ID: 916194389

View in Genome Browser
Species Human (GRCh38)
Location 1:162209933-162209955
Sequence TAGCCAAGGCTGATGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 405
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 377}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916194389 Original CRISPR TAGCCAAGGCTGATGCAGAG TGG Intronic
900570869 1:3357574-3357596 CAGCCAGTGCTGATGGAGAGGGG + Intronic
901543567 1:9938205-9938227 TTGCCTAGGCTGAAGCACAGTGG + Intronic
903044912 1:20557354-20557376 CAGCCAAGGATGATGCAGAAGGG + Intergenic
903187247 1:21635608-21635630 CAGCTAGGGCTGGTGCAGAGCGG - Intronic
903469844 1:23579065-23579087 TCACCACGCCTGATGCAGAGTGG - Intergenic
903929019 1:26851581-26851603 TTGCCAAGCCTGAGGCAGAAAGG + Intronic
903988450 1:27247094-27247116 TTGCCCAGGCTGGAGCAGAGTGG + Intronic
904164453 1:28544696-28544718 TAGCCAAGGCGGAGAGAGAGGGG + Intergenic
904734612 1:32621357-32621379 TAGCCCAGGCTGAAGCGCAGTGG - Exonic
905886364 1:41494159-41494181 TCCCCAAGGCTGATCCAGAGAGG + Intergenic
907186124 1:52610568-52610590 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
907194750 1:52677359-52677381 CTGTCAGGGCTGATGCAGAGGGG - Intergenic
907313483 1:53553138-53553160 TCGCCAAGGCTGATGGGGATGGG - Intronic
907501300 1:54883516-54883538 TAGCCAAGGGCATTGCAGAGTGG - Intronic
910012728 1:82485702-82485724 TAGCCAAGGCAGAGAGAGAGAGG + Intergenic
913128997 1:115820886-115820908 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
915296097 1:154922967-154922989 TAGCACAGGCTGAAGGAGAGAGG - Intergenic
915989635 1:160500993-160501015 AAGTCAAGGCTAAGGCAGAGTGG + Intronic
915990040 1:160504941-160504963 AAGTCAAGGCTAACGCAGAGTGG + Intronic
916121199 1:161529792-161529814 TACCCCAGGCTGAAGCACAGTGG - Intergenic
916194389 1:162209933-162209955 TAGCCAAGGCTGATGCAGAGTGG + Intronic
917096656 1:171404940-171404962 TAGCCAAGGCGGAGAAAGAGAGG + Intergenic
918335547 1:183508103-183508125 CAGCCAATGCTCATACAGAGAGG - Intronic
918640887 1:186840013-186840035 TTGCCCAGGCTGAAGCACAGTGG + Intronic
919119546 1:193321929-193321951 TTGCCCAGGCTGATGCACAGTGG - Intergenic
919260762 1:195190796-195190818 TAGCAAAGGCAGTGGCAGAGAGG - Intergenic
919671288 1:200340314-200340336 TAGCCCAGGCTGGAGCATAGTGG - Intergenic
919790188 1:201285610-201285632 CAGCCAAGTCTTGTGCAGAGAGG - Intronic
923598289 1:235378258-235378280 TTGCCTAGGCTGGAGCAGAGTGG + Intronic
923664070 1:235983222-235983244 TGGCGAAGGCTAATGCAAAGGGG - Intronic
924603972 1:245516476-245516498 TAGCAAAGGCAGCTGCAGCGGGG - Intronic
1064087956 10:12359585-12359607 TTGCCCAGGCTGATGGAGAGAGG - Intronic
1065028783 10:21564594-21564616 TAGCCAAAACTGATGAACAGAGG - Intronic
1065837519 10:29672432-29672454 TCGCCCAGGCTGAAGCACAGCGG - Intronic
1069898291 10:71692414-71692436 TAGCCAGGGCTGCTCCACAGAGG + Intronic
1070437402 10:76406659-76406681 TACACAAGGCTGATTCAGGGTGG + Intronic
1072146173 10:92640770-92640792 TAGCCCAGGCTGAAGTACAGTGG + Intronic
1072208434 10:93224782-93224804 TAGCCAAGACTGATACAGTTTGG + Intergenic
1072261754 10:93682763-93682785 TTGCCTAGGCTGAAGCACAGTGG - Intronic
1072333172 10:94373326-94373348 TCGCCCAGGCTGAAGCACAGTGG + Intergenic
1073369106 10:102970633-102970655 TTGCCCAGGCTGAAGTAGAGTGG + Intronic
1074059859 10:109955108-109955130 TTGCCCAGGCTGGTGCAGAGGGG + Intergenic
1075314205 10:121439010-121439032 GAGCCAAGGGTGATGCCAAGTGG + Intergenic
1075730292 10:124631747-124631769 GACCCAGGGCTGGTGCAGAGGGG - Intronic
1076497618 10:130907248-130907270 TAGCCCAGGGCGATGCATAGCGG + Intergenic
1076669779 10:132113328-132113350 TGGCCAAGGCACCTGCAGAGAGG - Intronic
1077639886 11:3872090-3872112 TCGCCCAGGCTGAAGCACAGTGG + Intronic
