAAGAAGGAGAAGGG + Intronic
1173343344 20:42175083-42175105 AAGAACATGGAGAAGGAAGAGGG - Intronic
1177033592 21:16013935-16013957 TATTACATGAAGGTTGAAGAAGG - Intergenic
1177095134 21:16823266-16823288 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1177561428 21:22759291-22759313 GAGTACCTGAAGAAGGATGTTGG - Intergenic
1177703627 21:24672277-24672299 TGGTTCAAGAAGCAGGAAGATGG - Intergenic
1178095903 21:29215359-29215381 TAATAAATGAAGAGGGTAGATGG - Intronic
1178115064 21:29408395-29408417 TAATTCATGAAGAAGGACCAAGG + Intronic
1178675040 21:34623668-34623690 TAGTACATGGAAGAGGAAGTGGG + Intergenic
1178745265 21:35243448-35243470 GAGGAGATGGAGAAGGAAGAGGG - Intronic
1180462259 22:15575889-15575911 AAGAAGATGAAGAAAGAAGAAGG - Intergenic
1182603379 22:31484942-31484964 CAGTACATAGACAAGGAAGAAGG + Intronic
1182973911 22:34604435-34604457 CAGGAAATGAAGAAAGAAGATGG + Intergenic
1185160528 22:49225575-49225597 TAGTATATTAATAAAGAAGAAGG - Intergenic
950327785 3:12128638-12128660 TAGAACATTAAGGTGGAAGATGG + Intronic
950759086 3:15204736-15204758 GAATACATGAACAAGGAATAAGG + Intergenic
951474946 3:23094907-23094929 GAATACATGGAGAAGGAAGGAGG + Intergenic
951635807 3:24774739-24774761 TAATACATTTAGAAGGAATAAGG - Intergenic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952067339 3:29586799-29586821 TAATCCATGAAGAAAGAACACGG + Intronic
952097847 3:29976296-29976318 AAGTACTTAAAGAAGGAAGAAGG - Intronic
953984190 3:47428707-47428729 GAGCACAGGAAGAAGAAAGACGG + Intronic
954287781 3:49631012-49631034 AAGGACAGGAAGAAGGGAGAGGG - Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
955307393 3:57848145-57848167 GAGGAGAAGAAGAAGGAAGAAGG - Intronic
956819658 3:72942345-72942367 TAATACATGTAGAAAGAAGGAGG + Intronic
956940481 3:74155193-74155215 TAATACATGTAGGAGGAATATGG + Intergenic
957038086 3:75313347-75313369 TAGTCTATGATGAAGGCAGATGG - Intergenic
957142088 3:76373325-76373347 TAGTAATTGAGAAAGGAAGAGGG + Intronic
957592801 3:82223006-82223028 TATAACAAGAAGAAGAAAGAAGG - Intergenic
958430419 3:94033551-94033573 TAGTAAATGCAGAAGGAATATGG + Intronic
958457784 3:94354298-94354320 TTAGAAATGAAGAAGGAAGAAGG + Intergenic
959145553 3:102540272-102540294 TACTACATGAACAAGATAGATGG - Intergenic
959314727 3:104788830-104788852 TTGTACAAAAAGAAGAAAGAAGG + Intergenic
960400998 3:117198708-117198730 AAGGAGTTGAAGAAGGAAGAAGG - Intergenic
960610059 3:119547559-119547581 CAGTACATCAATAAGGAACAGGG - Intronic
960664849 3:120098767-120098789 TTGAAGATGAAGAAAGAAGAGGG + Intergenic
961584616 3:127911623-127911645 AAATACATGATGAAGGAGGATGG + Intergenic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963543453 3:146624570-146624592 GAATACTTGAAGAAGGAAAACGG + Intergenic
964560223 3:157986928-157986950 TATTACATGATGAAGTAACATGG + Intergenic
964821397 3:160774236-160774258 ACTTGCATGAAGAAGGAAGAAGG - Intronic
965149675 3:164954106-164954128 TAGAAATTGAAGTAGGAAGAGGG - Intergenic
