ID: 916191532

View in Genome Browser
Species Human (GRCh38)
Location 1:162183642-162183664
Sequence CTCTGTAACATAAAAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 954
Summary {0: 1, 1: 0, 2: 44, 3: 181, 4: 728}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916191532 Original CRISPR CTCTGTAACATAAAAATGGA AGG (reversed) Intronic
900537159 1:3184565-3184587 CTCGATAACATAAAAAAGGCAGG - Intronic
900880658 1:5378911-5378933 CTCAGTAAGCTAAAAATGGAAGG + Intergenic
901890995 1:12264703-12264725 CTCCATAACATAAAAGTGCAAGG + Intronic
903039341 1:20516782-20516804 CTCAGTCTCAAAAAAATGGAAGG + Intergenic
903597903 1:24510449-24510471 CTCTATAACATAGAAGTGCAAGG - Intronic
904761194 1:32805303-32805325 CTCCATAACATAAAAGTGCAAGG - Intronic
904923100 1:34024135-34024157 CTCTGAAACCTAAAAATGTTGGG - Intronic
905144266 1:35875022-35875044 CTCCATAACATAAAAGTCGAAGG + Intronic
905327314 1:37164092-37164114 CTCAATAAAATAAAAATGGAAGG - Intergenic
905949423 1:41936144-41936166 CTCTGTAACCCCAAGATGGAGGG + Intronic
906269749 1:44467134-44467156 CTCTGTAACAGAAAATTACAAGG - Intronic
906558796 1:46738244-46738266 CTCCATAACATAAAAATACAAGG - Intergenic
907002064 1:50871229-50871251 CTCCATAACATGAAAATGCAAGG + Intronic
907685114 1:56603171-56603193 CTCCGTAACATAAAAGTACAAGG + Intronic
907858812 1:58330370-58330392 CTCTATAACATAAATGTGCAAGG + Intronic
908091726 1:60692983-60693005 TTCTATAACATAAAAATGCAAGG + Intergenic
908689610 1:66763614-66763636 CTCTGTAACATAAAAGTGCAAGG - Intronic
908793579 1:67808281-67808303 CTATGTAAACTAAAAATAGAGGG + Intronic
908849608 1:68362368-68362390 CTCTATAACATAAAAGTGCAAGG - Intergenic
908921913 1:69205098-69205120 CTCTATAACATAAAAGTGCAAGG - Intergenic
908943870 1:69470439-69470461 CTCTGGAACATAAAAATCACAGG + Intergenic
909029109 1:70517841-70517863 CACTGTAACATAAAAGTGCAAGG + Intergenic
909088424 1:71195243-71195265 CTCCATAACATAAAAGTGCAAGG - Intergenic
909279627 1:73732619-73732641 CTCAGCAAAATAAAAATAGAGGG + Intergenic
909824118 1:80104563-80104585 CTCTATAACATAAAAGTGTGAGG - Intergenic
909904825 1:81181801-81181823 CTTTCTAACATAAAAGTGCAAGG - Intergenic
909916063 1:81321091-81321113 CTCCATAACATAAAACTGCAAGG - Intronic
910068083 1:83177888-83177910 ATCTGTAATATAAAAGTGCAAGG - Intergenic
910252758 1:85215415-85215437 CTCTGTAACAGAAACCTAGAGGG - Intergenic
910298150 1:85673817-85673839 CTCTGTAACATACTCATGAATGG - Intronic
910537899 1:88320417-88320439 TTCTGTAACTGAAAAAGGGAAGG + Intergenic
910545697 1:88414747-88414769 CTCTACAACATAAAAGTGCAAGG - Intergenic
910732732 1:90415865-90415887 CTCTATAACATAAAAGTGCAAGG + Intergenic
911820200 1:102409376-102409398 CTTTGTAACATAAAAGTGGAAGG + Intergenic
911907816 1:103592007-103592029 CTCTGTAGCATACAAAAGGTAGG + Intergenic
912205792 1:107507987-107508009 TTCTGTAACATAAAAGTGCAAGG + Intergenic
912731432 1:112109856-112109878 CTCTATAACATAAAAGTGCAAGG - Intergenic
912902470 1:113667368-113667390 CTCTATAATATAAAACTGCAAGG - Intronic
913659939 1:120997858-120997880 CTCTTTAGCATAAACATGGGGGG - Intergenic
914011296 1:143781009-143781031 CTCTTTAGCATAAACATGGGGGG - Intergenic
914166538 1:145180127-145180149 CTCTTTAGCATAAACATGGGGGG + Intergenic
914327208 1:146631029-146631051 AGCTGGAACATTAAAATGGAAGG - Intergenic
914649920 1:149689648-149689670 CTCTTTAGCATAAACATGGCGGG - Intergenic
915909494 1:159904739-159904761 CTCCATAACATAAAAGTGCAAGG - Intergenic
916191532 1:162183642-162183664 CTCTGTAACATAAAAATGGAAGG - Intronic
916768962 1:167889609-167889631 CTCTGAAACATAGAAGAGGAGGG - Intronic
916778765 1:167999609-167999631 TTCTGTAACATAAAAGTACAAGG - Intronic
917950937 1:180035250-180035272 CTCTATAAAATAAAAGTGCAAGG + Intronic
918485376 1:185023488-185023510 CTCTGTCAAAGAAAAATTGAGGG + Intergenic
918498317 1:185164590-185164612 CTCTGTAACATAAAAGTACAAGG - Intronic
919054960 1:192559126-192559148 CTCTATAACATAAAAGTGCAAGG - Intergenic
919113346 1:193247891-193247913 CTCTATAAAATAAAAGTGTAAGG + Intronic
919282093 1:195503446-195503468 CTCTGTAACATAAAAGTGCAAGG - Intergenic
919308415 1:195874581-195874603 CTCTATAACATAAAAGTGCAAGG - Intergenic
919328363 1:196137623-196137645 CTCTGTAATATGCAAATGCAGGG + Intergenic
919596119 1:199564721-199564743 ATCAGTAACAGAAAAATAGAGGG + Intergenic
919910674 1:202108752-202108774 CTCTGTAACTCTAATATGGAGGG + Intergenic
921096185 1:211889183-211889205 CTCCGAAAAAAAAAAATGGATGG + Intergenic
921233436 1:213097792-213097814 CACCGTAACATAAAAGTGCAAGG - Intronic
921276155 1:213522680-213522702 CTCCATAACATAAAAGTGCAAGG - Intergenic
921313951 1:213873109-213873131 CACTGTAACATAAAAGTGCAAGG + Intergenic
921576394 1:216840241-216840263 CACTGTAACATAAAAGTGGAAGG - Intronic
922624144 1:227020486-227020508 CTCCATAACATAAAAATGCAAGG - Intronic
922823362 1:228500242-228500264 CACTGTAACATAAAAATGCAAGG - Intergenic
922828926 1:228540863-228540885 GTCTCTAACATAAAAATGCCTGG + Intergenic
923551874 1:234970601-234970623 CTCTTTGACATAAAGAGGGAAGG - Intergenic
923936364 1:238764723-238764745 CTCCATAACATAGAAATGCAAGG - Intergenic
924080688 1:240394481-240394503 CTCTGTAACAAAAGAGTGCAAGG + Intronic
924125677 1:240848535-240848557 CTGTGTAAGATACAAATGTAAGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
924469730 1:244331668-244331690 AACTATAACATAAAAATAGAGGG - Intergenic
924661878 1:246027218-246027240 CTCCGTAACTTAAAACTGCAAGG + Intronic
1062865997 10:854969-854991 CTCCATAACATAAAAATGCAAGG - Intronic
1063661871 10:8039973-8039995 CTCTCTAACTCAAAAATGGAGGG + Intergenic
1063801979 10:9590219-9590241 CTCTATAACATAAAAGTGCAAGG - Intergenic
1063821161 10:9837843-9837865 CTCCATAACATAAAAGTGCAAGG + Intergenic
1063824958 10:9885880-9885902 CTCTATAACATAAAAGTGCAAGG - Intergenic
1064291452 10:14037742-14037764 CACTGTAACATAAGAGTGGAGGG - Intronic
1064547417 10:16464794-16464816 ATCTGGAGCATGAAAATGGATGG - Intronic
1064788335 10:18925109-18925131 CTCTGTAACATAGAAATGTAAGG - Intergenic
1064902921 10:20314116-20314138 CTCTGTAAGAAAAAAAGGAAAGG + Intergenic
1065402690 10:25323879-25323901 GTCTATAACATAAAAGTGCAAGG - Intronic
1065439564 10:25737156-25737178 GTCTGTAACATAAAAGTGCAAGG + Intergenic
1065899606 10:30193795-30193817 CTCCATAACATAAAAGTGCAAGG + Intergenic
1065939953 10:30555532-30555554 CTCTGTTACATGTAAATGTAAGG - Intergenic
1066057015 10:31691383-31691405 GTCCGTAACATAAAAGTGCAAGG - Intergenic
1067301815 10:45018507-45018529 CTCTATAACATAAAAGTGCAAGG - Intergenic
1067358154 10:45550399-45550421 GTTTGTAACAGAAAAATCGAAGG + Intronic
1068220309 10:54036127-54036149 CTCCATAACATAAAAGTGCAAGG + Intronic
1068236911 10:54248449-54248471 CTCTTTACAATAAAAATGTAGGG - Intronic
1068319353 10:55391218-55391240 CTCTGTAACATAAAAATTCAAGG - Intronic
1068507725 10:57924264-57924286 CTCTGTATCATATAAATGTCTGG + Intergenic
1068702007 10:60030440-60030462 CTTTGTTACATAAAAGTTGAGGG - Intronic
1069057979 10:63864793-63864815 GTGTGTAACATAAAAAGTGAGGG + Intergenic
1069072981 10:64009314-64009336 CTCTGTAAAATAAAATGGGCTGG - Intergenic
1069319023 10:67144572-67144594 CTCTATAACATAAAAGTGTAGGG - Intronic
1069947097 10:71994849-71994871 CTCCATAACATAAAAGTGCAAGG - Intronic
1070360874 10:75687559-75687581 CTCTGTAACATGAAAGTGCAAGG + Intronic
1071054068 10:81488308-81488330 CACCGTAACATAAAAGTGTAAGG + Intergenic
1071084591 10:81854944-81854966 CTCCATAACATAAAAGTGCAAGG - Intergenic
1071400795 10:85268481-85268503 CTCCATAATATAAAAGTGGAAGG - Intergenic
1071971221 10:90909180-90909202 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1072094747 10:92166987-92167009 CTCCATAACATAAAAGTGCAAGG - Intronic
1072841564 10:98780060-98780082 CTCTATGACAATAAAATGGAGGG + Intronic
1073696263 10:105872275-105872297 CTCTACAACATAAAAATGCAAGG - Intergenic
1073699308 10:105907470-105907492 CTCTGTCTCATAAAAAAGAATGG + Intergenic
1073719174 10:106146805-106146827 ATCTCTTACATAAACATGGATGG - Intergenic
1073775721 10:106783797-106783819 TGCTTTATCATAAAAATGGATGG + Intronic
1074033094 10:109708815-109708837 CTGTTTAACATAAAACTGCAAGG - Intergenic
1074353632 10:112762075-112762097 CTCTCTTAAATAAAAATGGATGG + Intronic
1074671790 10:115799598-115799620 TGCTCTAACATAAAAATTGATGG - Intronic
1074725559 10:116304918-116304940 CTCTGTAAAATAAAAGTGCAAGG - Intergenic
1075370862 10:121933788-121933810 CTATCTCAGATAAAAATGGAGGG + Intergenic
1075431779 10:122390088-122390110 CTCTATAACATAAAAGTGCAAGG - Intronic
1075491367 10:122873018-122873040 CTCCATAACATAAAAGTGCAAGG + Intronic