1079200048 11:18369253-18369275 TTGCCCAGGCTGGAGCAGAGTGG - Intergenic
1079455702 11:20634322-20634344 TACCCAAGGCAGATGGGGAGCGG - Intronic
1079542108 11:21589036-21589058 TGGCCAAGGCTGAAGCAGGGTGG + Intergenic
1080816523 11:35763073-35763095 GAGCTAAAGCTGATCCAGAGTGG - Intronic
1081877434 11:46418907-46418929 CAGCCAAGGCTGATGCTCACTGG - Intronic
1082217004 11:49583508-49583530 TTGCCCAGGCTGAAGAAGAGTGG + Intergenic
1082898338 11:58217515-58217537 TGGCCCAGGCTGGAGCAGAGTGG + Intergenic
1082913791 11:58408268-58408290 TAGCCAAGGCTGGAGTACAGAGG - Intergenic
1083130261 11:60618490-60618512 TAGCCAAGGCAGAGAGAGAGAGG + Intergenic
1084218015 11:67661813-67661835 TAGCCCAGGCTGAAGTACAGAGG - Intergenic
1084802549 11:71554698-71554720 TAGCATGGGCTGATGCGGAGGGG - Intronic
1085180526 11:74531842-74531864 TTGCCAAGGCTGGAGCACAGTGG + Intronic
1085469253 11:76746402-76746424 TAGCCCAGGCTGAAGTACAGTGG - Intergenic
1086632550 11:89040659-89040681 TTGCCCAGGCTGAAGAAGAGTGG - Intronic
1086899233 11:92347555-92347577 GAGCCAAGGCTGTCCCAGAGAGG + Intergenic
1088071590 11:105793207-105793229 TAGACAAGGCCGATGGAGTGAGG + Intronic
1088587137 11:111369141-111369163 AAGCCAATGATGCTGCAGAGGGG + Intronic
1088893703 11:114062609-114062631 AGGCCAAGGCTGATGGTGAGAGG + Intronic
1089146861 11:116335559-116335581 AAGCCAAGGCCCATGGAGAGTGG - Intergenic
1089572660 11:119420559-119420581 GATCCAAGGCTCAAGCAGAGTGG - Intronic
1091338634 11:134793506-134793528 CAGCCTAGTCTGAGGCAGAGAGG + Intergenic
1091953550 12:4615957-4615979 CTGCCAAGGCTGGAGCAGAGAGG + Intronic
1092166490 12:6345880-6345902 GGGCCAAGGCTGAGGCTGAGGGG + Intergenic
1093984856 12:25519256-25519278 GAGGCAAGGCTGCTGCAGAGAGG - Intronic
1094659468 12:32453271-32453293 TTGCCCAGGCTGGAGCAGAGTGG + Intronic
1095463526 12:42466914-42466936 TAGCCCAGGCTGGAGCACAGTGG + Intronic
1096584044 12:52608032-52608054 TAACAAAGACTGAGGCAGAGAGG + Exonic
1096712871 12:53470442-53470464 TTGCCCAGGCTGGAGCAGAGAGG + Intronic
1096802561 12:54120912-54120934 TAGCCCAGACTGGTGCACAGTGG + Intergenic
1097674096 12:62579202-62579224 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1097869873 12:64592674-64592696 TTGCCCAGGCTGATGTACAGTGG + Intergenic
1097897738 12:64842317-64842339 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1098950601 12:76637035-76637057 TTGCCCAGGCTGGAGCAGAGTGG + Intergenic
1098967045 12:76801612-76801634 TAGCCCAGGCTGGAGCACAGTGG - Intronic
1099091602 12:78317260-78317282 TAGCCTAAGGTCATGCAGAGTGG + Intergenic
1099651210 12:85430368-85430390 TTGCCCAGGCTGGTGCACAGTGG + Intergenic
1100987397 12:100216193-100216215 TAGCCCAGGCTGGAGCACAGCGG + Intronic
1103693108 12:122791798-122791820 GAGGCAAGGCTGGTGCAGGGAGG + Intronic
1103983577 12:124752430-124752452 TAGTCAAAGCTGAGTCAGAGAGG - Intergenic
1104950541 12:132437879-132437901 GAGCCAGGGCTGAGGCTGAGCGG + Intergenic
1104951988 12:132445266-132445288 TGGCCAGGGCAGATGCAGTGGGG - Intergenic
1105358197 13:19679454-19679476 TAGCCCAGGCTGGAGCACAGTGG - Intronic
1105466225 13:20643791-20643813 TCGCCCAGGCTGCTGCACAGTGG + Intronic
1105877006 13:24565170-24565192 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1108065968 13:46577927-46577949 TAGCCATGGGGGATGCAGAAGGG + Intronic
1108345169 13:49538674-49538696 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1108498653 13:51048804-51048826 TAGCCAAGCCTGCTGAAAAGAGG + Intergenic
1109161227 13:58977117-58977139 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1110065691 13:71102762-71102784 TAGCCAAGGCTGAAGTGCAGTGG + Intergenic
1110769948 13:79331048-79331070 TCGCCCAGGCTGAAGCACAGTGG + Intronic
