ID: 916201511

View in Genome Browser
Species Human (GRCh38)
Location 1:162275907-162275929
Sequence AAATGAGGTAAGGCAGGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 471}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916201505_916201511 22 Left 916201505 1:162275862-162275884 CCACATGCTTTAATAGAGCGGAG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG 0: 1
1: 0
2: 2
3: 50
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916201511 Original CRISPR AAATGAGGTAAGGCAGGAGT TGG Intronic
900851189 1:5144432-5144454 AAATGAGGTGATGAAGGAGGAGG - Intergenic
901029357 1:6298012-6298034 AAATGAGGTAGGACAGGTGAGGG + Intronic
901661191 1:10798887-10798909 AAATGAGTTAATGCAGGAAAAGG + Intergenic
901759368 1:11460672-11460694 AAATGAGTTAAGGCAGGTAAAGG - Intergenic
902142120 1:14365422-14365444 AGATGAGGTCATGCTGGAGTAGG - Intergenic
903000815 1:20264327-20264349 AAATGAGGTCATGCTGGAGTAGG - Intergenic
904026694 1:27508324-27508346 CCATGAGGTGAGGCAGGGGTTGG - Intergenic
905085213 1:35368009-35368031 AAATGGACTAAGGCAGGGGTTGG + Intronic
905203775 1:36331159-36331181 GAAAGAGATAAGGCAGGAGCGGG - Intergenic
906050914 1:42870949-42870971 AAATGAGCTAAGGCAAGAATTGG + Intergenic
907572747 1:55498847-55498869 AGATGAATTATGGCAGGAGTGGG + Intergenic
907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG + Exonic
907714312 1:56913203-56913225 AAATGAGGTCATGCTGGATTAGG - Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908106747 1:60852272-60852294 AAATGAGCTATGGAAGGAGAGGG + Intergenic
908263018 1:62353382-62353404 AAAGGAGGAAAGGCAGGAAAGGG + Intergenic
908662323 1:66450216-66450238 AGATGAGGTCATGCTGGAGTAGG - Intergenic
909491955 1:76235942-76235964 AAATGAGGTCACACTGGAGTAGG - Intronic
909760176 1:79276697-79276719 AAATGAGGTCATACTGGAGTAGG + Intergenic
910146316 1:84084681-84084703 AAATGAGGAAAAGGAGGATTGGG + Intronic
910249021 1:85174633-85174655 AAGTGAGGTAAGGTGGGGGTGGG - Intronic
910455689 1:87395182-87395204 AAATCAGGAAAAGCAGCAGTGGG + Intergenic
911143453 1:94530500-94530522 AAGTGTAGAAAGGCAGGAGTGGG - Exonic
911721291 1:101194060-101194082 AAGTTTGGTCAGGCAGGAGTAGG - Intergenic
912507460 1:110165994-110166016 AAATGAGGACTGGCAGGAGTAGG + Intronic
913697599 1:121342701-121342723 CAAGAAGGTAATGCAGGAGTTGG - Intronic
914139960 1:144937351-144937373 CAAGAAGGTAATGCAGGAGTTGG + Intronic
914430568 1:147617290-147617312 AAAGGAGTTAAGGAAGGAATTGG + Intronic
914986042 1:152457887-152457909 AACTGAGGTAGGGCTGGAGGGGG + Intergenic
915149202 1:153816353-153816375 AAATGAAGTAAGGGAGCAGGAGG + Exonic
916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG + Intronic
916593357 1:166215984-166216006 AAAGGAGGGAAGGTAGGAGGGGG - Intergenic
917097324 1:171412145-171412167 AAATGAAGTAATTCAGGAATGGG + Intergenic
917550124 1:176018420-176018442 AAATTAGGTGAGGGAGGACTGGG - Intronic
917640797 1:176981454-176981476 AGATGAGGTCAGCCTGGAGTAGG + Intronic
917683755 1:177394928-177394950 AAATGAAGCAAGGCAGGGGTGGG + Intergenic
917780363 1:178388839-178388861 AACTGAGGGAAGGCAGTGGTTGG + Intronic
918002447 1:180510192-180510214 AAATGAAGTAACTCAGGAGTGGG - Intergenic
918238369 1:182601012-182601034 AGATGAGGTCAGGCATGAGGAGG - Intronic
918623719 1:186634207-186634229 AAATGAGGTCATACTGGAGTAGG - Intergenic
919160214 1:193819997-193820019 AAATGAGGTTAGAGAGGATTGGG - Intergenic
919878204 1:201885827-201885849 AAGTGGGGAAAGGCAGGAGGAGG - Intergenic
919935671 1:202248954-202248976 AGAGGAGAGAAGGCAGGAGTTGG + Intronic
919961067 1:202469295-202469317 TAATGAGCTAAGGCAGTTGTTGG + Intronic
920283054 1:204858652-204858674 AAAGCAGGGAAGGCAGGAGGGGG - Intronic
920484988 1:206361350-206361372 CAAGAAGGTAATGCAGGAGTTGG - Intronic
920632462 1:207665876-207665898 AGATGAAGTAAGGCAGTATTCGG + Intronic
921028415 1:211312829-211312851 AGAGGAGGTATTGCAGGAGTGGG + Exonic
921089435 1:211829952-211829974 AAAAGAGGAAGGACAGGAGTAGG + Intronic
921152105 1:212411033-212411055 AGATGAGGTCATACAGGAGTAGG - Intronic
921434028 1:215095975-215095997 AAATCAGGGAAGGCAAGAGTGGG + Intronic
922619981 1:226983344-226983366 GGGTGAGGTGAGGCAGGAGTAGG + Intronic
923680402 1:236113989-236114011 AGATGAGGTCATGCTGGAGTAGG - Intergenic
923748817 1:236727714-236727736 CAATGAGGTCAGGCCGGTGTCGG - Exonic
924202166 1:241671812-241671834 AAATGCTGGAAGACAGGAGTAGG - Intronic
924841190 1:247710978-247711000 TAATGAGGAAAGGGAGGAGAAGG + Intergenic
1063247900 10:4242223-4242245 AAATGAGGGATGGCAGGTGTTGG + Intergenic