1075577553 10:123589205-123589227 CTCTGGAACATGCAAAAGGAAGG - Intergenic
1075596556 10:123734632-123734654 CTCCATAACATAAAAGTAGAGGG + Intronic
1075841127 10:125504683-125504705 CTCCATAACATAAAAGTGCAAGG + Intergenic
1075971147 10:126654372-126654394 CTCTATAACATCAAAGTGCACGG - Intronic
1076050214 10:127327378-127327400 CTCCATAACATAAAAGTGCAAGG - Intronic
1076549482 10:131268700-131268722 CTCCATAACATAAAAGTGTAAGG - Intronic
1076808281 10:132870750-132870772 CTCTGTCACATAAAAATGCCAGG + Intronic
1077084812 11:744218-744240 CTCTGTGACCTAGAAGTGGAAGG - Intergenic
1077885608 11:6385431-6385453 CTCTGTCTCAAAAAAAAGGAAGG + Intergenic
1078306956 11:10198773-10198795 CTCTATAACATGAAAGTGCAAGG - Intronic
1078805242 11:14693228-14693250 CTCCATAACATAAAAGTGCAAGG + Intronic
1078820895 11:14880807-14880829 CTCTGTATCTAAAAAATGAAAGG + Intronic
1079132881 11:17759150-17759172 CTCCATAACATAAAAGTGCAAGG - Intronic
1079303635 11:19302927-19302949 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1079325842 11:19491443-19491465 CTCCATAACATAAAAATACAAGG - Intronic
1079466602 11:20736759-20736781 CTCTGTCTCAAAAAAATGAAAGG - Intronic
1080259656 11:30334119-30334141 CTCCATAACATAAAAGTGCAAGG + Intronic
1080527666 11:33143413-33143435 CTGTGTACCACAAAAAGGGATGG + Intronic
1080543961 11:33297580-33297602 CTCCATAACATAAAAGTGCAAGG + Intronic
1082230052 11:49752731-49752753 CTCTATAACCTAAAAGTGCAAGG + Intergenic
1083135238 11:60667735-60667757 CTCCATAACATAAAAATACAAGG + Intergenic
1085269613 11:75262586-75262608 CTCTGTAAGTTGAAAATGGCTGG - Intergenic
1085432830 11:76469758-76469780 CTCTGCCACTTAAAAATGGCAGG - Intronic
1085500567 11:77018871-77018893 CTCCATAACATAAAAGTGCAAGG + Intronic
1085724875 11:78945964-78945986 CTCCATAACATAAAAGTGCAAGG + Intronic
1085845450 11:80059697-80059719 TTCTGTAAAATGAAAAGGGAGGG + Intergenic
1085932530 11:81101526-81101548 TTCAGTTAAATAAAAATGGAAGG + Intergenic
1086258805 11:84912861-84912883 CTCTTGAACAGAGAAATGGATGG + Intronic
1086279328 11:85167854-85167876 TTCTGTAAAATAAAAGTGTAGGG - Intronic
1086471565 11:87118778-87118800 CTCCATAACATAAAAATGCAAGG - Intronic
1086617798 11:88843980-88844002 CTCTGTAACATCAAAGTGCTGGG + Intronic
1086620004 11:88876218-88876240 CTCTATAACCTAAAAGTGCAAGG - Intronic
1086734161 11:90285184-90285206 CACCATAACATAAAAATGCAAGG - Intergenic
1086799598 11:91155342-91155364 ATCTCTAACATACAAATCGAAGG - Intergenic
1086980398 11:93190872-93190894 CTCTGTATACTAAAACTGGAGGG - Intronic
1087577459 11:100007503-100007525 CTTTATAACATTAAAGTGGAAGG - Intronic
1088439633 11:109855482-109855504 CTCTGTAACTTAAAAGTGCAAGG - Intergenic
1088502424 11:110495883-110495905 ATATGTAAAATAAAAATAGATGG + Intergenic
1088961394 11:114669457-114669479 CTCTGCAACACACAACTGGAAGG - Intergenic
1089415302 11:118284278-118284300 CTCTATAACATAAAAGTACAAGG + Intergenic
1090260785 11:125318032-125318054 CTCTATAACATAAAAGTGCAAGG - Intronic
1090813185 11:130265873-130265895 CTCCATAACATAAAAGTGCAAGG + Intronic
1091869719 12:3878922-3878944 CTCCATAACATAAAAGTGCAAGG - Intergenic
1093622776 12:21312223-21312245 CTTTATAACATAAAAGTGCAAGG - Intronic
1093686978 12:22067884-22067906 CTCCATTACATAAAAATGCAAGG - Intronic
1093690863 12:22107230-22107252 CTTTATAACATAAAGATGCAAGG - Intronic
1093883787 12:24436579-24436601 CTCCATAACATAAAAGTGCAAGG + Intergenic
1094022098 12:25925577-25925599 CTCTGTCTCAGAAAAAAGGAAGG + Intergenic
1094031853 12:26021484-26021506 CTCTGTAACTTAAAGCTGGAGGG - Intronic
1095466852 12:42496686-42496708 CTCTCTAACATGAAAGTGCAAGG - Intronic
1095657877 12:44691915-44691937 CTCTATAGCAGAAAAGTGGAAGG + Intronic
1095772414 12:45975489-45975511 CTCCATAACATAAAAGTGCAAGG - Intronic
1095790234 12:46159061-46159083 CTCTGAAGAATGAAAATGGAAGG - Intergenic
1095860554 12:46912434-46912456 CTCTGAAAAATAGAAGTGGAGGG + Intergenic
1095936771 12:47692419-47692441 CTCCATAACATAAAAGTGGAAGG - Intronic
1096290115 12:50335093-50335115 CTCTGCAAAATAAAAATAGCTGG + Intronic
1096776554 12:53967808-53967830 GTCTGTGACATAAAATTGGCAGG + Intergenic
1097328535 12:58307087-58307109 CTCTATAACATAAAAGTGCAAGG + Intergenic
1097788519 12:63788518-63788540 CTCCATAACATAAAAATGCAAGG - Intronic
1097891827 12:64784373-64784395 GTCTGTAACAAACAAATGCAGGG - Intronic
1098344484 12:69486948-69486970 CTATGTAACATAAAAGTGCAAGG + Intronic
1098498023 12:71159466-71159488 CTCTGTAACACAAAAATCAATGG + Intronic
1098712761 12:73786541-73786563 TTCTGTAACAGAAAAGTGCAAGG - Intergenic
1098921723 12:76308671-76308693 CTCTATAACATCAAAGTGCAAGG - Intergenic
1098936764 12:76489184-76489206 CTCTATAACATCAAAATGCAAGG + Intronic
1099474208 12:83088110-83088132 CTCTATAATATAAAAATGCCAGG - Intronic
1099503035 12:83437200-83437222 CTGTATAACATAAAAATGTAAGG - Intergenic
1099550428 12:84037060-84037082 CTCAGAAACATAACAATAGAAGG - Intergenic
1100516390 12:95332269-95332291 CTCTGTAATATAAAGGTGCAAGG - Intergenic
1100589936 12:96017467-96017489 ATCTTTAACATAAAAATACAAGG + Intronic
1100618780 12:96251837-96251859 CTCCATAACATAAAAGTGCAAGG + Intronic
1100774940 12:97963589-97963611 TTGTGTAATATATAAATGGAAGG + Intergenic
1100922909 12:99509646-99509668 CTCCATAACATAAAAGTGCAAGG + Intronic
1101620537 12:106383046-106383068 CTCCATAACATAAAAGTGCAAGG - Intronic
1101872247 12:108575570-108575592 CTCCATAACATAAAAGTGCAAGG - Intergenic
1104096413 12:125562127-125562149 CTTTGTAACATAAAAGTACAAGG - Intronic
1104395784 12:128431376-128431398 CTCCATAACATAAAAGTGCAAGG + Intronic
1104534024 12:129601157-129601179 CTCTATGACATAAAAGTGCAAGG - Intronic
1105061490 12:133155568-133155590 TCCTGTGACATTAAAATGGAAGG + Exonic
1105324999 13:19362747-19362769 CTCCATAACATAACAATGGAAGG - Intergenic
1105337672 13:19488537-19488559 CTCTATAACATAAAAGTGCAAGG - Intronic
1105746962 13:23386357-23386379 CTTTATAACATAAAAGTGCAAGG - Intronic
1108632964 13:52303935-52303957 CTCCATAACATAAAAGTGCAAGG - Intergenic
1108653727 13:52508620-52508642 CTCCATAACATAAAAGTGCAAGG + Intergenic
1108845034 13:54667798-54667820 CTATATAACATAAAAGTGCAAGG - Intergenic
1108916695 13:55622842-55622864 CTCTATAACACAAAAATGCAAGG + Intergenic
1109056645 13:57558286-57558308 CTCTGTAAAATAAACATGCCAGG - Intergenic
1109265807 13:60198986-60199008 CTCCGTAATATAAAAGTGCAAGG - Intergenic
1109375764 13:61490612-61490634 CTCTGTAAAACAAATGTGGAAGG - Intergenic
1109575861 13:64257482-64257504 CTCTGAAAAATGAAAATGTAAGG + Intergenic
1110447288 13:75600201-75600223 CTCCATAACATAAAAGTGCATGG + Intronic
1110737560 13:78955301-78955323 CTCTATAACATAAAAGTGCAAGG - Intergenic
1111163645 13:84428142-84428164 CTCCATAACATAAAAATGCAAGG + Intergenic
1111599560 13:90454885-90454907 CTGGATAAAATAAAAATGGATGG - Intergenic
1111774710 13:92644873-92644895 TACTGTAAAAAAAAAATGGAAGG + Intronic
1111787357 13:92806174-92806196 CTCCGTAACATAAAAGTGCAAGG - Intronic
1112357567 13:98686778-98686800 CTCTTTACTATAAAAATTGATGG + Intronic
1112543916 13:100345546-100345568 CTCCATAACATAAAAGTGGAGGG + Intronic
1112653392 13:101422503-101422525 CTCCGTAACATAAAAATATGAGG - Intergenic
1112840989 13:103577862-103577884 CTCTGTAACAATATAATGCATGG + Intergenic
1113045053 13:106146585-106146607 CACTGCAAAATAAAAATGCAGGG + Intergenic
1113137521 13:107109675-107109697 CTCTATAACATAAAAGTGTAAGG - Intergenic
1113345703 13:109476384-109476406 CTCTGATTCATAAAAATGGTAGG - Intergenic
1113649034 13:112021310-112021332 CTCCATAACATAAAAGTGCAAGG + Intergenic
1113695076 13:112339746-112339768 CTCCATAACATAAAAGTGCAAGG + Intergenic
1113722639 13:112571822-112571844 CTCCATAACATAAAAATGCAAGG - Intronic
1114042938 14:18695476-18695498 CTCTATAATATGAAAATGCAAGG - Intergenic
1114047230 14:18885916-18885938 CTCTATAATATGAAAATGCAAGG - Intergenic
1114116985 14:19633481-19633503 CTCTATAATATGAAAATGCAAGG + Intergenic
1114625584 14:24127483-24127505 CTCCATAACATAAAAATGCAAGG - Intronic
1114734328 14:25028050-25028072 CTCTATGACATAAAATTGCAAGG + Intronic
1114786169 14:25602034-25602056 CTGTGTATCATAAATATTGAAGG - Intergenic
1115136352 14:30113268-30113290 CTCTATAACATAAAAGTGGAAGG + Intronic
1115280463 14:31656064-31656086 CTCTATAACATAAAAGTACAAGG - Intronic
1115379108 14:32713598-32713620 CTCCATAACATAAAAGTGCAAGG - Intronic
1115398812 14:32936989-32937011 CAATATAACATAAAAATCGAAGG - Intronic
1115621965 14:35149513-35149535 CCCCATAACATAAAAATGCAAGG - Intronic
1115896992 14:38101582-38101604 CTCCATAACATAAAAGTGAAAGG + Intergenic
1116070803 14:40042835-40042857 GTCTGTAACATATGAATTGAAGG - Intergenic