1110867879 13:80418292-80418314 TAGTAAAGGCTGCTGCAGACTGG - Intergenic
1111086849 13:83386673-83386695 TAGCCCAGGCTGGAGTAGAGTGG - Intergenic
1111307507 13:86434472-86434494 TAGCCATGGCTGAAGCAGCTGGG - Intergenic
1111344931 13:86939127-86939149 TCGCCCAGGCTGAAGCACAGTGG - Intergenic
1111408769 13:87846039-87846061 TGGTCAAGACTGATCCAGAGGGG + Intergenic
1112402013 13:99086120-99086142 TCGGCAGGGCTGAGGCAGAGCGG - Intronic
1114457479 14:22865592-22865614 AAGACAAAGCTGAGGCAGAGGGG + Intergenic
1114730499 14:24987780-24987802 TACCCAAGGGAGATGCAGAGTGG + Intronic
1115132668 14:30072715-30072737 TAGCCATGGCTGGTGCAGCTGGG - Intronic
1115216452 14:31018253-31018275 TGGCCCAGGCTGATGTAGACTGG - Intronic
1115234458 14:31195558-31195580 TAGCCCAGGCTGCAGCACAGTGG + Intronic
1115730287 14:36261152-36261174 CAGTCAAGGCTAAGGCAGAGTGG - Intergenic
1115945615 14:38656402-38656424 CAGCCAAAGTTCATGCAGAGGGG + Intergenic
1117202198 14:53402464-53402486 TAGCCAAGGCTGAAGTCCAGTGG - Intergenic
1117796418 14:59398800-59398822 AGGGCAAGGCTGAAGCAGAGAGG - Intergenic
1118471254 14:66077234-66077256 TAGCCATGGATGATGCAGTAGGG - Intergenic
1120992712 14:90392060-90392082 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1121737120 14:96226251-96226273 TACCCCAGGCCGAGGCAGAGGGG - Intronic
1121795521 14:96732333-96732355 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1122567158 14:102667459-102667481 TTGCCAAGGCTGGAGCACAGTGG - Intronic
1122725160 14:103745848-103745870 TTGCCCAGGCTGAAGCACAGTGG + Intronic
1123065879 14:105618926-105618948 AAGCCAAGGTTGAGGCCGAGTGG - Intergenic
1123070036 14:105638172-105638194 AAGCCAAGGTTGAGGCCGAGTGG - Intergenic
1123074628 14:105661834-105661856 AAGCCAAGGTTGAGGCCGAGTGG - Intergenic
1123089275 14:105734959-105734981 AAGCCAAGGTTGAGGCCGAGTGG - Intergenic
1123095062 14:105763116-105763138 AAGCCAAGGTTGAGGCCGAGTGG - Intergenic
1124509823 15:30314283-30314305 GAGCCAAGGATAATACAGAGAGG - Intergenic
1124733068 15:32216271-32216293 GAGCCAAGGATAATACAGAGAGG + Intergenic
1125879495 15:43181539-43181561 TCGCCCAGGCTGAAGCACAGTGG + Intronic
1126126637 15:45299966-45299988 TAGCCAAGGCTGGAGTACAGTGG + Intergenic
1126583904 15:50264686-50264708 TTGCATAAGCTGATGCAGAGGGG - Intronic
1126614615 15:50564207-50564229 TCACCCAGGCTGAAGCAGAGGGG - Intronic
1126630212 15:50727082-50727104 TAGCCAAGTCTGTTGTGGAGAGG + Intronic
1128144211 15:65323359-65323381 CTGCCCACGCTGATGCAGAGTGG + Intergenic
1128492023 15:68156906-68156928 AAGGCAAGGCTAATGCAGTGAGG + Intronic
1128608981 15:69058794-69058816 TTCCCAAGCCTGATGAAGAGGGG - Intronic
1128716416 15:69911687-69911709 TAGAAAAGGCTGATGAAAAGTGG - Intergenic
1129269565 15:74412192-74412214 CTTCCAAGGCTGATCCAGAGAGG + Intronic
1130404948 15:83591045-83591067 TAGCCCAGGCTGGAGTAGAGTGG + Intronic
1132681139 16:1142253-1142275 CAGCCATGGCTGCTGCAGCGTGG + Intergenic
1132771723 16:1567316-1567338 GGGCCAAGGCTGATGCAGGTGGG - Intronic
1132992632 16:2804873-2804895 GAGCCCAGGCTGGGGCAGAGTGG - Intergenic
1133085260 16:3357411-3357433 TTGCCCAGGCTGAAGTAGAGTGG + Intergenic
1134013590 16:10873010-10873032 TCGCCAAGGCTGGAGCACAGTGG + Intergenic
1135036095 16:19078110-19078132 TATCCAGGCCGGATGCAGAGTGG + Exonic
1135203313 16:20459577-20459599 TATGCAAGTCTCATGCAGAGGGG + Intronic
1135215690 16:20565361-20565383 TATGCAAGTCTCATGCAGAGGGG - Intronic
1136142356 16:28295574-28295596 TAGACAATGCTGATGCAGTATGG - Intronic
1136464363 16:30431804-30431826 TCGCCCAGGCTGAAGCACAGTGG - Intergenic
1136508921 16:30723921-30723943 GAGTCAAGGCTGATGCTGACGGG - Exonic
1137480721 16:48849917-48849939 AAGCCATTGGTGATGCAGAGTGG - Intergenic
