ID: 916193732

View in Genome Browser
Species Human (GRCh38)
Location 1:162203841-162203863
Sequence CTTTGGTCAAGAAGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 172}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916193719_916193732 21 Left 916193719 1:162203797-162203819 CCCATCCCATCCAGCAGGGCCCC 0: 1
1: 1
2: 3
3: 41
4: 302
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193721_916193732 16 Left 916193721 1:162203802-162203824 CCCATCCAGCAGGGCCCCAGAGG 0: 1
1: 0
2: 0
3: 29
4: 265
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193727_916193732 1 Left 916193727 1:162203817-162203839 CCCAGAGGATTTGGTCTTTTTCC 0: 1
1: 0
2: 3
3: 14
4: 234
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193723_916193732 15 Left 916193723 1:162203803-162203825 CCATCCAGCAGGGCCCCAGAGGA 0: 1
1: 0
2: 2
3: 40
4: 322
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193726_916193732 2 Left 916193726 1:162203816-162203838 CCCCAGAGGATTTGGTCTTTTTC 0: 1
1: 1
2: 0
3: 22
4: 236
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193728_916193732 0 Left 916193728 1:162203818-162203840 CCAGAGGATTTGGTCTTTTTCCT 0: 1
1: 0
2: 3
3: 33
4: 436
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193720_916193732 20 Left 916193720 1:162203798-162203820 CCATCCCATCCAGCAGGGCCCCA 0: 1
1: 0
2: 2
3: 43
4: 394
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172
916193724_916193732 11 Left 916193724 1:162203807-162203829 CCAGCAGGGCCCCAGAGGATTTG 0: 1
1: 0
2: 6
3: 13
4: 197
Right 916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG 0: 1
1: 0
2: 0
3: 10
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916193732 Original CRISPR CTTTGGTCAAGAAGGCCAGA TGG Intronic
901355945 1:8649122-8649144 CTATGCTAAAGAAGCCCAGAAGG + Intronic
904391243 1:30187664-30187686 CTTTGGGCCAGAAGTCCAGTGGG + Intergenic
904605539 1:31695920-31695942 CTCTGATCAAGAAGGACGGATGG - Intronic
905999263 1:42409903-42409925 TTATGGACAAGGAGGCCAGATGG + Intronic
906695914 1:47823442-47823464 CCTGGGTCAGGGAGGCCAGATGG - Intronic
907259109 1:53203584-53203606 GTTTCGTCAAGAAGACCAAAAGG - Intronic
908208140 1:61872116-61872138 CTTTGTTTAAGAAGTCCAAATGG + Intronic
910320566 1:85938749-85938771 CTTTGGTCAAGAAGGCTCTCTGG - Intronic
912253952 1:108040069-108040091 TTTTTGTCATGAAGGCAAGAGGG - Intergenic
914513765 1:148356065-148356087 CTTTGGGGAAGAAGGGCAGGGGG - Intergenic
916193732 1:162203841-162203863 CTTTGGTCAAGAAGGCCAGATGG + Intronic
916554129 1:165878536-165878558 CTCTGGCCAACATGGCCAGAGGG - Intronic
918050824 1:180971215-180971237 TTTTGGGCAAGATGGCTAGAGGG - Intergenic
918320485 1:183359592-183359614 CTTTGTCCAAGCAGGACAGAGGG + Intronic
919170851 1:193952202-193952224 AGTTGGTAAAGAATGCCAGAGGG + Intergenic
921117011 1:212101390-212101412 CTTTGGTCAATCAGGCAACAGGG - Intronic
922122173 1:222682225-222682247 TTTTGGTCCAGAAGGGCAAATGG + Intronic