965655354 3:170977629-170977651 TAGTACAAGAAGGACGAACAAGG - Intergenic
965710944 3:171555652-171555674 TCGTACATCCAGAAAGAAGAAGG - Intergenic
966699509 3:182831551-182831573 TAGGAAATGAAGAAGGAACCAGG - Intronic
966708576 3:182946656-182946678 AAGTACATCAAGAAGTAAAAAGG + Intronic
967411683 3:189172517-189172539 TAATAGAGGAAGAGGGAAGAAGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967690560 3:192468863-192468885 TAATAAATGTAGAAGGAAAAAGG - Intronic
969096467 4:4736265-4736287 TGGAAAATGAAGAAGGAAGTTGG + Intergenic
969934792 4:10669568-10669590 TAGTACATGAAAAAGAATGAGGG + Intronic
970110100 4:12628235-12628257 TAGTAAAGGGAGAAGGAAAAAGG - Intergenic
970267775 4:14308047-14308069 TGGTAAATGAGAAAGGAAGAAGG - Intergenic
970291809 4:14581298-14581320 TAGTAAATGATGGAGGAAGAGGG + Intergenic
970867887 4:20780042-20780064 TAGGACATGGATAAGGAAGTAGG + Intronic
971112356 4:23602552-23602574 AAGGAAAGGAAGAAGGAAGAAGG + Intergenic
971340462 4:25764026-25764048 TAGCAAATGTAGAAGGAATAAGG + Intronic
971615650 4:28787922-28787944 GAGTACAGGAAGCAGGGAGAGGG + Intergenic
971675122 4:29616656-29616678 TAGAAAATGAAGAAGGCATAGGG - Intergenic
971734245 4:30425641-30425663 AAGGACAGGAGGAAGGAAGAAGG + Intergenic
972263224 4:37432836-37432858 AAGCAAATGAAAAAGGAAGAGGG + Intronic
972353362 4:38258365-38258387 CAGGAAATGAAGAAGGCAGAGGG - Intergenic
973064874 4:45776853-45776875 AAGAACAAAAAGAAGGAAGAAGG - Intergenic
973801058 4:54479113-54479135 TAGGACTTGAAGAATGAATAAGG - Intergenic
974095416 4:57358620-57358642 TAGTACATAAAAAAGGGGGAGGG + Intergenic
974198440 4:58607597-58607619 TAAAACATACAGAAGGAAGAAGG - Intergenic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
975780553 4:77834968-77834990 TAGTGCAGGAAGTAAGAAGAGGG + Intergenic
976323092 4:83738162-83738184 TAGAAAATGAATAATGAAGACGG + Intergenic
976757435 4:88513447-88513469 AAGAACAGGAAGAAGGAAAAGGG - Intergenic
976857436 4:89621735-89621757 TAGTAGATAGAGAAGAAAGAAGG + Intergenic
976917281 4:90391773-90391795 TAGTACACAAAGAAGAATGAAGG + Intronic
978168059 4:105632661-105632683 TAGAACCCGAAGAAGGAAAATGG - Intronic
978674159 4:111290549-111290571 TAATACAAGAAGAGGGAAGGAGG + Intergenic
978992943 4:115108995-115109017 TAGGAAAGCAAGAAGGAAGAAGG + Intronic
979184681 4:117773101-117773123 TTCTACACGAAGAAAGAAGAGGG + Intergenic
980113633 4:128658688-128658710 TAGAACAGGGAGAAGGAAAAGGG + Intergenic
980239749 4:130158383-130158405 TAGAACAAAAAGATGGAAGAAGG + Intergenic
980669448 4:135985778-135985800 GAGTACAAGAAGAATAAAGAGGG - Intergenic
980762735 4:137256941-137256963 CAGTATATCAGGAAGGAAGATGG + Intergenic
981244704 4:142521628-142521650 TAATCTCTGAAGAAGGAAGAAGG - Intronic
981321354 4:143395839-143395861 GAGTAAGTGAAGAAAGAAGAAGG + Intronic
981562598 4:146063931-146063953 AAGGAAATGAGGAAGGAAGAAGG - Intergenic
982035845 4:151344939-151344961 GAGAAAATCAAGAAGGAAGAAGG - Intergenic