1139520123 16:67477710-67477732 TAGCCCAGGCTGGAGCACAGTGG + Intronic
1139868513 16:70083912-70083934 TCGCCCAGGCTGGAGCAGAGTGG - Intergenic
1139894629 16:70278523-70278545 TAGCCCAGGCTGGAGTAGAGTGG - Intronic
1140346567 16:74219395-74219417 TAGACAAGACTGAGGCACAGAGG + Intergenic
1140386824 16:74547968-74547990 TCGCCCAGGCTGGAGCAGAGTGG + Intronic
1141557963 16:84848490-84848512 CAGCCAAGGCTGAAGCAAGGGGG + Intronic
1141589790 16:85060802-85060824 TTGCCCAGGCTGAAGTAGAGTGG - Intronic
1141704763 16:85658702-85658724 TAGGCAAGGCTGAGCCTGAGAGG - Intronic
1141948058 16:87323763-87323785 CAGCCAAGGCAGATGCAGCCAGG + Intronic
1142307976 16:89296026-89296048 TAGCCAAGGATGGAGCACAGTGG + Intronic
1142558206 17:793892-793914 TCCCAAAGGCTGGTGCAGAGAGG + Intergenic
1142922055 17:3197365-3197387 TAGCCATGGCTAATGAAAAGTGG + Intergenic
1143728973 17:8869532-8869554 AAGCCAAGGCTGATAAGGAGAGG - Intergenic
1143778839 17:9218781-9218803 TAGCATAGGCTGTGGCAGAGGGG - Intronic
1143931244 17:10428706-10428728 TAGCAAATGGTGGTGCAGAGAGG + Intergenic
1143997957 17:11024491-11024513 TTGCCTAGGCTGGAGCAGAGTGG + Intergenic
1145878146 17:28335368-28335390 CAGCCCAGGCTGATGTAGACAGG + Exonic
1146603059 17:34235251-34235273 TAGCCAGTCTTGATGCAGAGAGG - Intergenic
1147197236 17:38775290-38775312 TAGTTCAGGCTGATGCACAGTGG + Intronic
1147626349 17:41902864-41902886 TCGCCCAGGCTGAAGCACAGTGG + Intronic
1147835110 17:43324450-43324472 TAGCCGAGGCAGAGACAGAGAGG + Intergenic
1148491852 17:48028444-48028466 TAGCCAAGGCAGATGCAGGGGGG + Intronic
1148936128 17:51165937-51165959 TAACCAGGGCTCAAGCAGAGGGG + Intronic
1149214048 17:54333694-54333716 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1149401586 17:56301951-56301973 TTGCCAAGACTGTTGAAGAGTGG - Intronic
1149987120 17:61355695-61355717 TAGCTATGCCTGATGCAAAGTGG + Intronic
1150096895 17:62384573-62384595 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1150128575 17:62653941-62653963 TAGCCAGGGGTGGTGCAGGGTGG + Intronic
1150231269 17:63552107-63552129 GTGACAAGGCTGATGCAGGGGGG + Intronic
1150518937 17:65846606-65846628 TTGCCTAGGCTGAAGCACAGTGG + Intronic
1151769596 17:76151366-76151388 TTGCACAGGCTGATGGAGAGTGG + Intronic
1152115954 17:78387337-78387359 TTGCCCAGGCTGGTGCACAGTGG + Intronic
1153298781 18:3574173-3574195 TAGACAAGTCTGATTGAGAGAGG - Intronic
1153701542 18:7699446-7699468 TTGCCCAGGCTGAAGTAGAGTGG + Intronic
1153897042 18:9573635-9573657 TAGCCCAGGCTGGTGTAAAGTGG + Intronic
1154332555 18:13441800-13441822 GAGCCCAGGCTGAGGCATAGTGG + Intronic
1154506601 18:15046268-15046290 TAGCCATGGCTGAAGCAGCTGGG + Intergenic
1155073268 18:22334576-22334598 TAGCCAAGGCTGGAGGTGAGTGG + Intergenic
1155138432 18:23019799-23019821 TTGCCCAGGCTGAAGCACAGTGG + Intronic
1155175409 18:23297476-23297498 TCGCCTAGGCTGAAGCACAGTGG - Exonic
1155297942 18:24402411-24402433 TAGTCAAGGTAGATGCAGAAAGG + Intergenic
1157663719 18:49467914-49467936 TTGTTAAGGCTGAAGCAGAGGGG - Intergenic
1158319361 18:56246594-56246616 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
1158903716 18:61990127-61990149 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
1161434376 19:4253861-4253883 TAGCCAAGGCTGGAGTACAGTGG + Intronic
1162306671 19:9878884-9878906 TAGCCCAGGCTGGAGCACAGTGG + Intronic
1162780368 19:13003676-13003698 TAGCCCAGGCTGGAGCACAGTGG + Intronic
1162943006 19:14025176-14025198 TCGCCCACGCTGATGCACAGTGG + Intergenic
1163602257 19:18256190-18256212 TCGCCCAGGCTGAAGCACAGTGG + Intergenic
1164125075 19:22306396-22306418 TTGCCCAGGCTGGTGCACAGTGG - Intronic
1164300666 19:23959873-23959895 TAGCCAAGGCTGAAGTACAATGG + Intergenic
1164860564 19:31559063-31559085 TTTCCCAGGCTGCTGCAGAGTGG + Intergenic