922537114 1:226389628-226389650 CATGGGTCAAAAAGGCCACAGGG - Intronic
923433315 1:233945244-233945266 CTTTGCTCCTGAAGGCCAGGCGG + Intronic
923766029 1:236893155-236893177 CTTTGCTAACAAAGGCCAGAGGG - Intronic
1064644319 10:17445523-17445545 CTTTGGAAAAGAAAGGCAGACGG - Intronic
1069560183 10:69423656-69423678 CAGTGGTCAAGAAGGCCATATGG - Intergenic
1078528966 11:12121673-12121695 CTGTGGCCACGATGGCCAGAGGG - Intronic
1078801600 11:14650444-14650466 CTTTGGCCAAGGTGGGCAGATGG - Intronic
1080248154 11:30203038-30203060 CATTTGTCAAGACAGCCAGATGG - Intergenic
1082799950 11:57407082-57407104 CTTCGGTCAAGCAGGTCAGCTGG + Intronic
1083514743 11:63246410-63246432 TTTTGGTCATGAAGGCCACTGGG + Intronic
1085576364 11:77607451-77607473 GCTTGGTCAAGAAGGAAAGAAGG - Intronic
1086866148 11:91982412-91982434 CGTAGGTCAAGAAGTGCAGAAGG - Intergenic
1088632342 11:111785953-111785975 CTTTGGTGGAGAAGCCCATATGG + Intronic
1091202060 11:133788567-133788589 CTTTCCTCAAGGAGGCCTGAAGG - Intergenic
1091259802 11:134225038-134225060 CCTAGGTAAAGAAGGCCAGAGGG - Exonic
1093264363 12:16984201-16984223 TTTTGGACAAGAAACCCAGAGGG + Intergenic
1095069992 12:37830161-37830183 CTTTTGTCAAAAAGGCCTCAAGG - Intergenic
1096581669 12:52589653-52589675 CTTTGATGGAGGAGGCCAGAAGG + Intronic
1100210656 12:92395227-92395249 CTTTGTTCAATAGGGACAGAGGG - Intergenic
1100214681 12:92435251-92435273 CATTAGTTAAGATGGCCAGAAGG - Intergenic
1101919400 12:108920020-108920042 CTTTGATGGAGAAGGCCAGTTGG + Intronic
1102209935 12:111119110-111119132 CTTTTCTCTAGAGGGCCAGATGG + Intronic
1103251774 12:119506139-119506161 CTCTGGGTAAGAAGGGCAGAAGG - Intronic
1103647407 12:122405284-122405306 CTATGGTCAAAAAAGTCAGAAGG + Intronic
1107634515 13:42378702-42378724 CCTTAGTAAAGAAGGCAAGAAGG - Intergenic
1110440763 13:75522794-75522816 ATTTGGTAAGGTAGGCCAGAAGG - Intergenic
1110745745 13:79051251-79051273 CTTTGACCAAGATGGCCAAAAGG - Intergenic
1113923377 13:113927177-113927199 CGTTGGTGAAGAAGGCCTGTTGG - Intergenic
1115292222 14:31785108-31785130 CTTTGGTCCCCAAGGTCAGACGG - Intronic
1115307468 14:31947213-31947235 CGATGGTAAAGAACGCCAGAGGG - Intronic
1116126357 14:40792258-40792280 CTATGTTTAAGAAAGCCAGAGGG - Intergenic
1116133054 14:40883999-40884021 ATGTGGTCAGGAAGACCAGAAGG - Intergenic
1116387080 14:44345002-44345024 CATTGGTAAAAAAGTCCAGAAGG - Intergenic
1116683374 14:48006884-48006906 CTGTGGTCATTAAAGCCAGAGGG + Intergenic
1120110683 14:80551900-80551922 CTTTACTAAAGAAGGCCAGCAGG + Intronic
1120586740 14:86320981-86321003 CTTTAGACAAGAAGGCCTGTTGG + Intergenic
1122723351 14:103734664-103734686 CTTTGGTGATGAAGGGAAGAAGG + Exonic
1126800917 15:52295742-52295764 CTTTGGGCAAGATGGCCCGGCGG - Exonic
1128835061 15:70802860-70802882 CATGAGTCAAGAAGGCCGGATGG + Intergenic
1129385704 15:75195255-75195277 CTCAGGGCAAGAAGGCCACAGGG + Intergenic
1130749837 15:86699653-86699675 CTTTGGGCAAGAATACCACAGGG + Intronic