1064465530 10:15576269-15576291 AAATGGTGTAATCCAGGAGTAGG + Intronic
1064697315 10:17981101-17981123 AAATGAGGTATTGCAGGCTTTGG + Intronic
1065436808 10:25711227-25711249 AGATGAGGTCATGCTGGAGTAGG - Intergenic
1065511052 10:26478743-26478765 AAATGAGGTCAGGAAGGATGAGG + Intronic
1065792201 10:29270883-29270905 CAAGGTGGTAAGGCAGGAGGAGG + Intergenic
1065920942 10:30392443-30392465 AAATGAGACAGGACAGGAGTGGG + Intergenic
1066065109 10:31756227-31756249 GAGTGAGGTCAGGCAGGTGTGGG + Intergenic
1067737855 10:48872455-48872477 AAATGAGATAAAGCAGGTGCAGG + Intronic
1068006507 10:51397767-51397789 AAACAAGGAAAGGCAGGAGCAGG - Intronic
1068022388 10:51601572-51601594 AAATGAGAAAAGGCAGGAAAGGG - Intronic
1068200550 10:53778600-53778622 ATATGAGGTAAAGCTAGAGTGGG - Intergenic
1069885702 10:71622312-71622334 TAATGAGGTGAGGCAGGGGAGGG - Intronic
1070421583 10:76242655-76242677 AGATGAGGTCATGCTGGAGTAGG - Intronic
1070542012 10:77422661-77422683 AAATGAGGTCATACTGGAGTAGG + Intronic
1070872592 10:79770058-79770080 AAATGAGGTCATACTGGAGTAGG - Intergenic
1071541835 10:86492366-86492388 AAATGAGGTAAGACAATAATGGG + Intronic
1071639514 10:87292207-87292229 AAATGAGGTCATACTGGAGTAGG - Intergenic
1071655721 10:87445745-87445767 AAATGAGGTCATACTGGAGTAGG + Intergenic
1071732123 10:88258689-88258711 GGATGAGATAAGGCAGTAGTTGG + Intergenic
1071974353 10:90940033-90940055 AAATGAGGTGGGGCTGGAGTTGG + Intergenic
1072303509 10:94085180-94085202 ACATGAGGACAGGCAGGATTTGG + Intronic
1072451260 10:95541389-95541411 AAATAAGGCAAGGGAGGAGCTGG - Intronic
1073422390 10:103434741-103434763 AAATGAGCTAAGGGAGGAGCGGG - Intronic
1076934352 10:133557454-133557476 AAATGAGCTAAATCAGGAGGTGG + Intronic
1077011920 11:382657-382679 AGAGGAGACAAGGCAGGAGTGGG - Intergenic
1078654315 11:13224037-13224059 AAATGGGGTTAGGAAGCAGTAGG + Intergenic
1079414469 11:20220734-20220756 AGATGAGGTAATCCAGGAGAAGG + Intergenic
1079888072 11:26014659-26014681 AAATGTTGTAAAGCAGGAATTGG - Intergenic
1080737689 11:35033025-35033047 AAATTAGGGAATGGAGGAGTGGG + Intergenic
1081545284 11:44067146-44067168 AACTGAGGGAAGGGAGGAATGGG - Intronic
1082192483 11:49263834-49263856 AAAAGAGCTCAGGCAGCAGTGGG - Intergenic
1083064990 11:59915185-59915207 AGATGAGGTCATGCAGGAGTAGG - Intergenic
1083884276 11:65564001-65564023 AAATGAGGAAAGCCAGGTGCAGG - Intergenic
1085308757 11:75503616-75503638 AAATGAGCGAAGGAAGGAATAGG + Intronic
1086132796 11:83419253-83419275 ACATCAGTTAAGGCAGGAGCAGG - Intergenic
1086219972 11:84430635-84430657 AAGTGAAGGAAGGCAGGAGTAGG - Intronic
1086363988 11:86089375-86089397 AAATGAGGTGTGGGAGGTGTGGG - Intergenic
1086555257 11:88102898-88102920 TAATGAGGGAAGGGAGGAGACGG - Intergenic
1087769722 11:102195188-102195210 AAATGAGGTGAGGCAGAAAAGGG - Intronic
1089008346 11:115112218-115112240 AATTGGGTTATGGCAGGAGTGGG - Intergenic
1089134530 11:116238608-116238630 AAATGTGCCAATGCAGGAGTGGG - Intergenic
1089156444 11:116406539-116406561 AACTGAGGGTAGCCAGGAGTGGG - Intergenic
1089335935 11:117724120-117724142 AGATGAGGTGAGACAGGAGGGGG - Intronic
1089591224 11:119541940-119541962 CAATGAGGTAAGGAGGGAATGGG + Intergenic
1091011800 11:132008085-132008107 AAATGAAGCAAGGCAAGAGGGGG + Intronic
1092127727 12:6086631-6086653 GAAGGAGGGAAGGCAGAAGTGGG + Intronic
1092195108 12:6544682-6544704 GAATCAGGTCAGGCAGGAGGAGG + Intronic
1092199915 12:6574836-6574858 AAATCCAGTAAGTCAGGAGTTGG + Intronic
1093600457 12:21015180-21015202 AAATGAAGTAACTCAGGAATGGG + Intergenic
1095702840 12:45208254-45208276 AAATAAGGTAAAGCATGAGACGG - Intergenic
1096164548 12:49410522-49410544 AAATGAGGTCAGGTAGAAGTTGG - Intronic
1097195514 12:57240522-57240544 AAATGGGGAAAGGAAGGAGTGGG + Intronic
1097416124 12:59318623-59318645 AAATGAGGAAAGACAAGAGATGG - Intergenic
1097803701 12:63942736-63942758 AACGGATGGAAGGCAGGAGTAGG - Intronic
1099584553 12:84501441-84501463 AAATGAGGTCATTCTGGAGTAGG + Intergenic
1099825587 12:87773264-87773286 AAATGAGGACAGGCAGTATTTGG + Intergenic
1100020776 12:90067390-90067412 AAATGAGATTAGGCAAGAATAGG + Intergenic
1100022042 12:90080996-90081018 AAAAGAGGGAGGGAAGGAGTAGG + Intergenic
1100201549 12:92304176-92304198 AAATGAGGTTTGCCTGGAGTTGG - Intergenic
1101442110 12:104711558-104711580 AAGTGGGGGATGGCAGGAGTGGG + Intronic
1101561823 12:105864145-105864167 CAAAGAGGTAAGGAAGGAGGGGG + Intergenic
1102753897 12:115321128-115321150 ATATGAGGAAAGGAAGGAGGGGG - Intergenic
1102894998 12:116591852-116591874 GAATGAGTAAAGCCAGGAGTAGG - Intergenic