1165059792 19:33199554-33199576 CAGCCCAGCCTCATGCAGAGGGG - Intronic
1165062925 19:33213666-33213688 GAGCCAGGGCTGAAGCCGAGAGG - Intronic
1165308898 19:35018966-35018988 AAGCCAAGACGGGTGCAGAGGGG + Intronic
1166420714 19:42633915-42633937 TCCCCAAGGCTGATGCAGCAGGG + Intronic
1166954065 19:46450393-46450415 TCGCCCAGGCTGATGTACAGTGG + Intergenic
1167392868 19:49208047-49208069 TAGCCAAGGCGGAGAGAGAGAGG + Intronic
1167620837 19:50559583-50559605 TTGCCAAGGCTCAGGCAGTGGGG + Intronic
1168080106 19:54003895-54003917 TCGCCCAGGCTGATGTACAGTGG + Intronic
1168628498 19:57938082-57938104 TTGCCAAGGCTGAAGCGCAGTGG + Intergenic
925481137 2:4275919-4275941 TGACCAAGGCTGAGGCAGAGAGG + Intergenic
926614324 2:14980354-14980376 CAGGCAAGGCTGAAGCACAGGGG + Intergenic
926711110 2:15881520-15881542 TTGCCAAGGCTGGAGCACAGTGG - Intergenic
928009032 2:27591074-27591096 TTGCCAAGGCTGAAGCGCAGTGG + Intronic
930206684 2:48593996-48594018 TAGCCCAAGTTGATGCAAAGGGG - Intronic
930214374 2:48679417-48679439 AAGCCATTGGTGATGCAGAGTGG + Exonic
930402674 2:50910510-50910532 TAGCCAAGGATCATGGAGACTGG - Intronic
930690509 2:54358439-54358461 TCGCCCAGGCTGAAGCACAGTGG + Intronic
931165591 2:59744112-59744134 TGGCCAAGGCAGATGGAGGGAGG + Intergenic
931704776 2:64938167-64938189 CAGCTAAGGCTGAAGCAGGGGGG - Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
933653993 2:84872458-84872480 TTGCCCAGGCTGAAGCACAGTGG - Intronic
935275429 2:101472138-101472160 TCGCCCACGCTGAAGCAGAGTGG + Intronic
935822299 2:106906401-106906423 TGGCAAAGCCTGATGCAGGGTGG + Intergenic
936977809 2:118237040-118237062 TAGTCAGGGCTGATACATAGTGG - Intergenic
938055941 2:128214810-128214832 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
941263509 2:163328395-163328417 TAGCCAATGCTGATTAGGAGAGG + Intergenic
942028056 2:171930652-171930674 TTGCCAAGGCTGGAGTAGAGTGG + Intronic
943689793 2:190857876-190857898 GAGCCAAGGTGGCTGCAGAGGGG - Intergenic
943886316 2:193221386-193221408 TAGCCAAGGCTGGAGTACAGTGG + Intergenic
944646490 2:201785722-201785744 TCGCCAAGGCTGAAGTACAGTGG + Intergenic
945076564 2:206045820-206045842 CAGCCAAGGAAGATACAGAGAGG + Intronic
945915432 2:215698973-215698995 TTGCCTAGGCTGAAGCACAGTGG + Intergenic
947482010 2:230509496-230509518 CAGTCAAGGCTGATGCAGTCTGG + Intronic
947599013 2:231433456-231433478 TAGCCCAGGCTGAAGCGCAGTGG - Intergenic
948442903 2:238007991-238008013 TTGCCCAGGCTGAAGCACAGTGG + Intronic
948450906 2:238070869-238070891 TTGCCCAGGCTGATGCATAGTGG + Intronic
1170142431 20:13138259-13138281 TGGCCAAAGCTGATGCTGAATGG - Intronic
1170703895 20:18727920-18727942 TGGCCTAGGGTGAAGCAGAGGGG + Intronic
1171254505 20:23679280-23679302 CAGCTAAGGCTGATTCAGATGGG + Intergenic
1171260989 20:23734552-23734574 CAGCTAAGGCTGATGCAAATGGG + Intergenic
1171270108 20:23810394-23810416 CAGCTAAGGCTGATGCAGATGGG + Intergenic
1171794185 20:29553675-29553697 TAGCCCAGACTGGTGCACAGTGG - Intergenic
1172377057 20:34452028-34452050 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1172481217 20:35272659-35272681 TAGCCTGGCCAGATGCAGAGTGG + Intronic
1173230259 20:41190179-41190201 TAGCCCAGGCGGAAGCACAGGGG + Intronic
1173885025 20:46449878-46449900 TAGCCAAGGCTGGAGTACAGTGG + Intergenic
1174698700 20:52586091-52586113 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1174817471 20:53699119-53699141 TAGCCAAGGCTGGAGTACAGTGG + Intergenic
1175867032 20:62184316-62184338 TTGCCTAGGCTGGAGCAGAGTGG - Intronic
1176007456 20:62874231-62874253 CAGCCAAGGCAGAGACAGAGAGG - Intergenic
1178231583 21:30791081-30791103 TAGCCTGGGCTGATGCAGAAGGG + Intergenic