1131573157 15:93559667-93559689 GTTTGGTCATGAATGCCACAAGG - Intergenic
1133674248 16:8055386-8055408 CATTGGTCCAGGAGGCCAGGGGG - Intergenic
1134054130 16:11158581-11158603 GTTTGGTCAAGGAGGCCCCAAGG + Intronic
1134815106 16:17199230-17199252 CTTTAGTCAAGAAGGCAAAGGGG - Intronic
1137679699 16:50329670-50329692 CTGTGGTCAGGAAGGGCAGCCGG + Intronic
1137747990 16:50837335-50837357 CTTTGGCCCATAAGACCAGAGGG - Intergenic
1141255883 16:82402002-82402024 CTTTGAGAAAGAAGGCCAGGGGG + Intergenic
1143272028 17:5682985-5683007 CTCTGGTCAAGAAGAGCTGAAGG + Intergenic
1146285052 17:31568669-31568691 CTTGGGGTAAGAAGGCAAGAGGG - Intergenic
1146883445 17:36456125-36456147 CTTTGGGAAGGAAGGACAGAAGG + Intergenic
1154527883 18:15311876-15311898 CTTTTGACAGGAAGGCCACATGG + Intergenic
1155625442 18:27829092-27829114 CTATAGTAAAGTAGGCCAGAAGG + Intergenic
1160552754 18:79705479-79705501 CTTTGTCCATGAAGGACAGACGG - Intronic
1161909588 19:7182972-7182994 TTTTGGTCAATAAAGCCAAAAGG + Intronic
1163523860 19:17808405-17808427 ATTTGGACAAGAAGGACAGGTGG - Intronic
1163545112 19:17936676-17936698 CTTTGGTCTGAAAGGCCAGGAGG + Intronic
1165110669 19:33500274-33500296 CTTTGGTCAAGTAGACCACAGGG + Intronic
1165872943 19:38986085-38986107 CTTTGGTCTAGCTGGCCAGCTGG + Intergenic
925174089 2:1770251-1770273 CTTCTGTCAAGAAAGCCAGAGGG + Intergenic
926675280 2:15613538-15613560 CTTTACCCATGAAGGCCAGAAGG - Intronic
927339192 2:21962029-21962051 CTTTGGCCTGGAAGCCCAGAGGG - Intergenic
929028417 2:37627722-37627744 CTTTCATCCAGAAGACCAGATGG - Intergenic
929587932 2:43127716-43127738 CTTTGCTCAATAAGGCCCCAAGG - Intergenic
930670975 2:54150269-54150291 CTTTTCTGTAGAAGGCCAGATGG - Intronic
932455445 2:71846722-71846744 GTTTGGCCAAGAAAGCCAAAGGG + Intergenic
933688198 2:85159671-85159693 CTTGGGTCAAGGAAGCCTGAAGG - Intronic
935527476 2:104188570-104188592 CCTTGGTCAAGAAAATCAGACGG - Intergenic
937193484 2:120127982-120128004 CTTAAGTCAAAAAGGCAAGAGGG - Intronic
937675013 2:124580654-124580676 GTTTGGTCATGATGCCCAGAAGG + Intronic
939529289 2:143337057-143337079 ATCTGGTCAAGGAGGACAGAGGG + Intronic
941081842 2:161070819-161070841 CATTGCCCAAGAAGGCCAGCAGG - Intergenic
941406330 2:165093364-165093386 CATAGGTAAAGAAGGACAGATGG - Intronic
941745600 2:169083464-169083486 CTTTGGTCAAGAAAGCTCAAGGG + Exonic
942363238 2:175195202-175195224 AAATGGTCAAGAAGGGCAGATGG - Intergenic
947996678 2:234533835-234533857 CTTTGGTGAGGAAGGAAAGATGG + Intergenic
1171052056 20:21868891-21868913 CTTTGCTCTAGGAGGCCAAAGGG + Intergenic
1172039177 20:32031582-32031604 CTTTGTCCCAGAAGTCCAGAGGG + Exonic
1175376964 20:58534527-58534549 CTTTAATCAAGAAGGGCAGCAGG + Intergenic
1175444142 20:59008558-59008580 CTATAGTCAGGGAGGCCAGAGGG - Intergenic
1177530121 21:22347501-22347523 ATTTGAACAAGGAGGCCAGAAGG - Intergenic
1178307311 21:31501459-31501481 CTTTGGTCAATCAGGCCCAAAGG - Intronic
1179363411 21:40733705-40733727 CTGAGGTCAAGGAGGCTAGAGGG - Intronic