1116261517 14:42634310-42634332 CTGTGTAATATAAATATGGGAGG - Intergenic
1116277290 14:42851801-42851823 CTCTATAACATAAAAGTGCAAGG - Intergenic
1116476150 14:45342119-45342141 CTCCATAACATAAAAGTGAAAGG - Intergenic
1117074198 14:52085216-52085238 TTCTATAACATAAAAGTGCAAGG - Intergenic
1117100032 14:52336040-52336062 CACTGTTACAGAAAAATGAAGGG + Intergenic
1117201731 14:53396782-53396804 CTTTGTAACGTAAAAGTGCAAGG + Intergenic
1117231286 14:53721568-53721590 CTCCATAACATAAAAGTGCAAGG + Intergenic
1117263389 14:54060266-54060288 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1118176664 14:63447368-63447390 CTCTCTAACATAAAAGTGCAAGG - Intronic
1118527063 14:66657320-66657342 CTCTGTAACATAAAAGTACAAGG + Intronic
1119091625 14:71787578-71787600 CTCTATAACGTAAAAGTGCAAGG + Intergenic
1119368175 14:74113383-74113405 CTCTGTCTCAAAAAAAAGGAAGG + Intronic
1119739036 14:77001907-77001929 CTCTGTCTCAAAAAAATAGACGG + Intergenic
1119883320 14:78119426-78119448 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1120118850 14:80653396-80653418 CTCTATAATACAAAAATGCAAGG + Intronic
1120361683 14:83512439-83512461 TTCTGTATATTAAAAATGGAAGG - Intergenic
1120544162 14:85789862-85789884 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1120786958 14:88546862-88546884 CTCTGTAGCATATAAACAGATGG - Intronic
1121998041 14:98620901-98620923 CTCCAAAACATAAAAATGCAAGG + Intergenic
1122170503 14:99870365-99870387 CTCCATAACATAAAAGTGCAAGG + Intronic
1122522812 14:102357731-102357753 CTCCATAACATAAAAGTGCAAGG + Intronic
1122734114 14:103825709-103825731 CTCTGTATCATAAAAGTGCAAGG + Intronic
1124461069 15:29892326-29892348 CTCCGTAACATAAAAGTGCAAGG + Intronic
1124950379 15:34313509-34313531 CTCCAAAACATAAAAATGCAAGG + Intronic
1126684708 15:51238493-51238515 CTCTGTCTCAAAAAAAAGGATGG - Intronic
1126711075 15:51456797-51456819 ATCTGTAAAATGATAATGGAGGG + Intronic
1127081379 15:55383679-55383701 GTCCGTAACATAAAAGTGCAAGG - Intronic
1127447079 15:59074464-59074486 CTCTATAAGATAAAAGTGCAAGG - Intronic
1127902731 15:63353201-63353223 GGCTGCAACAGAAAAATGGAGGG + Intronic
1128173947 15:65537191-65537213 CTCCATAACATAAAAGTGCAAGG + Intronic
1129049213 15:72764539-72764561 CTCCACAACATAAAAATGCAAGG + Intronic
1129499365 15:76020858-76020880 CTCCATAACATAAAAGTGCAAGG + Intronic
1129575375 15:76737787-76737809 CTCAATAACATAAAAGTGCAAGG - Intronic
1129713075 15:77831265-77831287 CTCTGTATCAAAAAAAAGGGAGG - Intergenic
1130301685 15:82684329-82684351 CTCCATAACAAAAAAATGCAAGG - Intronic
1130852510 15:87809190-87809212 CTGTTTAGCCTAAAAATGGAAGG - Intergenic
1131042770 15:89287273-89287295 CTCCATAACATAAAAGTGCAAGG - Intronic
1131898685 15:97063500-97063522 CTCCATAACATAAAAGTGCAAGG + Intergenic
1132475299 16:132971-132993 CTCTATAACGTAAAAGTGCAAGG - Intronic
1133388672 16:5391351-5391373 CTCTCAAAGATGAAAATGGAAGG - Intergenic
1133445408 16:5856660-5856682 CTCTATAACATAAAAATGCAAGG - Intergenic
1133474289 16:6105189-6105211 AACAGTAACTTAAAAATGGAGGG - Intronic
1133512891 16:6477881-6477903 ATCTGTAACATGCAAGTGGAAGG - Intronic
1133587213 16:7207633-7207655 CTCTGCAACCTAAAGAAGGATGG + Intronic
1134751762 16:16630796-16630818 CTCTGTCAAAAAAAAAAGGAAGG - Intergenic
1135766467 16:25181618-25181640 CTCCATAACATAAAAGTGCAAGG + Intergenic
1135832139 16:25784716-25784738 CTCCATAACATAAAAATGCGAGG + Intronic
1135962383 16:27007413-27007435 CTCAGAAACATAAGAATAGAAGG + Intergenic
1136025651 16:27466977-27466999 CTCCGTAACATAAAAGTAAAAGG + Intronic
1137234088 16:46598885-46598907 TTCTGTAACATAAAAGTGCAAGG - Intronic
1137454230 16:48605974-48605996 TTCTGTAACACAGGAATGGAAGG - Intronic
1137864651 16:51880675-51880697 CTCTGTAAAATGTAGATGGATGG - Intergenic
1138255432 16:55554378-55554400 CTCCATAACATAAAAGTGCAAGG - Intronic
1139059172 16:63227591-63227613 TTCTATAACATAAAAGTGCAAGG - Intergenic
1140006352 16:71079910-71079932 AGCTGGAACATTAAAATGGAAGG + Exonic
1140162530 16:72512967-72512989 CTCCGTAACATGAAAGTGCAAGG - Intergenic
1141754476 16:85982335-85982357 ATCTTTCACATAAAAAGGGATGG + Intergenic
1141777051 16:86130944-86130966 CTCCATAACATAAAAGTGCAAGG - Intergenic
1142908722 17:3068596-3068618 CTCCATAACATAAAAGTGCAAGG - Intergenic
1142925842 17:3235649-3235671 CTCCATAACATAAAAGTGCAAGG + Intergenic
1143074741 17:4331698-4331720 CTCTGAAAGATGAAAACGGATGG + Intronic
1144492559 17:15727009-15727031 TTCTGTAACATGAAAATACAAGG + Intergenic
1144530748 17:16036623-16036645 CTCTGTAACATAAAAGTGCAAGG - Intronic
1144694409 17:17292315-17292337 CTCTGTCTCAAAAAAAAGGAGGG - Intergenic
1144706896 17:17374733-17374755 CTCCATAACATAAAAGTGCAAGG + Intergenic
1144781582 17:17810905-17810927 CTATGTAACATATATATAGAGGG - Exonic
1144907694 17:18649652-18649674 TTCTGTAACATGAAAATACAAGG - Intronic
1145717526 17:27036191-27036213 CTCTATAATATAAAAGTGCAAGG - Intergenic
1145967257 17:28928520-28928542 CTCTGTATTATAAAAATACAAGG - Intronic
1146042935 17:29474037-29474059 CTCCGTAAAATAAAAATGCAAGG - Intronic
1146412627 17:32600549-32600571 CTCCATAACATAAAAGTGCAAGG - Intronic
1146838230 17:36129682-36129704 CTCCATAACATAAAAGTGCAAGG + Intergenic
1147134358 17:38426696-38426718 TTCTGTTTCATAATAATGGAGGG - Intergenic
1147231170 17:39019187-39019209 CTCTGTAACATAAAGGTGTAAGG + Intergenic
1149192122 17:54075496-54075518 CTCCATAACATAAAAGTGCAAGG + Intergenic
1149377326 17:56058393-56058415 CTTTGTAACATAAAAGTGCAAGG - Intergenic
1149809320 17:59652972-59652994 CTCTATAACATAAAAGTGCAAGG - Intronic
1150113785 17:62526399-62526421 CTCAGTAACATAAAAAAGGAAGG - Intronic
1150198711 17:63330266-63330288 CTCCATAACATAAAAGTGCAAGG + Intronic
1150468090 17:65412295-65412317 CTCTTTAACATAAAAATATAAGG - Intergenic
1150509308 17:65732681-65732703 CTCCATAACATAAAAATGCAAGG - Intronic
1150766858 17:68009198-68009220 CTCTGTTACTTAAAAGAGGAAGG - Intergenic
1150866722 17:68858396-68858418 CTCCATAACATAAAAGTGCAAGG + Intergenic
1150930597 17:69580559-69580581 ATCATTAACATAGAAATGGAAGG + Intergenic
1152434541 17:80267703-80267725 CTCCATAACATAAAAGTGCAAGG + Intronic
1152812494 17:82388666-82388688 CTCCCATACATAAAAATGGACGG + Intergenic
1152972008 18:171106-171128 CTCTGTAACATAAAAGTGCAAGG + Intronic
1152979031 18:255580-255602 CTCCGTAACATAATAGTGCAAGG + Intronic
1153112554 18:1609578-1609600 ATGTGTTACATAAAAATGAAGGG - Intergenic
1153287992 18:3474062-3474084 CTCCATAACATAAAAGTGCAAGG + Intergenic
1153566366 18:6422219-6422241 CTCCATAACATAAAAGTGCAAGG - Intergenic
1153751459 18:8235881-8235903 ATCAGTAACATGAAAATGGCTGG - Intronic
1153859714 18:9189344-9189366 CTCCATAACATAAAAGTGCAAGG + Intronic
1153871768 18:9327847-9327869 CTCCATAACATAAAAGTGCAAGG + Intergenic
1153976988 18:10277997-10278019 CTCTGTAACATAAAAGTATAAGG - Intergenic
1154129213 18:11722500-11722522 CACTGTACCATAAAGATGGGAGG + Intronic
1154304952 18:13223808-13223830 CTCTGTAACATGCAGATGGCAGG - Intronic
1155461220 18:26086038-26086060 TTCTGAAAAAAAAAAATGGATGG + Intronic
1155511944 18:26586912-26586934 CTCCGTAACATGAAAGTGCAAGG + Intronic
1155774401 18:29740581-29740603 CTCTCTAAAATAAAAATATAAGG + Intergenic
1155818838 18:30349611-30349633 AACTGTAAAATAAAAATGTAAGG + Intergenic
1155904491 18:31433051-31433073 CTCAGTAAACTAAAAATAGAGGG + Intergenic
1156110679 18:33722626-33722648 CTCTATAACCTAAAAGTGCAAGG + Intronic
1156223613 18:35079932-35079954 ATCTGTAACATTAAAATTCAAGG + Intronic
1156288043 18:35718747-35718769 CTCCATAACATAAAAGTGTAAGG + Intergenic
1156607452 18:38682800-38682822 CACTGAAGCAGAAAAATGGATGG + Intergenic
1157804204 18:50646053-50646075 CCCTGTGGGATAAAAATGGAAGG + Intronic
1158212024 18:55062182-55062204 CTCCATAACATAAAAGTGCAAGG - Intergenic
1158790365 18:60773440-60773462 CTCCATAACATAAAAGTGCAAGG - Intergenic
1159303694 18:66612106-66612128 CTCTGTGTCAGAAAACTGGAGGG + Intergenic
1159514451 18:69439586-69439608 CTCTATAACACAAAAGTGAAAGG - Intronic
1160142776 18:76340072-76340094 CAGTGTAAAATGAAAATGGAGGG - Intergenic
1164490155 19:28703402-28703424 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1164901157 19:31925485-31925507 CTCTATAACATAAAAGTACAAGG - Intergenic
1164940198 19:32246489-32246511 CTCCATAACATAAAAGTGCAAGG + Intergenic
1165602739 19:37071237-37071259 TACTGTACCATAAAAATGAATGG + Intronic
1165644339 19:37421471-37421493 CTCCATAACATAAAAATACAAGG - Intronic
1165687624 19:37835836-37835858 CACTGTAACATCAAAATGCTGGG + Intergenic
1165967903 19:39599515-39599537 CTATTTAACATAATATTGGAAGG + Intergenic