982273043 4:153610928-153610950 TAGTTCAAGAAAAAAGAAGAAGG + Intronic
982482382 4:155928149-155928171 TAGTATTTGAAAAAGGAAGAGGG - Intronic
983865822 4:172765209-172765231 TATTACATGGAGAATGCAGAAGG + Intronic
985842503 5:2319110-2319132 TAGTACAAGACAGAGGAAGAAGG - Intergenic
986375795 5:7130077-7130099 AACTACATGAAGAATGCAGAAGG - Intergenic
986643376 5:9893156-9893178 TTGTAGGGGAAGAAGGAAGAAGG - Intergenic
986833871 5:11612470-11612492 TATACCATGAAGAACGAAGAAGG - Intronic
987083536 5:14447748-14447770 TCTTACATGAAGAAGGCATATGG - Intronic
988174339 5:27702092-27702114 TAGTTAATGAGGAAGGAATAAGG + Intergenic
988589848 5:32539265-32539287 AAATACATGAAGAAAGAATAAGG + Intronic
989354515 5:40528420-40528442 TAGTAGAGGAGGAAGGAAGATGG - Intergenic
989431696 5:41362791-41362813 TAGTCCAGGAAGAAGAAATAAGG + Intronic
990761029 5:59129493-59129515 TAGTAGATGAAGCAGAATGATGG - Intronic
990889911 5:60636677-60636699 TAGTGGAAGAAGAAAGAAGAAGG - Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
991716342 5:69454310-69454332 TAATCCCGGAAGAAGGAAGAGGG + Intergenic
992408527 5:76482521-76482543 TAGTACATACAGAAGGAAGAGGG + Intronic
993130168 5:83886838-83886860 AAGTACATAAAGAAGGGAGAAGG + Intergenic
993149485 5:84142740-84142762 AAGAACATCAAGAAGGAACATGG + Intronic
995304859 5:110633144-110633166 TCATACATGAAGAAGAAATAAGG + Intronic
995604361 5:113835453-113835475 TATTTCAGGAAAAAGGAAGAGGG + Intergenic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
997474510 5:134134839-134134861 GAGTAAATGAAGAAGGATGCTGG + Intronic
997983098 5:138482333-138482355 TTGTACATGGGGAATGAAGATGG - Intergenic
998138546 5:139687315-139687337 CTGTGCAGGAAGAAGGAAGAAGG + Intergenic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
999379442 5:151109989-151110011 TTGTGCTTGAGGAAGGAAGAGGG - Intronic
999869272 5:155732160-155732182 TAGTACATGAAGAATGCTGAAGG - Intergenic
1000016837 5:157285455-157285477 TGGTACATGATGGAGGAAGGTGG - Exonic
1000051999 5:157571465-157571487 TAGTAAATGAAAGAGGAAGTTGG + Intronic
1001713793 5:173798375-173798397 TTGTACTGGAGGAAGGAAGAGGG + Intergenic
1001740310 5:174047709-174047731 TAGTCCATGAAGAATGGAGGTGG + Intronic
1002430727 5:179202424-179202446 TAGGAGATGGAGAAGGAAGAAGG - Intronic
1003454480 6:6269027-6269049 AAGTAAAGGCAGAAGGAAGAAGG + Intronic
1003510634 6:6776998-6777020 TAATACATGAAAAAGGTGGAAGG - Intergenic
1003693675 6:8380147-8380169 AAGAACAGCAAGAAGGAAGAGGG + Intergenic
1004586990 6:17012275-17012297 TGGGACATGGAGAAAGAAGAGGG - Intergenic
1004973590 6:20939253-20939275 TAGTAAATGCAGCAGGAGGAAGG - Intronic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1007465141 6:42046394-42046416 TGGTAGATGAGTAAGGAAGATGG - Intronic
1008075438 6:47140549-47140571 AAGGCCATGTAGAAGGAAGAAGG + Intergenic
1008383001 6:50855036-50855058 TAGTCCTTGAATAAGTAAGATGG + Intergenic
1008978689 6:57457917-57457939 AAGAAAATGAACAAGGAAGATGG - Intronic