1103341091 12:120221552-120221574 CACTGAGGTAAGGGAGGAGAAGG + Intronic
1103413697 12:120730315-120730337 AAAGGAGGGAAGACAGGAGCTGG + Intronic
1103791653 12:123476492-123476514 AGATGAGGTTATGCTGGAGTAGG + Intronic
1103885447 12:124196913-124196935 CAATTAGGAAAGTCAGGAGTTGG - Intronic
1104162223 12:126191601-126191623 GACAAAGGTAAGGCAGGAGTGGG + Intergenic
1104353591 12:128066192-128066214 ATATGAGGTCATGCAGGATTAGG + Intergenic
1104382045 12:128315717-128315739 AGATGAGGTCATGCTGGAGTAGG + Intronic
1105271629 13:18881620-18881642 TAATGAAGTAAGGCAGGTGCAGG + Intergenic
1105699935 13:22927877-22927899 AAAGGCGGTGGGGCAGGAGTGGG + Intergenic
1105715557 13:23059272-23059294 CCAGGAGGTAAGGAAGGAGTGGG + Intergenic
1105852742 13:24350061-24350083 AAAGGCGGTGGGGCAGGAGTGGG + Intergenic
1106437867 13:29739823-29739845 AAATGAGGTGATGCTGGAATAGG + Intergenic
1106593684 13:31119486-31119508 ATATGTGGCAAGGCAGGAATAGG + Intergenic
1107034406 13:35885226-35885248 AAATGAGGTAAGACAAGACTTGG + Intronic
1108526757 13:51292104-51292126 AAAAGAGGTAAGGGAGGAAGAGG - Intergenic
1110182560 13:72635123-72635145 AAATGGGCTTAGGTAGGAGTAGG - Intergenic
1111623207 13:90750352-90750374 GAAAGAGGAAAAGCAGGAGTGGG - Intergenic
1111727965 13:92036956-92036978 CAAAAAGGTAAGGAAGGAGTAGG - Intronic
1111791287 13:92858652-92858674 AAAAGAGGGAGGGCAGGAGGAGG + Intronic
1112960467 13:105119699-105119721 AAATGAGGTCATGCAGGAGCAGG + Intergenic
1113652201 13:112041971-112041993 AAATGAGGTCATGCTGGAGTAGG + Intergenic
1113774570 13:112935768-112935790 AGATGAAGTCATGCAGGAGTGGG + Intronic
1115332887 14:32216753-32216775 AAATAGATTAAGGCAGGAGTTGG - Intergenic
1116266199 14:42693721-42693743 TAATGTGGAAAGGAAGGAGTTGG + Intergenic
1117071228 14:52058520-52058542 AAATGAGGGAAGGCATGAAAGGG + Intronic
1117477240 14:56108585-56108607 AAATGAGGTAATGCATGTGATGG - Intergenic
1117664849 14:58045744-58045766 AAATGAGGTCATACTGGAGTAGG + Intronic
1118171821 14:63395844-63395866 AAAGGAGGGAAGAGAGGAGTCGG + Intronic
1118482672 14:66182609-66182631 AAATGAGTAAAGGCAAGAGTGGG + Intergenic
1119174533 14:72559573-72559595 AAATGCGCGAAAGCAGGAGTGGG + Intronic
1119642440 14:76325349-76325371 AAATTAGTTAGGGCAGGAGTGGG + Intronic
1120582518 14:86270589-86270611 CAATCAGTTAAGGCAGGAGCTGG - Intergenic
1121495091 14:94386578-94386600 AACTGACGTAATGCATGAGTGGG + Intronic
1122152687 14:99733260-99733282 AAATCTGGTCGGGCAGGAGTTGG - Intergenic
1123754504 15:23386384-23386406 AAATGTGGTATGGGAGGGGTTGG + Intergenic
1123922426 15:25079819-25079841 AAATCAGGTAAAGCCAGAGTTGG + Intergenic
1124069132 15:26375217-26375239 AAATGAGGTAACGCATGTCTGGG - Intergenic
1124659035 15:31530255-31530277 GAACGAGGTAAAGCTGGAGTAGG - Intronic
1124826427 15:33100499-33100521 AAAGGAGGAAAGGGAGGAGGAGG + Intronic
1125833511 15:42732094-42732116 AAATCAGGGAAGGCAGCAGCAGG + Intronic
1126099326 15:45110412-45110434 ACATGAGGTGAGGGAGGGGTTGG - Exonic
1126102409 15:45127794-45127816 TGATGAGGTAGGGGAGGAGTGGG - Intronic
1126179068 15:45767324-45767346 AATTGATGTAAACCAGGAGTTGG - Intergenic
1126336177 15:47588448-47588470 AAAAGAGGAAAGGCAGGAGCGGG - Intronic
1126419579 15:48457238-48457260 AAAGGAGGTAAGTCAGGTGTGGG + Intronic
1127418033 15:58776319-58776341 GAATGAGGTAGGGGAGGAGAGGG - Intronic
1128596935 15:68960872-68960894 AAATGAAGTAACTCAGGAATGGG - Intronic
1128764148 15:70240832-70240854 GATGGAGGTGAGGCAGGAGTGGG + Intergenic
1129144006 15:73632163-73632185 AAATTAGGGAAGGGAGGAGTTGG - Intronic
1129208850 15:74053925-74053947 AAATGAGACAGGACAGGAGTGGG + Intergenic
1129222170 15:74137328-74137350 AAATGATGTAAAGCAGGAAAGGG + Intronic
1129315537 15:74740999-74741021 AAATGAGGTGAGAGAAGAGTAGG + Intergenic
1129735501 15:77959357-77959379 AAATGAGACAGGACAGGAGTGGG + Intergenic
1129836367 15:78709795-78709817 AAATGAGACAGGACAGGAGTGGG - Intronic
1129952196 15:79601689-79601711 AAATGAAGTCATGCAGGAGTAGG - Intergenic
1130510819 15:84587906-84587928 AAATGAGACAGGACAGGAGTGGG + Intergenic
1130750024 15:86701785-86701807 AAAGGAGGGAAGGAAGGAGTGGG - Intronic
1131501838 15:92975216-92975238 AAGAGCAGTAAGGCAGGAGTAGG + Intronic
1132248609 15:100316801-100316823 AGATGAGGAAAGGTAGGAATAGG + Intronic
1132269047 15:100506753-100506775 CAGTGAGGTAAAGCAGAAGTGGG + Intronic
1132339549 15:101069261-101069283 ACTTGAGGTAGGGCAGGAGGGGG + Exonic
1133203990 16:4221956-4221978 AGATGAGGTCATGCTGGAGTGGG - Intronic
1133526936 16:6614819-6614841 AGATGAGGTAACCCTGGAGTAGG - Intronic