1166392346 19:42416034-42416056 CTCTGTAACATAAAAGTGCAGGG + Intronic
1167636143 19:50656943-50656965 CTCTGTCAAAAAAAAAAGGAAGG + Intronic
1168468753 19:56624547-56624569 CTCTTTAGCAGCAAAATGGAGGG + Exonic
1168652965 19:58104793-58104815 CTCCGTAACATAAAAGTGCAAGG + Intronic
1202646685 1_KI270706v1_random:148338-148360 CTCTGTCTCAAAAAAAAGGAGGG + Intergenic
924989710 2:302201-302223 CTCTATAACATAGAAGTGCAAGG + Intergenic
925215494 2:2091795-2091817 CTCTGTAACATAAAAGTGCAAGG - Intronic
925562225 2:5209300-5209322 CTCTATAAAATAAACATGCAAGG + Intergenic
926374487 2:12212952-12212974 CTCTGCAAAATAACAATGGCAGG - Intergenic
926469756 2:13239030-13239052 CTGTATAACATAAAAGTGCAAGG - Intergenic
926722226 2:15969385-15969407 CTCCGTAACATAAACGTGCAAGG - Intergenic
926895334 2:17681097-17681119 CTTTGTAATATAAAAGTGCAAGG - Intronic
926971500 2:18471773-18471795 CTCTTTAAAAAAAAAAAGGAGGG - Intergenic
926979188 2:18549093-18549115 CTCTGCAACATTAAAGTGCAAGG + Intergenic
927324578 2:21789428-21789450 CTCCATAACATAAAAGTGCAAGG - Intergenic
927553933 2:24019720-24019742 CTCTGCAAAATGAAAATGAAGGG + Intronic
927616667 2:24604525-24604547 CTCCATAACATAAAAGTGCAAGG - Intronic
927755462 2:25705026-25705048 CTCTATAACATAAAAGTGCAAGG + Intergenic
927822848 2:26283919-26283941 CTCTGCAACATAAGAGTAGAGGG + Intronic
928792021 2:34968906-34968928 CTTTATAACATAAAAATACAAGG - Intergenic
929749926 2:44700075-44700097 TTCTGTAACACAAAAGTGCAAGG - Intronic
929866840 2:45724874-45724896 CTCCATAACATAAAAGTGCAAGG + Intronic
929939136 2:46317832-46317854 CTCCATAACATAAAAATGCAAGG - Intronic
930559263 2:52939872-52939894 CTCTACAACATAAAAGTGCAAGG + Intergenic
930613226 2:53566117-53566139 CTCTTAAAGATAAAAAGGGAAGG - Intronic
931022387 2:58062777-58062799 CTCCAAAACATAAAAATGGAAGG + Intronic
932175327 2:69595639-69595661 CTCTATTACATAAAAGTGCAAGG + Intronic
932186069 2:69697237-69697259 CTCTATAACATAAAAGTGCAAGG - Intronic
932950987 2:76293131-76293153 CTCTGTAACATAAGAGTGCAAGG - Intergenic
933075930 2:77926665-77926687 CTCCGTAATATAAAAGTGCAAGG - Intergenic
933301996 2:80551550-80551572 CTCCATAACATAAAAGTGCAAGG - Intronic
933328356 2:80866755-80866777 CTTTATAACATAAAAGTGCAAGG - Intergenic
933414260 2:81965781-81965803 TTCCATAACATAAAAATGCAAGG + Intergenic
933473408 2:82757225-82757247 CTCGGTAAGTTAAAAATAGAGGG - Intergenic
933626682 2:84608985-84609007 CACTGTAACATAAAAGGGCAAGG - Intronic
933627145 2:84613856-84613878 CTCTATTACATTAAAATGGGGGG - Intronic
933873635 2:86595896-86595918 CTCTGTAACGTAAAAGTGTAAGG + Intronic
934061698 2:88300334-88300356 CTCCATAACATAAAAATGCAAGG + Intergenic
934626741 2:95864378-95864400 CTCAGTAACATAAGAATCCAAGG + Intronic
934806816 2:97236913-97236935 CTCAGTAACATAAGAATCCAAGG - Intronic
934830693 2:97520262-97520284 CTCAGTAACATAAGAATCCAAGG + Intronic
935388105 2:102522384-102522406 CACTATAACACAGAAATGGAGGG + Intronic
935565660 2:104604306-104604328 CTCTATAACATAAAAGTGCAAGG + Intergenic
935776243 2:106474709-106474731 CTCTATAACACAAAAGTGCAAGG - Intergenic
935796870 2:106650917-106650939 CTCCATAACATAAAAATGCAAGG - Intergenic
935818963 2:106874664-106874686 CTCTTTAAGAAAAAAATTGAGGG - Intronic
935974330 2:108562668-108562690 CTCCGAAACATAAAAGTGCAAGG + Intronic
936079905 2:109425264-109425286 CTCTGCAACATAAAAGTACAAGG + Intronic
936257019 2:110925465-110925487 CTCTATAGCATAGAAATGCAAGG - Intronic
937461668 2:122094218-122094240 CTCCATAACATAAAAGTGCAAGG - Intergenic
937523087 2:122735213-122735235 CTTAGTAACATAAATATGTATGG + Intergenic
937695062 2:124799821-124799843 CTTTCTAAGATAAAAATAGAAGG + Intronic
937767077 2:125674015-125674037 CTCCATAACATAAAAGTGAAAGG + Intergenic
937979231 2:127604242-127604264 TTCTATAACATAAAAGTGCAAGG - Intronic
938158681 2:128963419-128963441 CTCCATAACATAAAAGTAGAAGG + Intergenic
938424609 2:131174458-131174480 CTCTATAATATGAAAATGCAAGG - Intronic
938960669 2:136337915-136337937 CTCCATAACATAAAAGTGCAAGG + Intergenic
939052744 2:137328445-137328467 CACTGTAAAATAAAAATAAAAGG - Intronic
939097366 2:137849370-137849392 ATCTGTGACACAAAAATGAAGGG + Intergenic
939509192 2:143085670-143085692 CTCCATAACATAAAACTGTAAGG + Intergenic
939653324 2:144790906-144790928 CTCTATAACATAAAAGTGCAAGG - Intergenic
939704739 2:145438793-145438815 CTCCATAACATAAAAGTGCAAGG - Intergenic
939711426 2:145525169-145525191 ATATATAATATAAAAATGGATGG - Intergenic
939786933 2:146526334-146526356 CTCAGTAACATAAAAGTGTAAGG + Intergenic
939817431 2:146912977-146912999 CTTTATAACATAAAAGTGCAAGG + Intergenic
940108565 2:150125645-150125667 CCCTGGTACATAAAAATGGTGGG - Intergenic
940126825 2:150335310-150335332 CTCTGTAACATACAAGTACAAGG + Intergenic
940184763 2:150971681-150971703 CTCTATAACATAAAAGTGCAAGG - Intergenic
940338050 2:152548883-152548905 CTCTGCAACAAAAAAAGTGAGGG + Intronic
940399899 2:153236222-153236244 CTCCATAACATAAAAGTGCAAGG + Intergenic
940919557 2:159292000-159292022 GTTTGTAACTTAAAAAGGGAAGG + Intergenic
941386180 2:164855226-164855248 CTCTCTAACATAAAACTGCAAGG - Intergenic
941433931 2:165444927-165444949 CTCTATACCATAGAAATGCAAGG + Intergenic
942050910 2:172140021-172140043 CTCCATAACATAAAAGTGCAAGG + Intergenic
942110341 2:172675662-172675684 CTCTATAACATAAAAGTGCAAGG + Intergenic
942534244 2:176946484-176946506 CTCCATAACATAAAAGTGCAAGG + Intergenic
942666856 2:178328858-178328880 ATCTGTAATATACATATGGAGGG + Intronic
943123399 2:183766205-183766227 CTCTGTAACATAAAAGGGCAAGG - Intergenic
943292866 2:186097521-186097543 CTCCATTACATAAAAATGCAAGG + Intergenic
943610376 2:190026247-190026269 CTCTGTCACATAAAGCTGGGGGG - Intronic
943851244 2:192725304-192725326 CTCTATAACATAAAAGTGCAAGG - Intergenic
944008165 2:194937439-194937461 CTAAGTAAAATAAAGATGGATGG + Intergenic
944025943 2:195167157-195167179 CTCCATAACATAAAAATGCAAGG + Intergenic
944255769 2:197622179-197622201 CTCCATAACATAAAATTGCAAGG + Intronic
944449245 2:199824196-199824218 CTCCATAACATAAAAGTGCAAGG - Intronic
945442852 2:209901020-209901042 CTCCATAACATAAAAGTGCAAGG + Intronic
945652291 2:212577889-212577911 CTCCATAACATAAAAATGCAAGG - Intergenic
945690881 2:213034033-213034055 CTCTATAACATAAAAGTGCAAGG - Intronic
946524267 2:220501217-220501239 CTCCATAACATAAAAGTGCAAGG + Intergenic
946575272 2:221068834-221068856 CTCCGTACCATAAAAGTGCAAGG + Intergenic
947812397 2:233012732-233012754 CTGTGCAATATAAAAATGCAGGG - Exonic
948080160 2:235199112-235199134 CTGTGGAACATAAAAAAGGGAGG + Intergenic
948444179 2:238019382-238019404 CTCTGTATCAAAAAAAAGGCAGG - Intronic
948955091 2:241283293-241283315 CTCTCTAACATGAAAGTGCACGG + Intronic
1169257482 20:4110245-4110267 CTGTGCAAAATGAAAATGGAGGG + Intergenic
1169322263 20:4643102-4643124 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1169535144 20:6530765-6530787 CTCCATAACATAAAAGTGCAAGG - Intergenic
1169750739 20:8990756-8990778 CTCCATAACATAAAAGTGCAAGG - Intergenic
1170272260 20:14540425-14540447 CTGTTTAATATAAAAATAGAAGG - Intronic
1170334959 20:15259582-15259604 TTCTCTAACATATAAATGTATGG - Intronic
1172236242 20:33377401-33377423 CTCTCTAACATCAAAGTGCAAGG - Intronic
1173942029 20:46919447-46919469 CTTTATAACATAAAAGTGCAAGG - Intronic
1174025654 20:47572027-47572049 CTACATAACATAAAAATGAAAGG - Intronic
1174673231 20:52328045-52328067 CTCCATAACATAAAAATGCAAGG + Intergenic
1175088323 20:56480241-56480263 CTCCATAACATAAAAGTGCAAGG - Intronic
1175167934 20:57059070-57059092 TTCTGTAACATAAAAGTGTAAGG - Intergenic
1176338668 21:5622532-5622554 CTCTGTAACAACAAAACTGAAGG + Intergenic
1176340076 21:5685605-5685627 CTCTGTAACAACAAAACTGAAGG + Intergenic
1176472330 21:7117758-7117780 CTCTGTAACAACAAAACTGAAGG + Intergenic
1176495891 21:7499536-7499558 CTCTGTAACAACAAAACTGAAGG + Intergenic
1176504751 21:7638851-7638873 CTCTGTAACAACAAAACTGAAGG - Intergenic
1176605184 21:8824426-8824448 CTCTGTCTCAAAAAAAAGGAGGG - Intergenic
1177167573 21:17619819-17619841 CTCCATAACATAAAAGTGCAAGG - Intergenic
1177297550 21:19196532-19196554 ATCAGTAAAACAAAAATGGAAGG + Intergenic
1177331458 21:19669593-19669615 TTCTATAACATAAAAGTGCAAGG - Intergenic
1177335672 21:19722902-19722924 CTCTAAAACATAAAAGTGAAAGG - Intergenic
1177390063 21:20456837-20456859 CTGTGTAAAATAAGAATAGAAGG - Intergenic
1177404552 21:20647929-20647951 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1177432929 21:21013842-21013864 CTCCATAACATAAAAGTGCAAGG + Intronic
1177461404 21:21415693-21415715 CTTTATAACATAAAAATACAAGG - Intronic