1179439279 21:41381812-41381834 CTTTAGTGAAGATTGCCAGATGG - Intronic
1180068807 21:45425885-45425907 CTTTGGGCAAGAAGGACAGCCGG - Intronic
1181503812 22:23337486-23337508 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
1181708808 22:24667706-24667728 CTGTGGCCAGGAAGGCAAGAGGG + Intergenic
952539897 3:34357019-34357041 CTGTTCTCAAGAAGTCCAGAAGG + Intergenic
954700579 3:52448803-52448825 CTTTGGGCAAGAAAGCCCGGTGG - Intergenic
959679582 3:109078767-109078789 CTTTGGCCAAGAAAGAGAGATGG + Intronic
960088586 3:113616266-113616288 CTAAAATCAAGAAGGCCAGATGG + Intronic
960246906 3:115409761-115409783 CTTTGGTCAGGATTTCCAGATGG - Intergenic
962081453 3:132143693-132143715 CTTTGGTAAAGGATGCTAGAAGG + Intronic
962417584 3:135197202-135197224 CTTTAGGCAAGAAGGCCTTATGG - Intronic
962849703 3:139299277-139299299 CTCTGGTCAATAAGGCCTGCTGG - Intronic
963619470 3:147587503-147587525 CTTTGGTCAGGAAGGCTGTATGG + Intergenic
968139189 3:196242917-196242939 CTGTGGTCAATAGGGCCAGAGGG + Intronic
970579063 4:17457703-17457725 CTTTGCTCAAGAACACCAGCTGG + Intergenic
970820231 4:20203771-20203793 AATTTCTCAAGAAGGCCAGAAGG - Intergenic
972832987 4:42835592-42835614 CCTTGGTGAAGATGGCCAGAAGG - Intergenic
973539268 4:51919872-51919894 ATGTAGTCAAGAAGGCCAGTTGG + Intergenic
976200731 4:82575821-82575843 CTTTTGTCATGAAGGGCTGATGG + Intergenic
977551336 4:98447035-98447057 CTGTGGGCAAGCATGCCAGAAGG - Intergenic
978854907 4:113383399-113383421 GTTTTGACAAGAAGGCCATAGGG - Exonic
981404666 4:144354093-144354115 CTTTGGGCTAGAAGGACAAATGG + Intergenic
983510170 4:168601328-168601350 CTTTGGTCCAGAAGACCTCAAGG + Intronic
984002129 4:174261929-174261951 CTTTGGTAAAGGATGCTAGAAGG + Intronic
984096600 4:175442741-175442763 CTTTGCTCAAGAAAGCGAAAAGG - Intergenic
984381679 4:179000750-179000772 CTTTGGAAAAGAATTCCAGAAGG - Intergenic
985263722 4:188138995-188139017 CTTTGGTCAAGCAGAACAAAAGG + Intergenic
986239184 5:5941878-5941900 CTTTGCCCAAGAAGCCCAGGAGG - Intergenic
988450413 5:31336909-31336931 CTTAGGGCAAGAAGGGAAGAGGG + Intergenic
988502828 5:31797987-31798009 CTTTGGTGGAGAAGGCGAGTTGG + Intronic
996580706 5:125029274-125029296 AGTTGGTCATGAAGGCCAGCAGG - Intergenic
996812871 5:127539487-127539509 ATATGGGCAAGAAGGCCTGATGG + Intronic
998504387 5:142660363-142660385 CTTGAGTCATGAAGGCCAAAGGG - Intronic
1001916753 5:175568115-175568137 CTTTTATCAAGAGGGCCATAGGG - Intergenic
1001964931 5:175903387-175903409 GTCTGGTCAAGGAGGTCAGAAGG + Intergenic
1002252024 5:177935801-177935823 GTCTGGTCAAGGAGGTCAGAAGG - Intergenic
1005960123 6:30687983-30688005 GTTTGGGAAAGAAAGCCAGAGGG - Intergenic
1006020823 6:31116636-31116658 CTTTGGTGAAGTAGCCCACAGGG + Exonic
1009529278 6:64789345-64789367 CTCTGGTTAAGAAAGGCAGAAGG - Intronic
1012231890 6:96769424-96769446 CTTTTGTAAAGCAGGCCTGATGG - Intergenic
1012939137 6:105399266-105399288 CTTTGTTCTACAATGCCAGAAGG + Intronic