1133859001 16:9576456-9576478 AAATGAGATCAGGCTGGAGAGGG + Intergenic
1134461865 16:14436603-14436625 AAATGTGGTATGGGAGGGGTTGG - Exonic
1135062615 16:19283755-19283777 AGCTCAGGTATGGCAGGAGTGGG + Intergenic
1135066591 16:19315048-19315070 AAAAGAGGGAAGGGAGGAGGGGG + Intronic
1135066613 16:19315105-19315127 AAAGGAGGGAAGGGAGGAGGGGG + Intronic
1135214052 16:20549013-20549035 AAATGAGGTAACACAGGACATGG - Intronic
1135249240 16:20886806-20886828 AGATGAGCTAAAGCAGGAGTTGG - Intronic
1135392793 16:22107743-22107765 TAATTAGGTAAGCCTGGAGTGGG + Intronic
1135870813 16:26148484-26148506 AAGTGAAGTAAGGCAGCTGTTGG - Intergenic
1136246012 16:28976282-28976304 AAATAAGTAAAGGCAGGAGAGGG + Intronic
1138409620 16:56828406-56828428 TACTGAGGTTAGGCAGGAGAAGG + Intronic
1138779594 16:59767006-59767028 AAATGACATAAAGCAAGAGTAGG - Intergenic
1140906165 16:79411094-79411116 AAATGGGACAAGGGAGGAGTTGG - Intergenic
1141036053 16:80626870-80626892 AAATCTGGTAAGGTAGGAGATGG + Intronic
1141139230 16:81486615-81486637 ACAGGAGGTGAGGCTGGAGTGGG + Intronic
1141283807 16:82652920-82652942 GAATGAGCTAATGAAGGAGTGGG - Intronic
1141440638 16:84027581-84027603 AAAGGGGGTAAGGCTGGAGAGGG - Intronic
1142425247 16:89999152-89999174 GAGTGAGGCACGGCAGGAGTAGG - Intergenic
1143178183 17:4968423-4968445 AAATAAGGCAAGTCAGGAGGGGG + Exonic
1143924874 17:10360762-10360784 AGATGAGGTCATGCTGGAGTAGG + Intronic
1144126328 17:12206174-12206196 AAAAGAGGTAAGAAAGAAGTAGG - Intergenic
1144430964 17:15191437-15191459 AGATGAGGGAAGGCAGAAGGGGG + Intergenic
1144507953 17:15849358-15849380 AAATGAGGCAAGGCAGGAACTGG - Intergenic
1144740709 17:17580734-17580756 GAATGAGGCAAGGGAGGGGTAGG - Intronic
1144850776 17:18242816-18242838 AAATGAGGTGCTGCAGGGGTGGG + Exonic
1144874025 17:18387663-18387685 TCATGAGGTCAGGCAGGGGTGGG - Intronic
1145172077 17:20666990-20667012 AAATGAGGCAAGGCAGGAACTGG - Intergenic
1145188253 17:20814803-20814825 CAGTGAGGAAAGGCAGGAGGAGG + Intergenic
1146744772 17:35318610-35318632 ATATGAGGTAGAGTAGGAGTAGG - Intergenic
1148037560 17:44679089-44679111 GAATGAGGAAAGGCAGCAGTAGG - Intronic
1149051132 17:52306666-52306688 AAATCAGGTAAGGCATGGGCAGG + Intergenic
1150078662 17:62216865-62216887 CAGCGAGGAAAGGCAGGAGTAGG - Intergenic
1151131307 17:71899593-71899615 AAATGCGGGAAGACAGGAGAAGG + Intergenic
1151348428 17:73517349-73517371 AGATGAGGTCACGCTGGAGTAGG + Intronic
1152432352 17:80256012-80256034 AAATGAGGCCATGCTGGAGTAGG + Intergenic
1152464597 17:80458687-80458709 AGATGAGGTCAGGCTGGATTGGG - Intergenic
1153098387 18:1435838-1435860 AAGTGTGGTAAGGCAGGTGTGGG - Intergenic
1153507575 18:5817354-5817376 AAATGAGGTTATACTGGAGTAGG - Intergenic
1153873361 18:9341625-9341647 AAGTGTGGCAGGGCAGGAGTGGG - Intronic
1154003803 18:10508398-10508420 AAATCTGGGAAGGAAGGAGTTGG - Intergenic
1154263025 18:12854511-12854533 AAAGGAGAAAAGGCAGGTGTGGG + Intronic
1154360704 18:13658079-13658101 AAAGGAGGAAGGGCAGGAGAGGG - Intergenic
1155001250 18:21689197-21689219 ACCTGAGGGAAGGCAGTAGTTGG + Intronic
1155799496 18:30082486-30082508 AATTAAGGTAAGGAAGGAGAAGG - Intergenic
1156826012 18:41430787-41430809 AAAGGAGGTAAGCCAGTAGCAGG - Intergenic
1157053205 18:44194801-44194823 AATTGATGTAAGACAGGAATTGG - Intergenic
1157118099 18:44881325-44881347 CAATGACCTAAGGCAGGGGTGGG + Intronic
1157382941 18:47236338-47236360 AAATGACATAAGGCAGTTGTAGG - Intronic
1158881500 18:61783478-61783500 AGATGAGGTTATGCTGGAGTAGG + Intergenic
1160050612 18:75429925-75429947 AAATGAGGGAAGGGAGGAAAAGG - Intergenic
1160216259 18:76934781-76934803 AAATGTGGGAAGACAGGAGGTGG - Intronic
1160861022 19:1237307-1237329 AAATGAGTTCAGGCTGGAGGGGG + Intronic
1161077894 19:2295178-2295200 AGATGAGGTCACGCAGGAGCAGG + Intronic
1161327376 19:3670315-3670337 AGATGAGGTCATGCCGGAGTGGG + Intronic
1161430019 19:4226064-4226086 AACAGAGGGGAGGCAGGAGTGGG + Intergenic
1162608011 19:11726537-11726559 AAATGGGGTATCTCAGGAGTAGG + Intronic
1163190693 19:15674714-15674736 GAATGAGGAAAGGAATGAGTCGG - Intronic
1163209298 19:15828857-15828879 TAATTAGTTAAGGCAGGAATTGG - Intergenic
1163672171 19:18636002-18636024 GAAGGAGGTAAGACTGGAGTCGG + Intergenic
1163710647 19:18844792-18844814 AAATGAGGTAAAACAGCAGTAGG - Intronic
1164393575 19:27845585-27845607 GAAAGAGGTAAGGCAGGAGCGGG + Intergenic
1164752453 19:30666638-30666660 ACATGGGGTAAGGCGGGAGCTGG + Intronic
1165921169 19:39298545-39298567 AAATAAATTAAGGAAGGAGTAGG - Exonic
1166132012 19:40751274-40751296 AAGTCAGGTAAGGCGGGAGTAGG - Exonic