1008999454 6:57696759-57696781 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1009166824 6:60350876-60350898 AAGAAAATGAACAAGGAAGATGG - Intergenic
1009695009 6:67091196-67091218 TAGTACATGATGATGTAAAAAGG - Intergenic
1009792115 6:68417048-68417070 TAATACATAAAGAAGAAAAATGG + Intergenic
1010485669 6:76410457-76410479 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1010959838 6:82133350-82133372 TAGTACAAAAAGGGGGAAGAGGG - Intergenic
1011290119 6:85768243-85768265 TAGTGAATTAAGAAGGAAAATGG + Intergenic
1011603497 6:89081055-89081077 TAGGAAATGAGGGAGGAAGAGGG - Exonic
1011896558 6:92234421-92234443 CAGATCATGAAGAAGGAAAAGGG - Intergenic
1012060395 6:94471340-94471362 TAGTACTAGAATAAGGAGGAGGG - Intergenic
1012429629 6:99151069-99151091 AAGGACATGAAGCAGGAAGGGGG + Intergenic
1012719173 6:102719641-102719663 TAGTAAAAGAAGGAGAAAGAGGG - Intergenic
1012807734 6:103916449-103916471 TGATACATAAAAAAGGAAGAAGG + Intergenic
1013055582 6:106579622-106579644 TTGTTCATAAAGAAGGTAGAAGG + Intronic
1013078299 6:106790283-106790305 TAGCACTTGAAGAAAGAGGATGG + Intergenic
1013343124 6:109234916-109234938 TTGTACATGAAAAAATAAGATGG + Intergenic
1013764526 6:113559212-113559234 TTGGGCATGAAGAAGGAAGTGGG + Intergenic
1014381357 6:120746511-120746533 TAGTAAATGATGGAGGAAGGTGG - Intergenic
1014505546 6:122249649-122249671 TAGGAAAGAAAGAAGGAAGATGG + Intergenic
1014688276 6:124530894-124530916 TAGAACAAAAAGATGGAAGAAGG - Intronic
1014789883 6:125660165-125660187 CAATACATGAAGAAGTAGGAGGG - Intergenic
1018816789 6:167338895-167338917 AAGAAAAAGAAGAAGGAAGAGGG - Intronic
1019973621 7:4562443-4562465 TGTTTCATGAAGAAAGAAGAAGG + Intergenic
1020464920 7:8466616-8466638 TAGTATATCATTAAGGAAGATGG + Intronic
1020577346 7:9949887-9949909 AAGAAGAAGAAGAAGGAAGAGGG + Intergenic
1022581831 7:31563150-31563172 TAGTAAATGAAGGAGGAATATGG + Intronic
1023056121 7:36291433-36291455 TCGTACCTGCAGAAGGGAGATGG + Intronic
1023740586 7:43277663-43277685 TGGTAAATGGAGAAGGAAGTGGG - Intronic
1023883995 7:44338498-44338520 AAGGGCATGAAGAAGGAAGAGGG + Intergenic
1024637967 7:51306061-51306083 TTGTACTTGATGAATGAAGATGG + Intronic
1026333444 7:69373209-69373231 TCTTACATGAAGAAAAAAGAAGG + Intergenic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1027379851 7:77595970-77595992 TAGCAACTGAAGAAGGAAGAGGG - Intronic
1027381936 7:77620436-77620458 CATTACATGAAGAAGAAAAAAGG - Intronic
1027385481 7:77655568-77655590 TGGTACATGGAGAAGTAGGAAGG - Intergenic
1027533094 7:79360421-79360443 TAGAACATCAAAAAGGAAGAAGG + Intronic
1028276388 7:88863075-88863097 TAGTACAAGATGAAGCTAGAAGG - Intronic
1028619690 7:92811519-92811541 TAGCACTTGAAGATGGCAGAAGG + Intronic
1029015129 7:97308371-97308393 TTTTACATGTAGAAGGTAGAAGG - Intergenic
1029315631 7:99710700-99710722 CAGTACATGGAGAAGGAGGGAGG - Intronic
1029321385 7:99763823-99763845 TGGTACATGGAGAAGGAGGGAGG - Intronic