1179625006 21:42644121-42644143 TAGCCCAGGCTGGAGTAGAGCGG - Intergenic
1180556345 22:16580355-16580377 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1180948011 22:19707518-19707540 GAGGCAGGGCTGATGCACAGGGG - Intergenic
1181748931 22:24975792-24975814 TAGCCAAGGATGGTGCAGAGCGG + Intronic
1182126416 22:27819073-27819095 ATGTCAAGGCTGCTGCAGAGGGG + Intergenic
1183316166 22:37137931-37137953 CAGGCAAGGGGGATGCAGAGTGG - Intronic
1183940682 22:41293370-41293392 TTGCCTAGGCTGAAGCACAGTGG - Intergenic
1184295604 22:43522396-43522418 AAGTGAAGGCTGATGCAGAGTGG - Intergenic
1184755788 22:46515051-46515073 CAGCCCAGGCTGAAGCTGAGGGG - Intronic
949350273 3:3118760-3118782 TAGGGAAGGCTGATGTGGAGGGG + Intronic
949895330 3:8764110-8764132 GAGCAAATGCTGAAGCAGAGAGG + Intronic
950274465 3:11646850-11646872 TACCCAAGTGTGATCCAGAGGGG + Intronic
951727344 3:25774750-25774772 AAGCCAAGGCAGACGGAGAGGGG - Intronic
951891524 3:27572315-27572337 TCGCCCAGGCTGAAGCACAGTGG + Intergenic
952465839 3:33584774-33584796 GAGCCAGGGCTGTAGCAGAGAGG - Exonic
952809114 3:37385597-37385619 CAGCCATGGCTGAATCAGAGGGG + Intergenic
952834489 3:37591691-37591713 CAGCCAAGGCTCAAGCAGTGAGG - Intronic
952857810 3:37786551-37786573 TTGCCCAGGCTGGAGCAGAGTGG - Intronic
953043365 3:39274276-39274298 GAGCTAAGGCTGATGGGGAGAGG + Intronic
953357032 3:42264830-42264852 TACCCAACGCTGACGCAGACTGG + Exonic
955048344 3:55383067-55383089 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
955280378 3:57589226-57589248 TTGCCCAGGCTGAAGCACAGTGG - Intronic
955336690 3:58092604-58092626 TAGCCCAGGCTGGAGCACAGTGG - Intronic
955993814 3:64657374-64657396 TCTCCAAGGCTGATGCACAGTGG + Intronic
956082277 3:65570140-65570162 TTGCCAAGGCTGAAGTACAGTGG + Intronic
956105887 3:65818521-65818543 TAGCCACAGAAGATGCAGAGGGG + Intronic
956198349 3:66677036-66677058 TAGCCTAGGCTGAAGCGCAGTGG + Intergenic
957352224 3:79039760-79039782 TAGCCCAGGCTGGAGCACAGTGG - Intronic
957462660 3:80541714-80541736 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
959771111 3:110097636-110097658 TTGCCAAGGCTGATGTTGAAAGG + Intergenic
961340729 3:126215709-126215731 AAGCCAATGCTGTTTCAGAGTGG + Intergenic
961628691 3:128281029-128281051 TTGCCTAGGCTGAAGCGGAGGGG - Intronic
962123582 3:132590294-132590316 TTGCCAAGGCTGGAGTAGAGTGG + Intronic
962529790 3:136268501-136268523 TAGCCCAGGCTGGAGCACAGTGG + Intronic
964468696 3:157027780-157027802 TTGCCAAGGCTGGAGCACAGTGG - Intronic
966738412 3:183209526-183209548 TTGCCAAGGCTGCAGTAGAGTGG + Intronic
968837519 4:2976019-2976041 TTGCAAAGGTTGAAGCAGAGGGG - Intronic
970303112 4:14702425-14702447 TAGTGAAGGCTGATGGAAAGAGG - Intergenic
971314864 4:25559286-25559308 TAGCCCAGGCTGTTGTAAAGTGG - Intergenic
971461968 4:26909037-26909059 TTGCCAAGGCTGAAGCACAGTGG - Intronic
973900107 4:55460648-55460670 TAGACAAGACTGAATCAGAGTGG - Intronic
974013013 4:56624601-56624623 CAGCCAAGGCTGGAGCAGATGGG - Intergenic
974843371 4:67323279-67323301 TAGCCATGGCTGGAGCAGATGGG - Intergenic
975395347 4:73868880-73868902 TAAGAAAGGCTGAGGCAGAGAGG + Intergenic
976338103 4:83914020-83914042 TCGCCCAGGCTGGAGCAGAGTGG + Intergenic
982649267 4:158066131-158066153 TAGATGAGGCTGATGCATAGTGG - Intergenic
983891255 4:173032643-173032665 TTGCCCAGGCTGAAGCACAGTGG - Intronic
984019373 4:174466490-174466512 TAGCCCAGGCTGGAGTAGAGTGG + Intergenic
984062156 4:175002992-175003014 TAGCCATGGCTGGAGCAGATGGG - Intergenic
984623163 4:181976157-181976179 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
984679154 4:182587128-182587150 TTGCCCAGGCTGAAGCACAGTGG + Intronic
986963936 5:13247332-13247354 CAGCCAAGGCTGGAGTAGAGTGG - Intergenic