1166616222 19:44249814-44249836 AAATGAGCTAATGCTGGAGCTGG - Intronic
1166811390 19:45516490-45516512 AACTGAGGTCAGGCAGGGGCTGG + Intronic
1166960970 19:46495589-46495611 GAATGTGGCAAGGCTGGAGTGGG + Exonic
1168228744 19:55015172-55015194 GAATGAGGAGAGGCAGGAGCAGG + Intronic
1168467212 19:56612850-56612872 AAATGAGGTCATCCTGGAGTGGG - Intronic
1168694872 19:58398384-58398406 GAGTGAGGTGAGGCAGGATTGGG - Intergenic
925592074 2:5519839-5519861 AAATAAGGTCATACAGGAGTAGG - Intergenic
926179580 2:10629746-10629768 AAATGAGTTAAGACATGATTTGG - Intronic
927830462 2:26345863-26345885 AGCTGAGGTAAGGCAAGAGAGGG - Intronic
928159075 2:28905125-28905147 AAATGAGGGGAGACAGGAATGGG + Intronic
928660938 2:33501073-33501095 CACTGAGGGAAGGCAGGAATGGG - Intronic
929319900 2:40530231-40530253 AAATGAAGGAAGGGAGGAGTAGG + Intronic
930262776 2:49166648-49166670 AAAGGAGGTGAGGCATGAGGAGG + Intergenic
931847845 2:66222774-66222796 CAATGAGGTGAGGCAGGCGGTGG + Intergenic
931895251 2:66721409-66721431 AAATGAGGTATGCCTGGACTGGG - Intergenic
932234084 2:70107308-70107330 AAATGAGCAAAGGAAGGATTTGG + Intergenic
932505774 2:72230017-72230039 AAATGAGGTGAGTAAGGAGGGGG + Intronic
932938131 2:76130407-76130429 ACCTGAGGTCAGTCAGGAGTTGG - Intergenic
933387052 2:81624310-81624332 AAATGAGGTAGGCTAGTAGTTGG + Intergenic
933566369 2:83955339-83955361 AAATGAGTTAAGAAAGGATTGGG + Intergenic
933971044 2:87469865-87469887 AAATGAGGTCATGCTGGAGTCGG + Intergenic
935889372 2:107659232-107659254 AGATGAGGGAAGGCAAGACTGGG + Intergenic
936157615 2:110058723-110058745 AAATTAGGTAAGCCTGGGGTGGG - Intergenic
936187077 2:110312721-110312743 AAATTAGGTAAGCCTGGGGTGGG + Intergenic
936322685 2:111480324-111480346 AAATGAGGTCATGCTGGAGTCGG - Intergenic
936573295 2:113634098-113634120 AGGGGAGGTAAGGAAGGAGTGGG - Intronic
936607956 2:113976524-113976546 AAGGGAGATGAGGCAGGAGTGGG - Intergenic
936617351 2:114061573-114061595 AAGTGGGGTAAGGCAGGATGGGG + Intergenic
937182171 2:120006641-120006663 GAATGGGGGAAGGCAGGGGTTGG - Intergenic
939504622 2:143030334-143030356 AAATGAGGTCATGCAGGAAAAGG - Intronic
940013580 2:149080328-149080350 AAATGAGGTCATACTGGAGTAGG - Intronic
940277378 2:151953395-151953417 AAAACAGGGAAGGGAGGAGTTGG - Intronic
940614953 2:156038432-156038454 AACTCAGGCAAGGCAGGAGTTGG + Intergenic
940784124 2:157963987-157964009 AAGTGAGGTAACTCAGGAGTGGG - Intronic
941612693 2:167681089-167681111 AAATGAGGTTAGGAAGGGGATGG + Intergenic
942738321 2:179141991-179142013 AAAGGAAGGAAGGAAGGAGTTGG - Intronic
944031999 2:195245731-195245753 AAATGAAGTAACTCAGGAATGGG + Intergenic
944643755 2:201756497-201756519 AAATCATGTAAACCAGGAGTTGG + Intronic
945186562 2:207145865-207145887 GAATGAGGAAAGGAAGGAGAAGG + Intronic
945893534 2:215456774-215456796 AAAGGAGGTGAGGCTTGAGTTGG + Intergenic
946371517 2:219284397-219284419 AGATGAGGAAAGGGAGGGGTAGG + Intronic
946500192 2:220238931-220238953 AACTGAGGTAAGGAAGGAAATGG - Intergenic
1168980060 20:1996427-1996449 AAATGAGGAAAGAGAGCAGTTGG - Intergenic
1169286945 20:4316911-4316933 AAATTAGTTATTGCAGGAGTGGG - Intergenic
1169432520 20:5551162-5551184 ATAGGAGGTATAGCAGGAGTGGG - Intronic
1170052181 20:12158104-12158126 AAATGAGGAAATGCAAGAGAAGG - Intergenic
1171445147 20:25197394-25197416 GACTGAGGGAAGGCAGGGGTAGG - Intronic
1173058805 20:39642399-39642421 AAATGTTTTAATGCAGGAGTAGG - Intergenic
1175319035 20:58072574-58072596 AAATGAGGTCATACAGGATTAGG + Intergenic
1175491926 20:59385173-59385195 AAAGGAGGTAAGGGAGGGGAAGG + Intergenic
1177062188 21:16389710-16389732 AAATTAGTCAAGGCAGGAATTGG - Intergenic
1177351465 21:19947232-19947254 AAATTAGGTCATACAGGAGTAGG - Intergenic
1178237715 21:30862131-30862153 AGATGAAGTTAAGCAGGAGTAGG + Intergenic
1178577649 21:33808866-33808888 AGGTGATGTCAGGCAGGAGTGGG - Intronic
1178597748 21:33970070-33970092 TTAGGAGGTTAGGCAGGAGTAGG + Intergenic
1180864054 22:19105743-19105765 AAGTGAGGAAAGGCAGGACCTGG + Intronic
1180933677 22:19610398-19610420 ACATGAGGAGGGGCAGGAGTTGG - Intergenic
1182118435 22:27771773-27771795 GAATGAGTTAACGCAGGAGTTGG - Intronic
1182574782 22:31265919-31265941 AGATGAGGAAAGACGGGAGTAGG - Intronic
1182756598 22:32684934-32684956 AAATGAGATAAAGTAGGAATTGG + Intronic
1182778229 22:32846915-32846937 ATTTGGGGTAAGGAAGGAGTTGG + Intronic
1184081867 22:42227369-42227391 AAATGAGGTAAAGCATCAGTTGG - Intronic
1184858384 22:47158845-47158867 AAAGGAGGCAAGGCAGGCGCAGG + Intronic
1184879076 22:47293696-47293718 AAATGAGGTCACACTGGAGTAGG - Intergenic