1015055549 6:128898555-128898577 CTGTGGTCTAGAAGGCAATAGGG - Intronic
1017562536 6:155644380-155644402 CTTTTGTCAAGATGGACATAAGG - Intergenic
1019126879 6:169846466-169846488 CTTTGGTAATGAACGCCAAATGG - Intergenic
1022636634 7:32142406-32142428 CTTTGCTCAGAATGGCCAGAGGG + Intronic
1024263937 7:47592445-47592467 CTTTGGTCATTCTGGCCAGAAGG - Intergenic
1026413541 7:70154120-70154142 CTTTTGTCAAGAAAGACAGTTGG - Intronic
1030220220 7:107090581-107090603 CTTTGGCAAAGAAAGACAGAGGG - Intronic
1030849767 7:114469094-114469116 CTGTGGTCAAGAAGGCCAAGAGG - Intronic
1033233002 7:139616292-139616314 CTGTGCTCAAGAAGGCTGGAAGG - Intronic
1033568095 7:142599283-142599305 CCTTGGTCCACAAGGTCAGAGGG - Intergenic
1035149349 7:156854643-156854665 CTTAGGTGAAGAAGGCTAGAGGG - Intronic
1038024237 8:23574664-23574686 CTTTGGAGATAAAGGCCAGATGG - Exonic
1038130992 8:24731425-24731447 CTTTGAACAAGAAGGTCAGGTGG - Intergenic
1041658722 8:60379847-60379869 CATTGGTAAAGATGGACAGATGG - Intergenic
1041926158 8:63238749-63238771 CTTGAGGCTAGAAGGCCAGAAGG - Intergenic
1042141392 8:65682356-65682378 CTTTGGTCTAGGAAGCCATATGG + Exonic
1042229332 8:66540879-66540901 CTTTGCTCAAGAGGGAAAGAAGG + Intergenic
1043767499 8:84155321-84155343 CTTTGGTCTAGAAGCCCTAAAGG + Intergenic
1044426486 8:92057250-92057272 CTTTTGTAATGAAGGCTAGATGG - Intronic
1045712206 8:104998056-104998078 CTTTGGGGAAGGATGCCAGAAGG + Intronic
1047754418 8:127907677-127907699 TTTGGGTCAGGAAGCCCAGATGG + Intergenic
1048310842 8:133321470-133321492 ATTTGATCAAGAATTCCAGAAGG + Intergenic
1050119374 9:2292661-2292683 CTTTGTTCAAAGTGGCCAGAAGG - Intergenic
1052324725 9:27205399-27205421 TTTTGGTAAGGAAGGACAGAGGG + Intronic
1052989888 9:34512914-34512936 CCTGGGACAAGCAGGCCAGAGGG + Intronic
1055585436 9:77754376-77754398 ATTTTGTCAAGAAGTACAGATGG - Intronic
1055965182 9:81859244-81859266 CTAAGGCCAAGAGGGCCAGATGG - Intergenic
1056106259 9:83349603-83349625 CTTTGGTCTTGCAGGCTAGATGG - Intronic
1056216805 9:84412752-84412774 CTTTGCTAAAATAGGCCAGATGG + Intergenic
1057435204 9:95033669-95033691 CTTTCATCAAAAAGGCCACATGG + Intronic
1058213364 9:102200964-102200986 TCTTGGTCAAGTAGGCCAGCTGG + Intergenic
1060025642 9:120168703-120168725 CTTTGGGCAAGATGACCAGCTGG - Intergenic
1060482888 9:124028138-124028160 CTTTCATCAAGAAAGCCAGGAGG - Intronic
1061315274 9:129791837-129791859 CTTAAGTCAAAAAGGCAAGAAGG - Intergenic
1061533217 9:131230810-131230832 CTTTGGGGGAGAAGGCAAGAGGG - Intronic
1062525181 9:136975372-136975394 CTGTGGTCAAGATGGCCAGCAGG - Intergenic
1186897638 X:14020359-14020381 CTTTGGGGAAGAAGCGCAGAAGG + Exonic
1186998676 X:15151941-15151963 GTATGGTCAATAGGGCCAGAGGG - Intergenic
1188648112 X:32594257-32594279 CTTTGGTAAAGAGGTACAGATGG - Intronic
1189269156 X:39738509-39738531 CTTTAGTCGAAAAGGCCAAATGG - Intergenic
1197703849 X:129619549-129619571 CTTTGGCCAGGAAGGAAAGAAGG - Intergenic
1198151790 X:133917933-133917955 CTTTGCTTAAGTATGCCAGAGGG - Intronic