1030462405 7:109855904-109855926 AAGAAGAGGAAGAAGGAAGAAGG + Intergenic
1031132877 7:117853273-117853295 TAAAAAATGAAAAAGGAAGAGGG - Intronic
1031618574 7:123908916-123908938 AAGAAGAAGAAGAAGGAAGAAGG + Intergenic
1032254858 7:130289042-130289064 TGACAGATGAAGAAGGAAGATGG - Intronic
1032412637 7:131709149-131709171 TAATAAATGAAGAAGGAAGAAGG - Intergenic
1032924329 7:136585678-136585700 TAGTAAATAAAAAAGGAGGAAGG + Intergenic
1033031038 7:137827064-137827086 TAGCACATGAAGAAGGAAGGGGG - Intronic
1033352911 7:140576787-140576809 GAGCACAAAAAGAAGGAAGAGGG + Intronic
1033890469 7:146006537-146006559 TAGAAGAAGAAGAAGGAGGAGGG - Intergenic
1034058111 7:148058155-148058177 TAGTACATGAAGAGAGAGCATGG + Intronic
1034915809 7:155037851-155037873 TAGTTCAGGAAAAAGAAAGATGG - Intergenic
1035050299 7:155994824-155994846 TAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1037057440 8:14459459-14459481 TAATACATATAGAAGGCAGAAGG + Intronic
1038561769 8:28586962-28586984 TAGCGCATGAAGGAGGGAGAGGG + Intergenic
1039762164 8:40589712-40589734 AAGGAAAGGAAGAAGGAAGAAGG - Intronic
1039806199 8:41001795-41001817 AAGAAGAAGAAGAAGGAAGAAGG - Intergenic
1040604596 8:48919321-48919343 TAGTACAGAAAGAGGGAAAAGGG - Intronic
1041119057 8:54568125-54568147 TAGAACAAGAAGGAGGAAAAGGG + Intergenic
1042264598 8:66895372-66895394 AAGAAGAAGAAGAAGGAAGAAGG - Intronic
1042311061 8:67379859-67379881 AAGAACAAGGAGAAGGAAGAAGG - Intergenic
1042483750 8:69330108-69330130 TAGTACATGCAGACTGAAGGAGG + Intergenic
1042623786 8:70734718-70734740 TAGTTCAGGAACAAGGAAAATGG - Exonic
1042808480 8:72798008-72798030 TTGTATATGAAGAAGGGAAATGG - Intronic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043264087 8:78240638-78240660 TAGTATATGAAGAAACCAGAGGG + Intergenic
1043441983 8:80284364-80284386 TGAGACATGAAGGAGGAAGAAGG - Intergenic
1043704680 8:83333143-83333165 TATGAAATGAAGAAGGAAGAGGG + Intergenic
1044099100 8:88108504-88108526 TATTACATAAAGAAGAAAAAAGG - Intronic
1044458295 8:92414698-92414720 CAGTACATGCAGAATGAATAGGG - Intergenic
1044845007 8:96371926-96371948 TAGGACTGGAAGAAAGAAGAGGG - Intergenic
1045358755 8:101412949-101412971 TGGTGGATTAAGAAGGAAGAGGG - Intergenic
1045796671 8:106053735-106053757 TATTACATAAAGAAGGATAAAGG + Intergenic
1047071922 8:121354698-121354720 TAATACATGAAGAAGTGAGCAGG + Intergenic
1047888301 8:129277773-129277795 TAGTACATGGATATGTAAGATGG + Intergenic
1048715370 8:137262976-137262998 TAGTGCATTTAGAAAGAAGAGGG - Intergenic
1048870992 8:138798562-138798584 TAGCACAAAAAGAGGGAAGAAGG - Intronic
1051027204 9:12626931-12626953 TTGCACATGCAAAAGGAAGAAGG - Intergenic
1051449607 9:17180634-17180656 TGGAACATCAAGAAGGAAGAAGG - Intronic
1051731032 9:20142909-20142931 TACGACCTGAAGAAGGAAGGAGG + Intergenic
1054763918 9:69026936-69026958 TAGTAGATGTAGAAGGTTGAAGG + Intergenic
1055604666 9:77956399-77956421 AAGGACATGAAAAAGGAAGCTGG - Intronic