1177468633 21:21524522-21524544 CTCTGTAACAAAAAAAAAGGGGG + Intronic
1177472875 21:21581379-21581401 CTCTATAACCTAAAAGTGCAAGG + Intergenic
1178181032 21:30161808-30161830 ATCTTTAACATATAAATGGGGGG + Intergenic
1178195951 21:30345321-30345343 CTCTATAACATAAAAGTGCAAGG + Intergenic
1178354023 21:31895568-31895590 CTCTGTCACACAGAGATGGATGG - Intronic
1178382015 21:32118128-32118150 CTCTATAACATAAAAGTAGGAGG - Intergenic
1179111576 21:38450742-38450764 CTCTGAAATATGAAAATGAAAGG + Intronic
1179360254 21:40699803-40699825 CTTTATAACATACAAATGCATGG + Intronic
1179429133 21:41307192-41307214 CTCCGTAACACAAAAGTGAAAGG - Intronic
1179877856 21:44280446-44280468 CTCTGTCTCAAAAAAAAGGAGGG - Intergenic
1179962216 21:44774354-44774376 CTCTTTTACATAAAATTGGGAGG + Intronic
1180113374 21:45677446-45677468 CTCCGTAACATAAAAGTGCAAGG + Intronic
1180347477 22:11716031-11716053 CTCTGTCTCAAAAAAAAGGAGGG - Intergenic
1180465763 22:15608571-15608593 CTCTATAATATGAAAATGCAAGG - Intergenic
1180900129 22:19365174-19365196 CTCTATAACATAAAACGGCAAGG + Intronic
1183268039 22:36842266-36842288 CTCCATAACATAAAAGTGCAAGG + Intergenic
1183612502 22:38919505-38919527 CTCCATAACATAAAAGTGCAAGG - Intergenic
1183681393 22:39332072-39332094 CTCCATAACATAAAAGTGCAAGG - Intergenic
1183757929 22:39787763-39787785 CTCCCTAACATAAAAATACAAGG + Intronic
1183949148 22:41343164-41343186 CTCTGTCTCAAAAAAAAGGAGGG + Intronic
1184008424 22:41728403-41728425 TTCTGTGACATAACAAGGGAAGG - Intronic
1184624316 22:45711455-45711477 CTCTGTAACTTAATAATGCAGGG - Intronic
1203239344 22_KI270733v1_random:62-84 CTCTGTAACAACAAAACTGAAGG + Intergenic
949306635 3:2649124-2649146 CTCCTTAACATAAAAGTGCAAGG + Intronic
949411944 3:3775171-3775193 CTCCATAACATAAAAGTGCAAGG + Intronic
949419340 3:3849082-3849104 CTGTGAACCATGAAAATGGATGG + Intronic
949623189 3:5839011-5839033 CTCCATAATGTAAAAATGGAAGG - Intergenic
949626464 3:5872319-5872341 CTCTATAACATAAAAGTGCAAGG + Intergenic
950517181 3:13474940-13474962 CTCTGTAACAACAAAATGCAGGG + Intergenic
950632510 3:14292421-14292443 TTCTGTAACATGAAAGTGCAAGG + Intergenic
950838549 3:15944258-15944280 CTCCATAACATAAAAGTGCAAGG + Intergenic
950928094 3:16763267-16763289 CTCCGTAACATAAAAGTGTGAGG - Intergenic
950976262 3:17248940-17248962 CTCTGTAACATTAAAGTGCAAGG - Intronic
951102061 3:18699954-18699976 ATCTTTATCATACAAATGGAAGG - Intergenic
951306666 3:21071681-21071703 CTCTATAACATAAAAGTGCAAGG + Intergenic
951313184 3:21155529-21155551 CCCTGTAACATAAAAGTTCAAGG - Intergenic
952015697 3:28954343-28954365 CTCTATAACATAAAAGTTCAAGG + Intergenic
952365407 3:32670377-32670399 CTCCATAACATAAAAGTGCAAGG - Intergenic
953121718 3:40050042-40050064 CTCTATAACATAAAAGTGCAAGG + Intronic
953335891 3:42093706-42093728 CTCTGTAAAAAAAAAAAGGAAGG - Intronic
953591947 3:44266071-44266093 CTCTGTAACATAGAAGTGCAAGG - Intronic
954503506 3:51044760-51044782 CTCCACAACATAAAAATGCAAGG - Intronic
954944644 3:54409882-54409904 CTGTATAACATAAAAGTGCAAGG + Intronic
955290411 3:57687432-57687454 CTCCATAACATAAAAGTGCAAGG + Intronic
955679445 3:61485384-61485406 CTCCATAACATAAAAGTGCAAGG - Intergenic
955969854 3:64427578-64427600 CTCTATAACATAAAAGTGTAAGG + Intronic
956063502 3:65372758-65372780 CTCCGTAACATAAAAGTATAAGG - Intronic
956163110 3:66375259-66375281 CTCTGTAACACAGAAGTGTAAGG + Intronic
956451829 3:69382480-69382502 ATCTGTGACATTAAAATGGGAGG - Intronic
956510723 3:69990063-69990085 CCCTGAAACATAAAAATTCATGG + Intergenic
956658802 3:71580530-71580552 CTCTGGAACAGAAAAATAGCAGG + Intronic
957126267 3:76165276-76165298 CTCCATAACATAAAAACGCAAGG - Intronic
957126318 3:76165862-76165884 CTCCATAATATAAAAATGCAAGG + Intronic
957525599 3:81375123-81375145 CTCTGGGACAGAAAAGTGGAAGG - Intergenic
957536077 3:81505451-81505473 CCATGTAACATAAAAAGGGAAGG - Intronic
957563858 3:81860133-81860155 CTCTGAAACATAAATATTTATGG + Intergenic
957569951 3:81933949-81933971 CTCTGGAATATAAAAATGCATGG - Intergenic
957955713 3:87184386-87184408 CTCTATAACATAATATTGCAAGG - Intergenic
958058552 3:88446518-88446540 CTCTGGACCCTAAAAAAGGAAGG - Intergenic
958698803 3:97561595-97561617 CTCTGTAACATAAAAGTGCAAGG + Intronic
958702191 3:97606815-97606837 CTCTACAACAGAAACATGGAAGG + Intronic
958718249 3:97813596-97813618 CTCCGTAACATCATAGTGGAAGG - Intergenic
959014425 3:101117179-101117201 CTCCATAACATAAAAGTGCAAGG + Intergenic
959290997 3:104474400-104474422 CTCCATAACATAAAAGTGCAAGG + Intergenic
959390372 3:105765037-105765059 CTCTCTAACATAAAAGTGCAAGG + Intronic
961411566 3:126725756-126725778 CTCCATAACATAAAAGTGCAAGG - Intronic
961733135 3:128982269-128982291 CTCCATAACATAAAAGTGTAAGG - Intronic
962028957 3:131578886-131578908 CTCTGTAACATAAAAGTGTAAGG + Intronic
962280408 3:134048058-134048080 AACTGTAAAATAAAAATGCAAGG + Intronic
962836156 3:139190457-139190479 CTCTATAACATAAAAGTGCAAGG - Intronic
963195269 3:142520788-142520810 CTCTATAACATAAAAGTGTAAGG + Intronic
963293185 3:143514624-143514646 CTCCATAACATAAAAGTGCAAGG - Intronic
963608757 3:147438789-147438811 CTCTATAACATAAAAGTGCAAGG - Intronic
964260508 3:154830325-154830347 ATCTGCACCATAAAAATGAATGG + Intergenic
964324482 3:155531733-155531755 CTCCATAACATAAAAGTGCAAGG - Intronic
964398779 3:156276631-156276653 CTCCATAACATAAAAGTGCAAGG - Intronic
964813627 3:160693047-160693069 CTCTGTAACATAGAAGTGCAGGG + Intergenic
965066945 3:163861835-163861857 CTCCATAACATAAAAGTGCAAGG + Intergenic
965363316 3:167766897-167766919 CTCCGTAACATAAAAGCGTATGG + Intronic
965438719 3:168686210-168686232 CTCCATAACATAAAAGTGCAAGG + Intergenic
965454306 3:168878700-168878722 CTATGTGACATAAAAATACATGG - Intergenic
965628830 3:170709600-170709622 CTCCATAACATAAAAGTGCAAGG + Intronic
965631835 3:170740998-170741020 TTCTGGTACATCAAAATGGAGGG + Intronic
965831230 3:172791535-172791557 TTCTGTAACATAAAAGTACAAGG - Intronic
965867989 3:173229114-173229136 CTCCATAACATAAAAGTGCAAGG - Intergenic
965990985 3:174817635-174817657 CTCTTTAAAATAAAAATTGGGGG + Intronic
966070354 3:175869970-175869992 CTCCGTAACATAGAAGTGCAAGG + Intergenic
966116340 3:176467851-176467873 CTCCATAACATAAAAATGCAAGG + Intergenic
966644680 3:182231185-182231207 GTCTATACCATAAAAATGCAGGG - Intergenic
966750822 3:183320464-183320486 CTCTGTAACATACAAGTGCAAGG - Intronic
966995784 3:185278852-185278874 CTCTATAACATAAAAGTGCAAGG - Intronic
967325786 3:188238087-188238109 CTCCATAACATAAAAGTGCAAGG - Intronic
968244493 3:197129285-197129307 CTCTATAACATGAAAGTGCAAGG - Intronic
968259039 3:197304286-197304308 CTCTCTAAAAGAAAGATGGATGG - Intergenic
968766305 4:2471887-2471909 CTCTGTAATGTAAAAGTGTAAGG + Intronic
969079933 4:4610507-4610529 TTCTTTAACATAAACAGGGATGG + Intergenic
969378396 4:6778320-6778342 TTAAGTAACATGAAAATGGAAGG - Intergenic
970112635 4:12655497-12655519 CTCTCTAACAAAAAATTGCATGG + Intergenic
970332071 4:14996974-14996996 CTTCGTAACATAAAAGTGCAAGG + Intergenic
970390363 4:15603825-15603847 CTCTATAACATAAAAATAGAAGG - Intergenic
970730464 4:19097684-19097706 TTTTTTAACATAAAAATAGAAGG + Intergenic
970847407 4:20557111-20557133 CTCTGTCACATGAAAGTGCAAGG + Intronic
971121639 4:23711352-23711374 ATCTGTAACATCAAACTGGTAGG - Intergenic
971178058 4:24300590-24300612 CTCTGTCACATATAAACTGATGG - Intergenic
971537900 4:27777490-27777512 CTCCATAACATAAAAGTGTAAGG + Intergenic
971768391 4:30864395-30864417 CTTTCTAAGATAAAAATTGAAGG - Intronic
971830867 4:31692906-31692928 CTCTGTAACATGAAAGTACAAGG + Intergenic
972383658 4:38542831-38542853 CTCCATAACATAAAAGTGCAAGG - Intergenic
973233824 4:47873955-47873977 CTCCATAACATAAAAGTGCAAGG - Intronic
973658339 4:53075143-53075165 CTCTCTAACATAAAAGTGCAAGG - Intronic
973697421 4:53504289-53504311 CTCCATAACATAAAAGTGCAAGG - Intronic
973901242 4:55474390-55474412 CTCCATAACATAAAAGTGCAAGG + Intronic
975475482 4:74818490-74818512 CTCTATAACACAAAAGTGCAAGG - Intergenic
975762001 4:77629724-77629746 CCCTGGAACATAAAAGTGCAAGG - Intergenic
976016959 4:80567247-80567269 CTCTTTCACATAAAAAAAGACGG + Intronic
976080757 4:81352234-81352256 CTCTGTGACATGTAAAAGGAAGG - Intergenic
976468545 4:85399866-85399888 CTCCATAACATAAAAGTGCAAGG + Intergenic
977126966 4:93181656-93181678 CTCTGTAACATAAAAGTGCAAGG - Intronic
977169502 4:93743288-93743310 CTCCATAACATAAAAGTGCAGGG + Intronic
977394391 4:96453055-96453077 CTCTGTACCTTATAATTGGATGG + Intergenic
977444427 4:97111393-97111415 ATGTGGAACAGAAAAATGGAAGG - Intergenic