987106709 5:14646859-14646881 TACCCAAGACTGATGCTCAGAGG + Intergenic
987480548 5:18451340-18451362 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
987691505 5:21272723-21272745 TTGCCCAGGCTGATGTACAGTGG - Intergenic
988286704 5:29228131-29228153 TTGCCAAGGCTGAAGTACAGTGG + Intergenic
990264431 5:54060393-54060415 TAGCCCAGGCTGCTGCGCAGTGG - Intronic
990746866 5:58967460-58967482 TAGCCAGGGTTTTTGCAGAGTGG + Intergenic
991006412 5:61832507-61832529 TAGCCAGGTCAGATGCAGGGTGG + Intergenic
991748875 5:69777414-69777436 TTGCCCAGGCTGATGTACAGTGG + Intergenic
991800453 5:70357226-70357248 TTGCCCAGGCTGATGTACAGTGG + Intergenic
991828147 5:70652815-70652837 TTGCCCAGGCTGATGTACAGTGG - Intergenic
991892811 5:71356666-71356688 TTGCCCAGGCTGATGTACAGTGG + Intergenic
992777295 5:80099534-80099556 TGGCCCAGGCTGAAGTAGAGTGG - Intergenic
994092510 5:95821693-95821715 AAGCCAAGGATGCTGAAGAGAGG + Intronic
995158014 5:108938838-108938860 AAGCCATGACTGATGTAGAGTGG + Intronic
996547123 5:124691762-124691784 TGGCCAAGGCAGAAGCAGAGTGG + Intronic
996923978 5:128800588-128800610 TCACCCAGGCTGATTCAGAGAGG - Intronic
999751840 5:154633365-154633387 TCTCCCAGGCTGATGCACAGTGG + Intergenic
999980910 5:156957067-156957089 TCGCCTAGGCTGAAGCACAGTGG + Intronic
1000793545 5:165636020-165636042 TAGTTAAGGCTGAGGCAGGGAGG + Intergenic
1002564084 5:180100268-180100290 CAGCCAAGTCTGATACTGAGTGG + Intergenic
1005566759 6:27103694-27103716 TCGCCCAGGCTGGAGCAGAGTGG - Intergenic
1006526733 6:34612373-34612395 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1007952693 6:45886294-45886316 TAGCCAAAGGTGAAGCACAGAGG + Intergenic
1009490533 6:64284832-64284854 CAGCCATGGCTGAAGCAGAAGGG + Intronic
1010835811 6:80586499-80586521 TAGCCATGGCTGAAGCAGCTGGG - Intergenic
1011886625 6:92104539-92104561 TTGCCAAAGCTGATATAGAGAGG + Intergenic
1013549221 6:111190728-111190750 TAGCCATGGCTGGTGCAGCTAGG + Intronic
1015773041 6:136788347-136788369 TTCCCAAGGCTGATGCAGAATGG - Intronic
1016066604 6:139689436-139689458 TACCCAGGGCTTATGCAGTGGGG - Intergenic
1016303813 6:142661626-142661648 TAGCCCAGGCTGAAGTACAGTGG + Intergenic
1018421426 6:163643690-163643712 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1019697510 7:2454202-2454224 TTGCCCAGGCTGAAGCACAGTGG - Intergenic
1020744090 7:12058881-12058903 TAGCCCAGGCTGAAGTATAGTGG - Intergenic
1021551470 7:21875619-21875641 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1022711555 7:32855512-32855534 AAGCAAAGGCTGAAGCAGGGAGG - Intergenic
1024867655 7:53921924-53921946 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1025116554 7:56263308-56263330 TTGCCCAGGCTGGTGCACAGTGG - Intergenic
1026280168 7:68915114-68915136 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1028034200 7:85959269-85959291 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
1028474808 7:91241506-91241528 TTGCCCAGGCTGAAGCACAGTGG + Intergenic
1029268529 7:99361420-99361442 TAGCCCAGGCTGAAGTACAGTGG - Intronic
1029811428 7:103053190-103053212 TCGCCCAGGCTGAAGCACAGTGG + Intronic
1029820147 7:103138928-103138950 TGGCCAAGGCTGAGTTAGAGGGG - Intronic
1030072972 7:105713459-105713481 TGGCCCAGGCTACTGCAGAGAGG + Intronic
1030722666 7:112887130-112887152 TAGCCCAGGCTGGAGTAGAGTGG - Intronic
1031670940 7:124544765-124544787 TAGCCCAGGCTGGAGCACAGTGG + Intergenic
1032354825 7:131201057-131201079 TTGCCCAGGCTGATGTACAGCGG + Intronic
1032404299 7:131644558-131644580 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1032443311 7:131959052-131959074 CAGCCAATAGTGATGCAGAGTGG - Intergenic
1033262110 7:139852906-139852928 TAGCCAAGGTTGGTACACAGGGG - Intronic