1185118106 22:48949398-48949420 AAAAGAGGTGAGGCTGGAGGAGG - Intergenic
1185426889 22:50776782-50776804 AGGGGAGGTAAGGAAGGAGTGGG + Intronic
949474508 3:4430840-4430862 AAGTAAGGCAGGGCAGGAGTGGG + Intronic
949593741 3:5521836-5521858 AAGTGAGGTAAGGCAGTAGTTGG + Intergenic
950230798 3:11274086-11274108 ACATGAGGGCAGGAAGGAGTTGG - Intronic
950793649 3:15493533-15493555 AAAAGAGGTGAGGCAAGACTGGG - Intronic
950863385 3:16170036-16170058 GACTGAGGGAAGGGAGGAGTTGG + Intergenic
953393651 3:42549263-42549285 AAGTGAGGACAGGCAGGGGTGGG - Intronic
953447124 3:42978187-42978209 AAATTAGGAAAGTCAGGATTAGG - Intronic
954833460 3:53443687-53443709 AAATCAGTTAATCCAGGAGTTGG - Intergenic
955884475 3:63583232-63583254 CAATCAGTTAAGGCAGGAGATGG + Intronic
956620635 3:71218165-71218187 AAATGAGGAAAGGGAAGAGGTGG - Intronic
957337358 3:78848651-78848673 AAATGAGGTCAGAAAGGATTAGG + Intronic
958646616 3:96882620-96882642 AAGTGAAGTAATGCAGGAATGGG - Intronic
958989765 3:100829243-100829265 TAAGGATCTAAGGCAGGAGTTGG - Intronic
959887538 3:111519974-111519996 AAGAGAGGTAAGGAAGGAGGAGG - Intronic
961070359 3:123918707-123918729 AAATGGGGTAATACAGAAGTGGG - Intronic
961193714 3:124983896-124983918 AAACGGGGTAAGGCAGGGATTGG - Intronic
962141457 3:132794941-132794963 AAATTAGTAAAGGCAGGAGAAGG - Intergenic
962987217 3:140546675-140546697 AATAAAGGTAAGGCAGGAGCTGG + Exonic
964428987 3:156584031-156584053 AAAACAGAGAAGGCAGGAGTAGG - Intergenic
964819371 3:160754583-160754605 AAATGTGGGCAGGCAGGTGTTGG - Intergenic
965080393 3:164024807-164024829 AAAGGAGGGAGGGCAGGAGCAGG + Intergenic
966719177 3:183044559-183044581 AAATGAGCTAAGGCAGAGTTGGG - Intronic
967291365 3:187924039-187924061 AAATGAAGTAACTCAGGAATGGG + Intergenic
967328206 3:188263597-188263619 AAATGAGGAAAGTGAGGAGCAGG - Intronic
967930093 3:194684851-194684873 AAAAGACGTATGGCTGGAGTGGG - Intergenic
968281522 3:197480510-197480532 AGATGAGGTAATGCTGGAGCAGG - Intergenic
969145696 4:5122293-5122315 TAATGAGGTAATGCATGAATGGG - Intronic
969297159 4:6276963-6276985 AAATGAGATCAGCCTGGAGTAGG - Intronic
969343037 4:6554178-6554200 AAATGAGGCCATGCTGGAGTAGG + Intronic
969538925 4:7773805-7773827 AGAGGAGGGAAGGCAGGTGTTGG - Intronic
969607345 4:8209173-8209195 GGATGAGGTAATGCAGGCGTAGG - Intronic
970236568 4:13964750-13964772 AAATGAGGTAATGCATGACAAGG - Intergenic
970846220 4:20541175-20541197 AAATAAGGTAAGGTAGAATTTGG - Intronic
971029821 4:22623845-22623867 AAATGAGGAAAGACAGGCTTGGG + Intergenic
971241398 4:24892203-24892225 AGAAGTGGTAGGGCAGGAGTTGG - Intronic
971264449 4:25085648-25085670 AATTGAGGAGAGGCAGGGGTGGG + Intergenic
971554318 4:27993945-27993967 AATTAAGGTCAGGCAGGAATGGG + Intergenic
973549852 4:52022807-52022829 AACTGAGGTAACTCAGAAGTAGG + Exonic
975742158 4:77439883-77439905 AAATGTGGTCAGGCCTGAGTAGG + Intergenic
976592252 4:86860618-86860640 AAATTAGCTAAGGCAGTTGTGGG + Intergenic
977384968 4:96327195-96327217 AAAATAGGTAATGCAGAAGTTGG + Intergenic
977512470 4:97978825-97978847 AAAAGATGTAAAGCAGGATTTGG + Intronic
978003429 4:103585562-103585584 AAATGAGCTAAAGCATAAGTAGG - Intergenic
978764633 4:112391540-112391562 AAATGAGGTCATACTGGAGTAGG + Intronic
978925673 4:114240092-114240114 AAAGGAGGTAAGGTGGGAGAAGG - Intergenic
979305528 4:119138683-119138705 AAAGGAGAGAAGGCAGGAGAAGG - Intronic
980113874 4:128660586-128660608 ACATGGGGAAAGGCAGCAGTTGG + Intergenic
980874090 4:138643219-138643241 ACATGGAGTAAGGCAGGAGGAGG + Intergenic
981219539 4:142215244-142215266 ATATGAGGTAAGGGAACAGTGGG - Intronic
981358882 4:143824580-143824602 AAATGAGATTATACAGGAGTAGG - Intergenic
981369665 4:143945463-143945485 AAATGAGATTATACAGGAGTAGG - Intergenic
981379403 4:144055405-144055427 AAATGAGATTATACAGGAGTAGG - Intergenic
981543092 4:145866052-145866074 AAATGAGGTGAGGAAGGGGGTGG + Intronic
981544957 4:145884223-145884245 AAATGAGGAAAGGTAGGGGATGG - Intronic
982213715 4:153062510-153062532 AGATGAGGTCATGCTGGAGTGGG + Intergenic
982452770 4:155572529-155572551 AAATGAAGTAATGCTGGAGTGGG + Intergenic
982501193 4:156157821-156157843 AAATGAGGTCAGCAAGGTGTTGG + Intergenic
984519914 4:180788910-180788932 AAATGAGGATATGCAGGAGTTGG + Intergenic
984896383 4:184544965-184544987 AAATGAGGTCATACTGGAGTGGG + Intergenic
985040804 4:185889830-185889852 GAATGAAGGAAGGCAGGAGGTGG - Intronic
985380763 4:189392293-189392315 TAATCAGGTAAGGCAGGAACTGG + Intergenic
986096306 5:4557276-4557298 AAATGTGTTAAGACAGAAGTGGG - Intergenic
986171922 5:5321258-5321280 AAGTGAGGAAAGGCAGTATTTGG + Intergenic