978010235 4:103672938-103672960 CTCCATAACATAAAAGTGCAAGG - Intronic
978523494 4:109640548-109640570 CTCTATAACATAAAAGTGCAAGG - Intronic
979313984 4:119237839-119237861 CTCCATAACATAAAAATACAAGG - Intronic
979625948 4:122845597-122845619 CTCCATAACATAAACATGCAAGG - Intronic
979659033 4:123231317-123231339 CTTTATAACATAAAAGTGCATGG - Intronic
979667637 4:123329857-123329879 CTCCATAACATAAAAGTGTAAGG + Intergenic
979729400 4:124005887-124005909 CTCCATAACATAAAGATGCAAGG - Intergenic
980221357 4:129920135-129920157 CTCTGTGACATAGAAGTGCAAGG + Intergenic
980429894 4:132680620-132680642 CTCTATAAAATAAAAAGGTAAGG - Intergenic
980706988 4:136511104-136511126 CTCTGTAACATAAAAATGTGAGG - Intergenic
981119569 4:141034210-141034232 CTCCAAAACATAAAAATGCAAGG - Intronic
981200682 4:141975973-141975995 AGCTGTAACATAAAAGTGCAAGG + Intergenic
981643411 4:146970793-146970815 CTGTGAAACATAAAACTGCAAGG - Intergenic
982069937 4:151686231-151686253 CACTGTAAAATGAAAATGGCAGG - Intronic
982085076 4:151826782-151826804 CTCTATAACATAAAAGTGCAAGG - Intergenic
982399317 4:154948725-154948747 CTCTGCCAGAAAAAAATGGAGGG - Intergenic
982458911 4:155643571-155643593 CTCCATAACATAAAAATGCAAGG + Intergenic
983031288 4:162804966-162804988 CTCTGAGTCATAAAAATGTATGG - Intergenic
983446070 4:167854482-167854504 ACCTGGAACATAAAAAAGGATGG - Intergenic
983805256 4:171985576-171985598 CTGTGTAACATAATAATCCATGG - Intronic
984051691 4:174872485-174872507 CACTGTAACTATAAAATGGATGG - Intronic
984252857 4:177355199-177355221 ATTTATAACATATAAATGGAGGG + Intronic
984297193 4:177867191-177867213 CAATGTAAAATTAAAATGGAAGG - Intronic
984351651 4:178601798-178601820 CTCTGTAGAATGAAAATTGATGG + Intergenic
984461125 4:180038210-180038232 CTCTATAACATAAAAGTGCAAGG + Intergenic
984545093 4:181091997-181092019 CTCCTTAACATAAAAGTGCAAGG - Intergenic
984685604 4:182664915-182664937 CTCTGCAACATAAAAATGCAAGG + Intronic
984721354 4:182976114-182976136 CTGTGGAAAATAAAACTGGATGG + Intergenic
984823003 4:183899701-183899723 CTCCATAACATAAAAGTGCAAGG + Intronic
985345918 4:189003962-189003984 CTTTGTAACATAGAAGTGCAAGG + Intergenic
985481695 5:115680-115702 CTCCTTAACGTAAAAATGCAAGG - Intergenic
985732746 5:1558838-1558860 CTCCATAACATAAAAACGCAAGG - Intergenic
986000360 5:3626418-3626440 AGCTGTAACATTAGAATGGAAGG - Intergenic
986441233 5:7783638-7783660 ACCTGAAAAATAAAAATGGATGG - Intronic
986631549 5:9778644-9778666 CTCCATAACATAAAAGTGCAAGG - Intergenic
987095886 5:14549373-14549395 CTCCATAACATAAAAGTGCAAGG - Intergenic
987237978 5:15962589-15962611 CTCCCTAACATAAAAGTGCAAGG + Intergenic
987401082 5:17477592-17477614 CTGTGAAAAATAAAAATGTAGGG - Intergenic
987726701 5:21709909-21709931 CTCCAAAACATAAAAATGCAAGG + Intergenic
987851086 5:23355472-23355494 CTCCATAACATAAAAATGGAAGG + Intergenic
988330329 5:29829769-29829791 CTCCATAGCATAAAAATGAAAGG - Intergenic
989005154 5:36801978-36802000 CTCTGTCTCAAAAAAAAGGAAGG - Intergenic
989225188 5:39019169-39019191 CTCCGTAACATAAAATGGCAAGG + Intronic
989634280 5:43517655-43517677 CTCTGTAACATAAAAGGGCAAGG + Intergenic
989654064 5:43725397-43725419 CTCTGTAACATAAAAGTGCAAGG - Intergenic
990053592 5:51541005-51541027 CTCAGAAAAATAAAAATTGAGGG - Intergenic
990105715 5:52257010-52257032 TTCTGTAACACAGAAATGCAGGG + Intergenic
990358264 5:54992168-54992190 CTATGTGAAATAAACATGGATGG + Intronic
990586241 5:57214053-57214075 CCCTGTCACATAAAAATGGAAGG - Intronic
990605580 5:57406578-57406600 CCCTGAAAGAGAAAAATGGAGGG + Intergenic
990677005 5:58198273-58198295 CTCTATAACATAAAAGTGCAAGG - Intergenic
991121532 5:63020613-63020635 CTTTGTAACACAAAAGTGCAAGG - Intergenic
991188657 5:63841897-63841919 CTCCATAACATAAAAGTGTAAGG + Intergenic
991228664 5:64303713-64303735 CTCTATAACAAAAAAGTGCAAGG + Intronic
991336159 5:65549628-65549650 CTCCATAACATAAAAATGCAAGG - Intronic
991413108 5:66364806-66364828 CTCCGTAACATAAAAGTGCAAGG - Intergenic
991486851 5:67145841-67145863 CTCTCTAGCATTGAAATGGATGG + Intronic
991651340 5:68857883-68857905 CTCTACAACATAAAAATGCACGG - Intergenic
992033532 5:72748429-72748451 CTCAGACAAATAAAAATGGATGG + Intergenic
992216750 5:74532445-74532467 CTCCGTAATATAAAAGTGTAAGG + Intergenic
992625045 5:78629061-78629083 CTCTTTAACATTAAAAAAGATGG + Intronic
993393654 5:87355049-87355071 CTCCATAACATAAAAGTGTACGG + Intronic
994466952 5:100148219-100148241 CTCTACAACATAAAAATGCAAGG - Intergenic
994937145 5:106269546-106269568 CTCTGGAACATAAAAGTGTAAGG - Intergenic
995211895 5:109550391-109550413 CTTTGCAAAATAAAAATAGAAGG + Intergenic
995301105 5:110584096-110584118 CTCTAAAAATTAAAAATGGAAGG + Intronic
995584787 5:113636973-113636995 CTGTGTGAAATAAAAATGTAGGG + Intergenic
996045766 5:118872018-118872040 CTCTTTAACAAAAAAGTGCAAGG - Intronic
996177908 5:120381825-120381847 CTCTATAACATAAAAGTGCAAGG - Intergenic
996347208 5:122500038-122500060 ATATGTAACATACATATGGAGGG + Intergenic
996482898 5:123995539-123995561 CTCTATAACATAAAAGTGCATGG - Intergenic
996512474 5:124332294-124332316 CTCTATAACATAAAAGTGCAAGG - Intergenic
996517644 5:124390730-124390752 TTCTGTAACATAAAAGTGCAAGG - Intergenic
996673248 5:126144150-126144172 CTCCAGAACATAAAAATGCAAGG + Intergenic
996719136 5:126612997-126613019 CTATTTAACATGAACATGGAAGG + Intronic
997036016 5:130192653-130192675 CTCAGTAAAAGAAATATGGAAGG - Intergenic
997645566 5:135479333-135479355 CTCTTTATCATCAAGATGGAAGG - Intergenic
997703422 5:135923607-135923629 CTCCATAACATAAAAGTGCAAGG - Intronic
998441327 5:142164837-142164859 CTTTGTAAAATAAAAAGGGGTGG - Intergenic
998579267 5:143354033-143354055 CGCTGTAACATAAAAGTGTAAGG - Intronic
998814511 5:145999122-145999144 CTCTATAACATAAAAATGCAAGG - Intronic
999117028 5:149173323-149173345 CTCTGCCCCATAAGAATGGAGGG + Intronic
999835102 5:155361680-155361702 CTCTATAGCATAAAAATGCAAGG - Intergenic
1000040765 5:157483545-157483567 GTCTGTAACAGAAAAAAGGAAGG + Intronic
1000238443 5:159385846-159385868 GTCTTAAACATAAAAATGAAAGG - Intergenic
1000453844 5:161424128-161424150 CTCCATAACATAAAAGTGCAAGG + Intronic
1000586670 5:163108340-163108362 CTGTATAACATAAAAGTGCAAGG - Intergenic
1000656163 5:163880767-163880789 ATCTTTAAAATATAAATGGAAGG - Intergenic
1000782595 5:165501686-165501708 CTCCATAACATAAAAATGCAAGG - Intergenic
1000826863 5:166055635-166055657 CCCTGTCTCAAAAAAATGGATGG + Intergenic
1001360333 5:171078001-171078023 CTCCGTAACATAAAGGTGCAAGG + Intronic
1002179334 5:177422315-177422337 CTCTGTCTCAAAAAAAAGGAAGG - Intronic
1002881775 6:1258851-1258873 CTCCATAACATAAAAGTGCAAGG + Intergenic
1003996137 6:11541373-11541395 CTCTATAACATAAAAGTGCAAGG - Intronic
1004067930 6:12267620-12267642 CTCCATAACATAAAAGTGCAAGG + Intergenic
1004128939 6:12900907-12900929 CATTTAAACATAAAAATGGAAGG - Intronic
1004152797 6:13136292-13136314 CTCCATAACATAAAAGTGAAAGG - Intronic
1004658098 6:17684323-17684345 CTCTGTAACATAAAAGGGCAAGG - Intronic
1004972365 6:20924731-20924753 CTCCATAACATAAAAGTGCAGGG + Intronic
1005213939 6:23502968-23502990 CTCCATAACATCAAAATGCAAGG - Intergenic
1005246811 6:23895513-23895535 CTCCATAACATAAAAATGCAAGG + Intergenic
1005418025 6:25622083-25622105 CTGTGAAGCATAAAAGTGGAGGG - Intergenic
1005914176 6:30337948-30337970 CTCTGTAACAAAAATGTGCAAGG - Intronic
1006787925 6:36680200-36680222 CCCTGGAAAATAAAAATAGACGG - Intronic
1007379725 6:41480436-41480458 CTCCATAACATAAAAGTGCAAGG + Intergenic
1007863869 6:44945739-44945761 CTCTATAATATAAAAGTGCAAGG + Intronic
1007884280 6:45208325-45208347 CTCCATAACATAAAAGTGCAAGG + Intronic
1008015080 6:46509422-46509444 CTCTGTAACGTAAAAAGTCAGGG + Intergenic
1008120729 6:47613914-47613936 CTCCATGACATAAAAGTGGAAGG - Intronic
1008516251 6:52322014-52322036 CTCTGTAACTTAAAAGTGCAAGG - Intergenic
1008975072 6:57416731-57416753 CTCTATAACATAAAAGTACAAGG - Intronic
1009163958 6:60318248-60318270 CTCTATAACATAAAAGTGCAAGG - Intergenic
1009431163 6:63567885-63567907 CTCCCTAACATAAAAATGAAAGG - Intronic
1009840378 6:69065211-69065233 ATCTGTTACAAAAAAGTGGATGG + Intronic
1009963286 6:70550924-70550946 CTCCATAACATAAAAGTGGAAGG - Intronic
1010267971 6:73888856-73888878 TTCTGAAAAATAAAAATGCAAGG - Intergenic
1010697375 6:78993246-78993268 CTGTGTAACATAAAAGTGTAGGG + Intronic
1010898510 6:81396565-81396587 CTCCATAACATAAAAATGCAAGG + Intergenic
1010941958 6:81929820-81929842 CTCAGTAACATGAAAAGGTAAGG - Intergenic
1011518225 6:88175771-88175793 CTCTGTAACTTAAAAAAAAAAGG - Intergenic
1011644815 6:89447511-89447533 CTCTGTAACATAAAAGTGCAAGG + Intronic