1033447670 7:141436732-141436754 AAGCCAAGCCAGATGCTGAGTGG + Intronic
1034080990 7:148277546-148277568 CAGCCAAGCCTCATGTAGAGAGG - Intronic
1034836266 7:154354073-154354095 GAGCCAGGGCTGGTGCACAGAGG - Intronic
1035561742 8:609772-609794 TTGCCAGGGCTGGTGAAGAGAGG - Intergenic
1035726553 8:1827965-1827987 TAGCCAATGCTGATGCAGCCAGG - Intronic
1036190716 8:6667868-6667890 TTGCCAAGGCTGTAGCACAGTGG - Intergenic
1036516529 8:9449641-9449663 TTGCCCAGGCTGGAGCAGAGTGG + Intergenic
1037381624 8:18291465-18291487 ATGCCAAAGCTTATGCAGAGAGG + Intergenic
1037580440 8:20242582-20242604 TAACCCAGGCTGAAGCACAGTGG - Intergenic
1038230471 8:25694699-25694721 TAGCCAATGCTGATGCTGAGGGG + Intergenic
1038802888 8:30765311-30765333 TCACCAAGGCTGAAGCACAGTGG + Intronic
1039064203 8:33595153-33595175 TAGCCATGGATGCTGCAGAGGGG + Intronic
1041432712 8:57801847-57801869 TAACCAGGGCTTATGCAGGGAGG + Intergenic
1043308192 8:78823393-78823415 TAGCCATGGCTGATGCAGCTGGG - Intergenic
1043935752 8:86140374-86140396 TAGCATAGGCTGATCGAGAGAGG + Intronic
1044332842 8:90941753-90941775 TAGCCAGGTCTGAGGCACAGTGG - Intronic
1046607542 8:116388368-116388390 TAGCCATGGCTGAAGCAGTTGGG - Intergenic
1046882373 8:119323413-119323435 TTGCCAAGGCTGATGTCAAGAGG + Intergenic
1047700012 8:127439957-127439979 TTGCCAAGGCTGATGTCAAGAGG - Intergenic
1049488491 8:142878750-142878772 CGGCCAAGGTTGGTGCAGAGCGG + Intronic
1049847773 8:144811641-144811663 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1049847818 8:144811990-144812012 AAGCAAAGGCTGAGACAGAGTGG + Intergenic
1050086536 9:1972126-1972148 TAGCCATGGCTGGTGCAGCTGGG - Intergenic
1050648176 9:7744765-7744787 TTGCCCAGGCTGGAGCAGAGTGG - Intergenic
1051947394 9:22586803-22586825 TTGCCCAGGCTGGAGCAGAGTGG + Intergenic
1053669315 9:40345362-40345384 TCGCCCAGGCTGAAGCACAGTGG - Intergenic
1053792096 9:41693992-41694014 TAGCCCAGACTGGTGCACAGTGG + Intergenic
1054180503 9:61906012-61906034 TAGCCCAGACTGGTGCACAGTGG + Intergenic
1054380447 9:64485384-64485406 TCGCCCAGGCTGAAGCACAGTGG - Intergenic
1054472852 9:65551974-65551996 TAGCCCAGACTGGTGCACAGTGG - Intergenic
1054515301 9:66030928-66030950 TCGCCCAGGCTGAAGCACAGTGG + Intergenic
1054657088 9:67675130-67675152 TAGCCCAGACTGGTGCACAGTGG - Intergenic
1055101764 9:72472743-72472765 TAGCCCAGGCTGGAGCACAGTGG - Intergenic
1055106089 9:72514637-72514659 TGGCCCAGGCTGAAGCACAGTGG + Intergenic
1055969323 9:81895854-81895876 TTGCCAAGGCTGATGTCCAGAGG - Intergenic
1056590796 9:87964321-87964343 TAGCCAGGGCAGATGCTGAAGGG + Intergenic
1058383405 9:104405227-104405249 TATCCAATGCAGATGCAGAGGGG + Intergenic
1060452595 9:123756975-123756997 TAACCAAGGCAGATGGAGAGGGG + Intronic
1060910387 9:127344981-127345003 TAGACAAGGCAGGTGGAGAGAGG + Intronic
1061502194 9:131010282-131010304 TAGCCCAGGCTGTAGCACAGTGG - Intronic
1062522090 9:136962159-136962181 TCGCCCAGGCTGGAGCAGAGTGG + Intergenic
1187390965 X:18886481-18886503 GAGCCATGGCAGAGGCAGAGGGG - Intergenic
1188220412 X:27534169-27534191 TAGCCCAGGCTGAAGCACAGTGG - Intergenic
1188374593 X:29412229-29412251 TTGCCCAGGCTGAAGCACAGTGG - Intronic
1189809200 X:44765207-44765229 TAGCCCAGGCTGAAGTACAGTGG - Intergenic
1191208697 X:57861722-57861744 TTGCCAAGGCTGATGTTGAGAGG - Intergenic
1193124617 X:77858228-77858250 TTGCCTAGGCTGAAGCACAGTGG + Intronic
1194054947 X:89120196-89120218 TGGCCCAGGCTGAAGCACAGTGG - Intergenic
1197797049 X:130308953-130308975 TTGCCTAGGCTGAAGCACAGTGG - Intergenic
1198819336 X:140630086-140630108 TTGCCCAGGCTGGAGCAGAGTGG + Intergenic
1199776137 X:151013490-151013512 TAGCCAAGGCTGGAGCAGCTGGG + Intergenic
1201144933 Y:11059162-11059184 TAGCCCAGGCTGGAGCACAGTGG + Intergenic