1055654077 9:78436380-78436402 TAAAGCATGAAGGAGGAAGATGG + Intergenic
1056272550 9:84960601-84960623 TAGTACATGACAAAACAAGATGG - Intronic
1056379055 9:86040957-86040979 AAGTGCCTGAAGCAGGAAGAGGG - Intronic
1056806583 9:89733499-89733521 AAGGAAATGAAGAGGGAAGAAGG - Intergenic
1057422614 9:94924653-94924675 TAGTGAATGAAGAATGAAGCAGG + Intronic
1058162679 9:101586715-101586737 AACCACATGAAGCAGGAAGAGGG - Intronic
1058376743 9:104330799-104330821 GAAAAGATGAAGAAGGAAGAAGG + Intergenic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1061520099 9:131112721-131112743 TTTTACATGAAGAAGAGAGAAGG + Intronic
1061927982 9:133815688-133815710 ATGTCCATAAAGAAGGAAGATGG - Intronic
1185479215 X:433677-433699 AAGGCAATGAAGAAGGAAGAAGG + Intergenic
1186020683 X:5251567-5251589 TTCAACATGAAGAAAGAAGATGG + Intergenic
1186205436 X:7195156-7195178 TACTACATAAAGAAGCAACATGG - Intergenic
1186400662 X:9256388-9256410 AAGTAAAGGAAGAAAGAAGATGG + Intergenic
1187226473 X:17378318-17378340 TTGTACATGAATAATAAAGATGG + Intronic
1188038589 X:25345811-25345833 TAGACCAGGAAGAAGCAAGAAGG - Intergenic
1188527138 X:31098955-31098977 TGAGACTTGAAGAAGGAAGAAGG - Intronic
1188986167 X:36770202-36770224 TAGGACCTGCAGAAGGTAGATGG - Intergenic
1189450693 X:41126430-41126452 TATAAAATGAAAAAGGAAGAGGG - Intronic
1190539014 X:51458212-51458234 TAATACACCAAAAAGGAAGAAGG + Intergenic
1190582774 X:51904346-51904368 GGGAACCTGAAGAAGGAAGAGGG + Intergenic
1190593843 X:52033123-52033145 TAGAACATGAAGAAAGAGCAAGG + Intergenic
1192353167 X:70373323-70373345 AAGGAAAGGAAGAAGGAAGAAGG + Intronic
1192397788 X:70800667-70800689 AAGCACATGAAATAGGAAGAAGG - Intronic
1192710046 X:73572110-73572132 GACTACATGAAGGGGGAAGAAGG - Intronic
1193103000 X:77636897-77636919 AAGAAGAAGAAGAAGGAAGAAGG + Intronic
1194226115 X:91260058-91260080 TGAGACATGAAGGAGGAAGAAGG - Intergenic
1196153624 X:112403198-112403220 AAGTAAATGAAAAAGAAAGAAGG - Intergenic
1196560034 X:117135254-117135276 CAGTAAGTGAAGAAGGAAAAGGG - Intergenic
1196776920 X:119346891-119346913 TAGTATATAAAGAAGAAACAGGG + Intergenic
1196963279 X:121026855-121026877 TAGTACCTGAAGGAATAAGATGG + Intergenic
1197425312 X:126289758-126289780 TAGTTCCTGAAGGAGGAAGGTGG + Intergenic
1197457142 X:126691115-126691137 AAGAACATGAAGAAGGAGAAGGG + Intergenic
1197904062 X:131405156-131405178 TACTACAGGAACAAAGAAGAGGG + Intergenic
1198856508 X:141022770-141022792 AAGGACATAAAGAAAGAAGAAGG + Intergenic
1198906184 X:141564597-141564619 AAGGACATAAAGAAAGAAGAAGG - Intergenic
1199573771 X:149293050-149293072 GAGTACATGCACATGGAAGATGG - Intergenic
1199619189 X:149684489-149684511 TGGTACATGAAGAAAGACCATGG + Intergenic
1201578149 Y:15482542-15482564 TACTACATAAAGAAGCAACATGG - Intergenic
1202096134 Y:21249660-21249682 CAGTACATGAGGCAGGAAGCAGG + Intergenic
1202327412 Y:23705801-23705823 AACTACATGAAGAATGCAGAAGG + Intergenic
1202543358 Y:25964251-25964273 AACTACATGAAGAATGCAGAAGG - Intergenic