1011724582 6:90197221-90197243 CTCTGTATCACAAAAATGAAGGG + Intronic
1011737324 6:90324587-90324609 CTCCATAACATAAAAGTGCAAGG - Intergenic
1011856479 6:91699150-91699172 CTCCATAACATAAAAGTGTAAGG - Intergenic
1011872014 6:91907338-91907360 CTCCATAACATAAAAGTGCAAGG - Intergenic
1012294139 6:97498836-97498858 CTCTGTAACATGAAAAGATACGG - Intergenic
1012340033 6:98109384-98109406 CTCCATAACATAAAAGTGCAAGG - Intergenic
1012760131 6:103290761-103290783 CTTTGTAATATTAAAATGAAAGG + Intergenic
1013261242 6:108445113-108445135 CTCTATAACATAAAAATGCAAGG - Intronic
1013493573 6:110675048-110675070 CTCTATAACATAAAAGTGCAAGG + Intronic
1013720593 6:113022787-113022809 CCCTGTAAAATAAGAATAGAGGG + Intergenic
1013739840 6:113269485-113269507 CTTTATAACATAAAAGTGCAAGG + Intergenic
1014262479 6:119235563-119235585 CTCTGTAACATAGAAGTGCAAGG + Intronic
1014508967 6:122296870-122296892 CTCCGTAACGTAAAAGTGCATGG - Intergenic
1014521563 6:122449630-122449652 CTCCGTAACATAAAAGTATAAGG + Intronic
1014685718 6:124497550-124497572 ATCAGTAACAAAAAGATGGAAGG + Intronic
1014742359 6:125160823-125160845 CTCTGTAACATAAAAGTGCAAGG - Intronic
1014775124 6:125500011-125500033 CTCCATAACATAAAAGTGCAAGG - Intergenic
1015259617 6:131221385-131221407 CTCCATAACATAAAAGTGCACGG + Intronic
1015433355 6:133155860-133155882 CTCCATAACATAAAAGTGCAAGG - Intergenic
1015497180 6:133893981-133894003 CTCTGTAAGATGAAAGAGGAAGG - Exonic
1015640764 6:135329089-135329111 CTCCGTAACATAAAAGTGCAAGG + Intronic
1016148444 6:140705575-140705597 CCCTGTAACATCAAAGTGCAAGG - Intergenic
1016220322 6:141661197-141661219 TTCTATAACATAAAAATGCAAGG - Intergenic
1016551920 6:145291091-145291113 ATATGTAAAACAAAAATGGATGG + Intergenic
1016794110 6:148099514-148099536 CTTCATAACATAAAAATGCAAGG + Intergenic
1016867442 6:148781497-148781519 TTCTGGAACATAAAAGTGCAAGG + Intronic
1017068884 6:150554663-150554685 CTCCATAACATAAAACTGCAAGG + Intergenic
1017243682 6:152198185-152198207 CTCCATAACATAAAAGTGCAAGG - Intronic
1017734722 6:157350971-157350993 CTCCATAACATAAAAGTGCAAGG + Intergenic
1017855237 6:158345173-158345195 CTTTATAACATAAAAGTGCAGGG + Intronic
1018344485 6:162886663-162886685 CTCTGTGACATAAAAATAAATGG - Intronic
1018373485 6:163189559-163189581 ATCTGTAAGCTAAAAATTGATGG - Intronic
1018840566 6:167513829-167513851 CTCTTAAAAATAGAAATGGAAGG - Intergenic
1019021315 6:168920586-168920608 GTCTGTAACATTCAAAAGGAAGG - Intergenic
1019061030 6:169258367-169258389 CTCTGTAAGACAAAAATGCAAGG - Intergenic
1019822024 7:3251387-3251409 CTCCATAACATAAAAGTGCAAGG + Intergenic
1020090972 7:5340778-5340800 CTCCATAACATAAAAATGCAAGG + Intronic
1020570645 7:9856595-9856617 CTCTACAACATAAAAGTGCAAGG - Intergenic
1021155745 7:17207534-17207556 CAGTGTAACATAAAAATGTGAGG + Intergenic
1021282831 7:18741060-18741082 CTCTGTAACATGAAAGTGGAAGG + Intronic
1021376527 7:19914636-19914658 CTCTAGAACATAAATGTGGAAGG - Intergenic
1021539690 7:21743462-21743484 CCCTGTACAGTAAAAATGGATGG + Intronic
1021993532 7:26158628-26158650 CTCTGTAACCTACTAATGGAGGG - Intronic
1022145024 7:27528680-27528702 CTCCATAACATAAAAGTGGAAGG + Intronic
1022528682 7:31053652-31053674 CTCAAAAACATAAAAATGGTCGG - Intronic
1022548856 7:31217182-31217204 CTCTACAACATAAAAGTGCAAGG - Intergenic
1022610362 7:31866026-31866048 CGCTGTTACATAGAAAAGGAAGG - Intronic
1022682377 7:32561384-32561406 CTCTATAACATAAAAGTGCAAGG - Intronic
1022899324 7:34787217-34787239 CTCTGTAATATAAACATGCAAGG - Intronic
1023074573 7:36470397-36470419 CGCTGTAAGATAATAAAGGAGGG - Intergenic
1023099928 7:36706757-36706779 CTCCATAACATAAAAGTGCAAGG - Intronic
1023193543 7:37609832-37609854 CTCCATGACATAAAAGTGGAAGG + Intergenic
1023262849 7:38375536-38375558 CTCTGTGATATAAAAATGAGAGG - Intergenic
1023422890 7:40002351-40002373 ATTTGTAACATAAAAATGTAGGG - Intronic
1023508317 7:40923083-40923105 CTCTATAAAATAGAAATTGAGGG + Intergenic
1023605163 7:41924147-41924169 CTTTGAAACATAAAACTGTATGG + Intergenic
1024204502 7:47145413-47145435 CTGAGTAACATGAAAACGGAGGG - Intergenic
1024486586 7:49926745-49926767 GTCTGTAAGAGAAAAAGGGAAGG + Intronic
1024543398 7:50497570-50497592 CTCTGTATCATATAAATGCATGG - Intronic
1024672175 7:51606515-51606537 CACTGTATCATGAAAATGGAAGG + Intergenic
1024852638 7:53738824-53738846 CTCTATAACACAAAAGTGAAAGG + Intergenic
1026507773 7:71000561-71000583 CTCTATAACATAAAAATGCAAGG + Intergenic
1026545925 7:71321956-71321978 CTCTGTCTCAAAAAAAAGGAAGG - Intronic
1026732574 7:72924718-72924740 ATTTGTAACATAGAAATGGAGGG + Intronic
1027006135 7:74694609-74694631 CTCTATAACATAAAAGTGCAAGG + Intronic
1027276013 7:76556872-76556894 ATCTGTAATATAAAAGTGCAAGG + Intergenic
1027371746 7:77513236-77513258 CTAGGTAACCTAAATATGGAGGG + Intergenic
1027371774 7:77513515-77513537 CTAGGTAACCTAAATATGGAGGG + Intergenic
1027742464 7:82027904-82027926 CTCTATAACATAAAAGTGCAAGG + Intronic
1027933891 7:84577419-84577441 CTCAGAAACATAAAAATTCAGGG + Intergenic
1029980996 7:104879108-104879130 CTCTGTGACATAAAAGTGCAAGG + Intronic
1030387356 7:108880584-108880606 CTTCATAACATAAAAATGCAAGG + Intergenic
1030426037 7:109379637-109379659 CTCTGTAACATAAAAGTACATGG + Intergenic
1030453808 7:109747039-109747061 CTCCTTAAAATAAAAATTGAGGG + Intergenic
1031041993 7:116848286-116848308 GTCTGAAGAATAAAAATGGAAGG - Intronic
1031815240 7:126425647-126425669 CTGTGTAACATAAAAGTGTGAGG - Intergenic
1031827331 7:126582427-126582449 CTCTATAACATAAAAGGGCAAGG + Intronic
1031838796 7:126711771-126711793 CTCCATAACATAAAAGTGCAAGG - Intronic
1032043489 7:128582158-128582180 CTCAGTAACATAAAAAAGGAAGG - Intergenic
1032227248 7:130042498-130042520 CTTTGGAAAGTAAAAATGGATGG - Intronic
1032701693 7:134386006-134386028 CTCCATAACATAAAAGTGCAAGG + Intergenic
1033119353 7:138653190-138653212 CTCCGTAACATAGAAGTGCAAGG + Intronic
1033139936 7:138816989-138817011 CTCTGTAACATAAAAGTGCAAGG + Intronic
1033795326 7:144838859-144838881 CTCCGTAACATAAAAGAGCAAGG + Intergenic
1033845898 7:145431722-145431744 CTCTGTAACATAAAAGTGCAAGG - Intergenic
1034685444 7:152967027-152967049 GACTGGAACATAAAAATGTAAGG - Intergenic
1034727553 7:153352315-153352337 CTCCATAACATAAAAGTGGAAGG + Intergenic
1034743351 7:153498792-153498814 CTCCAGAACATAAAAGTGGAAGG + Intergenic
1034873292 7:154702714-154702736 CTCCATAACATAAAAGTGCAAGG + Intronic
1034981183 7:155478112-155478134 CTCCATAACATAAAAGTGTAAGG + Intronic
1034984837 7:155503888-155503910 CACTGTAACTTAGAAATGAATGG - Intronic
1035144452 7:156800046-156800068 CTCCATAACATAAAAGTGCAAGG + Intronic
1035167050 7:156997551-156997573 CTCCATAACATAAAAGTGCAAGG - Intronic
1035197137 7:157231059-157231081 CTCTGTTAAAAAAAAATGGGAGG - Exonic
1035426221 7:158776474-158776496 CTCCATAACATAAAAGTGCAAGG - Intronic
1035985260 8:4422996-4423018 CTCAGTAACATATGATTGGAAGG + Intronic
1036039852 8:5064390-5064412 CTCAGTAACATAAAAGTGCAAGG + Intergenic
1036591279 8:10170802-10170824 CAGAGTACCATAAAAATGGATGG - Intronic
1037263457 8:17033839-17033861 CTCCATAACATAAAAGTGCAAGG + Intronic
1038621840 8:29151309-29151331 CTCTGTAACATAAAAGTGCAAGG + Intronic
1038903207 8:31867374-31867396 CTCTGAAACATACAAATCAAGGG - Intronic
1039093625 8:33859006-33859028 CTATCTAACAGAAAAATAGAAGG + Intergenic
1039337283 8:36605775-36605797 CTCTGTAACATAAATGTGAAAGG - Intergenic
1039815214 8:41087762-41087784 CTCCATAACATAAAAGTGCAAGG + Intergenic
1040076035 8:43231896-43231918 CTCCGTAACATGAAAGTGCAAGG - Intergenic
1040642337 8:49351483-49351505 CAGTGGAAAATAAAAATGGATGG - Intergenic
1040808868 8:51427353-51427375 CTCTGTAAAATAACAGAGGAGGG + Intronic
1041282429 8:56224497-56224519 CTCTGCAAAATAAAAACTGAAGG - Intergenic
1041943791 8:63419265-63419287 CTCTGAAAGGTAAAAATTGAGGG + Intergenic
1042099946 8:65264827-65264849 CTCTATAACATAAAAGTGCAAGG - Intergenic
1042548058 8:69968570-69968592 CTCTATAACATAAAAGTGGAAGG + Intergenic
1042829572 8:73011657-73011679 CTCTGTGACATAGAAGTGCAAGG - Intronic
1042882364 8:73507850-73507872 CTCCATAACATAAAAGTGTAAGG - Intronic
1043722442 8:83562510-83562532 CTCTGTAACAGAAAATTACAAGG - Intergenic
1043990838 8:86752086-86752108 CTCCATACCATAAAAATGCAAGG - Intergenic
1044044139 8:87409422-87409444 CTCCATAACATAAAACTGTAAGG + Intronic
1044158066 8:88875287-88875309 TTCTGTAACAGAGTAATGGATGG - Intergenic
1044164260 8:88961675-88961697 CTCTCAAACATAAAAGTGCAAGG - Intergenic
1044287891 8:90430850-90430872 CTCCATAACATAAAAGTGCAAGG + Intergenic