986651330 5:9966153-9966175 AAATTAGGTAATACTGGAGTAGG - Intergenic
987144467 5:14978953-14978975 TGATGAGTTAAGGCTGGAGTTGG - Intergenic
987483731 5:18495154-18495176 AAATGTGTTAAGGAAGAAGTAGG + Intergenic
987846210 5:23290529-23290551 AAGCGAGGTAATGCAGGAATGGG - Intergenic
988862716 5:35301427-35301449 AAACAAGGCAAGGAAGGAGTGGG - Intergenic
990009722 5:50982275-50982297 AGATGAGGTCATGCTGGAGTAGG + Intergenic
990320045 5:54620915-54620937 AAATGAGGTAAAAGAGGAGTGGG - Intergenic
990338684 5:54801216-54801238 ATATGCGGTAAGGGAGGAATGGG - Intergenic
990909579 5:60840267-60840289 AAATGAGGTCATACTGGAGTGGG + Intronic
991350539 5:65716264-65716286 AAATGAGAAAGGGGAGGAGTAGG + Intronic
992137389 5:73761119-73761141 AGAGGAGGTAAGCCAGGAATGGG - Intronic
992150566 5:73898359-73898381 AAATGAGGCAGGGTAGGGGTTGG - Intronic
993803191 5:92370942-92370964 AAATAAGTTAATGCAGCAGTAGG + Intergenic
994904472 5:105819953-105819975 AAGAGAGGTAAGAGAGGAGTAGG - Intergenic
994904883 5:105826838-105826860 AAGTGAGCTAAAGCAGGGGTTGG - Intergenic
995785224 5:115820477-115820499 TAATGATGCAAGGAAGGAGTAGG - Intergenic
998649674 5:144103984-144104006 AAATGAAGTGAGGCAAGACTTGG - Intergenic
998652008 5:144131245-144131267 AAAGGAGCTAAGGCAGGGGGTGG + Intergenic
999499597 5:152133393-152133415 AAATGAAATAAGACAGAAGTTGG - Intergenic
1000098280 5:157990146-157990168 AAATGAGGAAAGGAAGGGCTGGG + Intergenic
1000111066 5:158108402-158108424 AAAGCAGGGAAGGCAGGATTTGG + Intergenic
1000244033 5:159434141-159434163 AGATGAGGTCATGCTGGAGTAGG + Intergenic
1000464782 5:161562359-161562381 AAAGGAGGTATGGCTGGACTTGG - Intronic
1001681388 5:173559763-173559785 AAATGAGGTCATGCAGTTGTAGG + Intergenic
1001844518 5:174910198-174910220 AAATGAGACAGGACAGGAGTGGG + Intergenic
1002669513 5:180855386-180855408 AAATGAGGCATGAGAGGAGTGGG - Intronic
1002823899 6:755306-755328 AAAGGAGGTAAAGAAGGAGGAGG - Intergenic
1004831248 6:19478621-19478643 GAGTGGGGGAAGGCAGGAGTGGG - Intergenic
1004969479 6:20893023-20893045 ACCTGAGGTAAGGCAGGTGCAGG - Intronic
1005392218 6:25345163-25345185 AAATGAAGTAAGAAGGGAGTGGG - Intronic
1010079012 6:71835478-71835500 AAATGATATAAGGCAGAATTTGG - Intergenic
1011113592 6:83865630-83865652 AAATGAGGTCATACTGGAGTAGG - Intronic
1011278919 6:85657306-85657328 AAATGAGGTGATGCTGGAGTAGG - Intergenic
1011667829 6:89652242-89652264 CAATGAGCTAAGACAGGAGCTGG - Exonic
1012668814 6:102014388-102014410 AGATCAGTGAAGGCAGGAGTGGG - Intronic
1013597692 6:111674750-111674772 AAAGGAGGTGAAGCAGGAATGGG + Intronic
1013821457 6:114157966-114157988 TAATCAGGTTAGGGAGGAGTGGG - Intronic
1014866770 6:126541777-126541799 AAAGGAGTTAAGGCCAGAGTGGG + Intergenic
1015464750 6:133536302-133536324 AATTGGGGTAATGCAGGAGATGG - Intergenic
1015502148 6:133945547-133945569 AAATGAGGAAAGGCAGTCCTGGG + Intergenic
1015503829 6:133961068-133961090 AAGTGAAGTAAGGGAAGAGTTGG + Intronic
1015709193 6:136121003-136121025 AAATGAGTTCAGGAAGGAGAGGG - Intronic
1016307904 6:142702684-142702706 AAATGAGGAAGCGAAGGAGTAGG - Intergenic
1016341401 6:143065133-143065155 TAATCAGTTAAGGCAGGAATTGG + Intronic
1016401854 6:143689617-143689639 AAATGGGGAGAGGCAGGGGTTGG - Intronic
1017574645 6:155788709-155788731 AAATGATGGAAGGGAGGAATTGG + Intergenic
1017663448 6:156695999-156696021 GAATGGGGTGAGGCAGGAGGAGG - Intergenic
1018732019 6:166658484-166658506 AAATGACACAAGGCAGGGGTGGG + Intronic
1018868126 6:167760932-167760954 AAATGAGGTTAGGTATGAGGAGG + Intergenic
1020410892 7:7890327-7890349 AAAGGAGATAAGGAATGAGTAGG - Intronic
1021696931 7:23285057-23285079 AAATGAAGGAAGGCAGCAGCTGG - Intergenic
1021814432 7:24433452-24433474 TAATGAGGTCAGGCTAGAGTAGG + Intergenic
1021920794 7:25482996-25483018 AAATGAGGTAAAGGAGGAGGAGG - Intergenic
1022263210 7:28727452-28727474 AAAGGAGGAAAGGAAGGGGTAGG + Intronic
1022855676 7:34311257-34311279 AAGTGAGGTAAGGGAGGTATTGG - Intergenic
1024415828 7:49106377-49106399 AAATGAGGTCATGCTGGAGTAGG - Intergenic
1025105637 7:56169882-56169904 AAATGACGGCAGGCATGAGTTGG + Intergenic
1025875510 7:65477119-65477141 GAAAGAGGTAAGGCAGGAGCGGG - Intergenic
1026314723 7:69218391-69218413 AAATGACGGCAGGCACGAGTTGG + Intergenic
1027455843 7:78390757-78390779 AACTGAGGTGAGGCAGGAAGGGG - Intronic
1027605830 7:80297258-80297280 ATATGAGGTGAGGCATAAGTGGG + Intergenic
1027732285 7:81889720-81889742 AAGTGAGGTAAGAAAGGAATGGG + Intergenic
1028995464 7:97095278-97095300 TAAAGAGCTAAGGCAGGAGAAGG - Intergenic