1044449404 8:92316329-92316351 CTCCATAACATAAAAGTGCAAGG + Intergenic
1045131372 8:99158040-99158062 CTCCATAACATAAAAGTGCAAGG + Intronic
1045153766 8:99441973-99441995 GTCTGTAAAGTAAAAATGGAAGG + Intronic
1045563493 8:103289477-103289499 CTCCATAATATAAAAGTGGAAGG - Intergenic
1045889553 8:107138743-107138765 CACCGTAACACAAAAATGCAAGG - Intergenic
1045892609 8:107175081-107175103 CTCTGTAGCACAAAATTGAAGGG - Intergenic
1046014020 8:108584385-108584407 CTCTCTAAAATAAAAATGCTAGG - Intergenic
1046028655 8:108756355-108756377 CTTTCTAACTTAAAAATAGAAGG + Intronic
1046252961 8:111657452-111657474 TTCTGTTAAAAAAAAATGGAAGG + Intergenic
1046489984 8:114939175-114939197 TTATGTAGCAAAAAAATGGAAGG + Intergenic
1046927632 8:119809210-119809232 GTCTGTAACATGAAAGTGCAAGG - Intronic
1047034474 8:120921875-120921897 CTCTATAACATAAAAGTACAAGG - Intergenic
1047049437 8:121094004-121094026 CCCTATAACATAAAAGTGCAAGG - Intergenic
1048051785 8:130824755-130824777 CACTGTAAAATGAAAATGCAGGG + Intronic
1048433429 8:134391991-134392013 CCCTGTAACATAAAAGTGCAAGG + Intergenic
1048714797 8:137256441-137256463 CTTTGTAAAAAAAAAATGTAGGG - Intergenic
1048824240 8:138408366-138408388 CTCTATAACATTAAACTGCAAGG - Intronic
1049865860 8:144935120-144935142 CTCTGTAATATAAGAATTGTGGG + Intronic
1049901240 9:168126-168148 CTCCATAACATAAAAGTGCAAGG + Intronic
1050867428 9:10520444-10520466 CTCCATAACATAAAAGTGCAAGG + Intronic
1051542938 9:18240838-18240860 CTCTATAACAGAAAAATGCAAGG - Intergenic
1052724264 9:32210993-32211015 CTCTATAACATGAAAGTGCAAGG + Intergenic
1053113714 9:35483851-35483873 CTCTATAACATAAAAGTACAAGG - Intergenic
1053132577 9:35625465-35625487 CTCTATAACATAAAAGTGCAAGG + Intronic
1053217712 9:36286347-36286369 CTCTATAACATAAAAGTGCAAGG - Intronic
1053744279 9:41178440-41178462 CTCCATAACATAAAAGTGCAAGG + Intronic
1054349555 9:64008338-64008360 CTCCATAACATAAAAGTGCAAGG + Intergenic
1054482991 9:65686758-65686780 CTCCATAACATAAAAGTGCAAGG - Intronic
1054684066 9:68252813-68252835 CTCCATAACATAAAAGTGCAAGG - Intronic
1054994546 9:71370641-71370663 CTCCGTAACATAAAATTACAAGG + Intronic
1055275388 9:74610201-74610223 TTCTGTAAAATAAAAATGCCTGG + Intronic
1055297068 9:74844456-74844478 CTCTGTAATATAAAAGTTCAGGG - Intronic
1055377280 9:75662915-75662937 CTCCTTAACATAAACATGCAAGG + Intergenic
1055402359 9:75937786-75937808 CTCTGTAACATAAAAGTGCAAGG - Intronic
1055557136 9:77486213-77486235 CTCTGTAACATAACAGTGCAAGG - Intronic
1056695538 9:88847193-88847215 CTTTGTAAGATACAAATGTAAGG - Intergenic
1056704678 9:88941780-88941802 CTCTGGAACATGGAAATGCAGGG - Intergenic
1057036389 9:91814705-91814727 CTCTGTAAGATAAAAATGACAGG + Intronic
1058067003 9:100560377-100560399 CTGTGTAAGATAGAAATGGCAGG + Intronic
1058212704 9:102190683-102190705 TTCTGTGACAGAAAAATTGAGGG - Intergenic
1058285852 9:103177021-103177043 CACCATAACATAAAAATGCAAGG - Intergenic
1058301035 9:103373278-103373300 CTCTTTAAAATAATAATTGATGG - Intergenic
1059129485 9:111730981-111731003 CTCCGTAACATAAAAGTACAAGG - Intronic
1059538897 9:115111333-115111355 CTGTGTAACCTAATCATGGAAGG - Intronic
1059711889 9:116875462-116875484 CTCTGTATCATAAAAGTGCAAGG + Intronic
1059812769 9:117874473-117874495 CTCTGTGACATAAACCAGGAAGG - Intergenic
1059936427 9:119315973-119315995 CTCTGTAACATGAAAGTACAAGG + Intronic
1060066489 9:120505893-120505915 CTAAGTAACATAAAAGTGTAAGG + Intronic
1203422991 Un_GL000195v1:12388-12410 CTCTGTAACAACAAAACTGAAGG - Intergenic
1203696634 Un_GL000214v1:104503-104525 CTCTGTCTCAAAAAAAAGGAGGG + Intergenic
1186386000 X:9110694-9110716 CTCTCTAAGACAAAAATGCAAGG + Intronic
1186493181 X:9991461-9991483 CTCCATAACATAAAAGTGCAGGG + Intergenic
1186518531 X:10185705-10185727 CTCTGTGACTTAAAAAAGGGGGG - Intronic
1186535794 X:10346604-10346626 CTCCATAACATAAAAGTGCAAGG + Intergenic
1186639109 X:11435993-11436015 TTCTGAAAAATAAAATTGGATGG - Intronic
1186849180 X:13563368-13563390 CTCCATAACATAAAACTGCAAGG - Intergenic
1187026704 X:15442861-15442883 CTCCATAACATAAAAGTAGAAGG + Intronic
1187147885 X:16654382-16654404 CTGTTTTACATAAAAAAGGATGG - Intronic
1187474403 X:19598002-19598024 CTCTATAACATAAAAGTACAAGG - Intronic
1187625569 X:21109192-21109214 GTCTGTAAGATAAGAAGGGAAGG + Intergenic
1187820883 X:23286842-23286864 CTATGTAAAATATAAAGGGATGG - Intergenic
1187890442 X:23929597-23929619 CTTTATAACATAAAAGTGCAAGG + Intronic
1188278822 X:28237704-28237726 CTCCATAACATAAAAGTGTAAGG - Intergenic
1188448259 X:30280484-30280506 CTCTGTAACATAAAAGTGCAAGG + Intergenic
1188469247 X:30518539-30518561 CTCCATAACATAAAAGTGCAAGG + Intergenic
1188583288 X:31741983-31742005 CTCTATAACATAAAAGTGCAAGG - Intronic
1188591449 X:31841354-31841376 CTCCGTAACATAAAAGTGAAAGG + Intronic
1188844392 X:35055731-35055753 CTCCATAACATAAAAGTGCAAGG - Intergenic
1188855574 X:35191182-35191204 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1189060111 X:37744622-37744644 TTCCATAACATAAAAATGCAAGG - Intronic
1189072482 X:37878482-37878504 CTCCATAACATAAAAGTGCAAGG + Intronic
1189183176 X:39023584-39023606 CTCAGTAACTTACAAATAGAAGG - Intergenic
1189274558 X:39776072-39776094 CACTGCAAAATAAAAATGAAGGG - Intergenic
1189827874 X:44938532-44938554 CTCCATAACATAAAAGTGCAAGG + Intronic
1189842928 X:45101093-45101115 CTTAGGAAAATAAAAATGGATGG - Intronic
1189923131 X:45923208-45923230 CTCTCTAACATAAAAGTACAAGG + Intergenic
1189942654 X:46141680-46141702 CTCCATAACATAAAAGTGCAAGG + Intergenic
1190180653 X:48189101-48189123 CTCCATAACATAAAAGTGCAAGG + Intronic
1190196639 X:48325209-48325231 CTCCATAACATAAAAGTGCAAGG - Intergenic
1190199568 X:48348958-48348980 CTCTATAACATAAAAGTGCAAGG + Intronic
1190204330 X:48390492-48390514 CTCTATAACATAAAAGTGCAAGG - Intronic
1190206206 X:48404911-48404933 CTCTATAACATAAAAGTGCAAGG + Intronic
1190210169 X:48440142-48440164 CTCTATAACATAAAAATGCAAGG - Intergenic
1190460772 X:50671524-50671546 CTCTATAACATAAAAGTGCAAGG - Intronic
1190663365 X:52675579-52675601 CTCCATAACATAAAAGTGCAAGG - Intronic
1190676058 X:52782903-52782925 CTCCATAACATAAAAGTGCAAGG + Intronic
1190715647 X:53100901-53100923 CTCCGTAACATAAAAGTGCAAGG - Intergenic
1190814195 X:53914432-53914454 CTCCATAACATAAAAATGCAAGG + Intergenic
1192722582 X:73715074-73715096 CTCTGAAAAATAAAAAGGGGTGG + Intergenic
1193143755 X:78056301-78056323 CTTTATAACATAAAAGTGCAAGG + Intergenic
1193197606 X:78652896-78652918 CTTTATAACATAAAAATTGAAGG - Intergenic
1193818270 X:86129026-86129048 ATGTGGAACATAAAAATGGTGGG + Intergenic
1193867228 X:86748954-86748976 CTCCTTAACATAAAAGTGCAAGG - Intronic
1193971297 X:88057362-88057384 CTCCACAACATAAAAATGCAAGG + Intergenic
1194403661 X:93468026-93468048 CTCTGTCCCAGAGAAATGGAGGG - Intergenic
1195593283 X:106657158-106657180 CTCCATAACATAAAAGTGCAAGG - Intronic
1195628348 X:107027883-107027905 CTCTATAACATAAAAGTGTAAGG - Intergenic
1195690811 X:107623530-107623552 CTCCGTAACATAAACGTGCAAGG - Intergenic
1195954326 X:110313465-110313487 CTCTGTAACAAAAATATGAAAGG - Intronic
1196333334 X:114498482-114498504 CTCCATAACATAAAAATCCAAGG - Intergenic
1196564100 X:117184314-117184336 CTCTGTAACATAAAACTACAAGG + Intergenic
1196577992 X:117343404-117343426 CTCCATAACATAAAAGTGCAAGG - Intergenic
1196939596 X:120762345-120762367 ATCTGTAACACAAAAATGTTGGG + Intergenic
1197344207 X:125312651-125312673 CTCCATAACATAAAAGTGCAAGG + Intergenic
1197557282 X:127971301-127971323 CTCCATAACATAAAAGTGTAAGG - Intergenic
1198038758 X:132827826-132827848 CTCTCTAACAGCAAAATCGAGGG - Intronic
1198445088 X:136705284-136705306 CTCTGTCAAAAAAAAAAGGAAGG + Intronic
1198489129 X:137121057-137121079 CTCAGAAAAATAAAAATTGAGGG + Intergenic
1198634543 X:138681296-138681318 CTCTGTAACATAAAAGTGCAAGG - Intronic
1198826551 X:140704408-140704430 CTCTATAGCATAAAAGTGCAAGG - Intergenic
1199409363 X:147502763-147502785 CTTTATAACATAAAAGTGCAAGG + Intergenic
1199916807 X:152351393-152351415 CTCCATAACATAAAAGTGCAAGG - Intronic
1200389176 X:155926386-155926408 CTCTATAACATAAAAGTACAAGG - Intronic
1200422025 Y:2980993-2981015 CTTTGATAGATAAAAATGGAAGG + Exonic
1200610290 Y:5320244-5320266 ATCTGTAATATAAAAATATATGG + Intronic
1201256542 Y:12113104-12113126 CTCTGGAAAAAAAAAAAGGAAGG - Intergenic
1201365969 Y:13206401-13206423 CAGTGCAAAATAAAAATGGAGGG - Intergenic
1201448601 Y:14084936-14084958 CTGTGCAAAATAAAAATGCAGGG - Intergenic
1201574592 Y:15448790-15448812 CTTCATAACATAAAAATGCAGGG + Intergenic
1202091707 Y:21197834-21197856 ATCCATAACATAAAAATGGGAGG + Intergenic