1031195678 7:118610192-118610214 AAATGAGGTAAGATTGTAGTGGG + Intergenic
1031269199 7:119624038-119624060 AAATAAGGTAACACTGGAGTAGG - Intergenic
1032111032 7:129075820-129075842 AAATGAGGCAGTGAAGGAGTGGG - Intergenic
1032415565 7:131732879-131732901 GAGTGAGTTAAGGCAGGAGGTGG + Intergenic
1032927179 7:136620443-136620465 AAATGAGGTAACTCAACAGTAGG + Intergenic
1033300296 7:140178607-140178629 AAAGGAGATTAGGCAGGACTTGG - Intergenic
1033946498 7:146725213-146725235 AAATGAGGTAATACTGGATTCGG - Intronic
1035050160 7:155994156-155994178 GGATGAGGTGGGGCAGGAGTGGG - Intergenic
1035104486 7:156430441-156430463 AAATGAGGAAAGCCAGGCTTTGG - Intergenic
1035628600 8:1091836-1091858 AAAAGGGGGAAGGCAGGTGTGGG - Intergenic
1037012004 8:13855424-13855446 AAATGTGGAAAGGCAGGCATGGG - Intergenic
1038003260 8:23408138-23408160 AAATGAGGAAATGTGGGAGTCGG + Intronic
1038716017 8:29991832-29991854 AAATGGGATAGGGCGGGAGTGGG + Intergenic
1038912307 8:31979463-31979485 ATAGGAAGTAAGACAGGAGTTGG - Intronic
1039217577 8:35290020-35290042 AAATGATGAAAGGCAAGTGTTGG + Intronic
1039333011 8:36559805-36559827 CATTGAGGTAAAGCAGGAGGTGG - Intergenic
1039492606 8:37959204-37959226 AAATGAGGTCATGCTGGATTAGG + Intergenic
1039553593 8:38460810-38460832 AACTGAGGTGAAGCAGGAGGTGG - Intronic
1040045104 8:42954843-42954865 AAATGAAGAAAGGAAGGGGTGGG + Intronic
1040672635 8:49711106-49711128 AAATGACGTAATGAAGGGGTCGG - Intergenic
1041049058 8:53915435-53915457 TGAAGAGGTCAGGCAGGAGTGGG - Intronic
1041366801 8:57114946-57114968 AAATGAGATGATGCAGGATTGGG + Intergenic
1042151709 8:65793811-65793833 AAATTACATAAGGCAGAAGTAGG + Intronic
1042616962 8:70660317-70660339 AAAAGAGGTAAGACAAGAGAAGG + Exonic
1042797161 8:72677026-72677048 AAATTAGGTCATGCTGGAGTAGG + Intronic
1042893714 8:73642613-73642635 AAAAGAGGTAAAGCAGGAGAGGG - Intronic
1044035058 8:87291608-87291630 AAATAAGATAGGACAGGAGTTGG - Intronic
1044094615 8:88047845-88047867 GAAGGAGATAAGGCAGAAGTAGG + Intronic
1044119439 8:88376587-88376609 ATATGAGATAAGGAAGTAGTTGG + Intergenic
1044323066 8:90827407-90827429 ACATAAGGAAAGGCAGGAGCTGG - Intronic
1044624965 8:94227891-94227913 TAATGAACTAAGGCAGGAATAGG - Intergenic
1046084197 8:109411549-109411571 AAATGAAGTAGGAAAGGAGTAGG - Intronic
1046844493 8:118900758-118900780 AAATGAGGAAAGGCAGAAAAGGG + Intergenic
1046930591 8:119837921-119837943 AAATAAAGTAAGGCATGAGGTGG + Intronic
1047152857 8:122284355-122284377 AGATGAGGTTAGACAGGATTAGG - Intergenic
1047177934 8:122559047-122559069 AAGTGAGGTGAGGCAGTATTTGG - Intergenic
1047555358 8:125923498-125923520 AAATGGGTTGAGGCTGGAGTGGG - Intergenic
1047785287 8:128148466-128148488 AAGTGAGCTAATGCAGGAATGGG - Intergenic
1047859111 8:128945277-128945299 CAATGAGGTCAGGCTGGAATAGG + Intergenic
1048007580 8:130431852-130431874 AAAGGAGGAAAGGGAGGAGTAGG + Intronic
1048076035 8:131072601-131072623 AAGTGAGGAAAAGCAGGATTGGG + Intergenic
1049966999 9:788891-788913 TAATGAGGGAAGGCTGGTGTGGG + Intergenic
1050103513 9:2142692-2142714 TAAAGAGGTGAGGCTGGAGTAGG + Intronic
1050184367 9:2957187-2957209 GAATGTGGACAGGCAGGAGTGGG + Intergenic
1050228811 9:3493934-3493956 AGATGAGGTAAAGCAGGACATGG - Intronic
1052479351 9:29002944-29002966 AAATGAGGTCATACTGGAGTAGG + Intergenic
1052480754 9:29022233-29022255 AAAGGAAGCAAGGCATGAGTTGG + Intergenic
1053210115 9:36220418-36220440 AACCGAGGCAAGGCAGGAGCCGG + Intronic
1053329378 9:37188976-37188998 AAATGAAGAAAGGAAGGAGTGGG - Intronic
1054878781 9:70123660-70123682 AGATGAGGTCATGCTGGAGTAGG + Intronic
1055666836 9:78561345-78561367 AAATGAGGTCATACTGGAGTAGG - Intergenic
1056463026 9:86826467-86826489 ATCTGGGGTGAGGCAGGAGTAGG - Intergenic
1056495077 9:87148358-87148380 AAAGGTAGTAAGGCAGGAGGTGG + Intergenic
1057842873 9:98500493-98500515 AAAGGAGGTAAGGAAGGACTGGG + Intronic
1058031673 9:100206139-100206161 ATATTAAGTAAGGCATGAGTAGG + Intronic
1058680260 9:107434517-107434539 AAATGAGGTGATACTGGAGTAGG - Intergenic
1058974673 9:110114900-110114922 AAATGAGAGAAGGTAGTAGTCGG + Intronic
1059330405 9:113531953-113531975 CAAGGAGGTAAGGCAAGAGCGGG + Intronic
1060150878 9:121287349-121287371 AACTGAGGCTAGGCAGGAGAGGG - Intronic
1060201317 9:121653080-121653102 ACTTCAGGAAAGGCAGGAGTGGG - Intronic
1186204073 X:7182936-7182958 AGATGAGGTCATGCTGGAGTAGG + Intergenic
1186358091 X:8808391-8808413 AAATGAGAGAATGAAGGAGTTGG + Intergenic
1186552584 X:10522171-10522193 AAGTGAGGTAAGGCTGGAGTAGG + Intronic
1188909786 X:35832565-35832587 AAGTGAAGTAACTCAGGAGTAGG + Intergenic
1188984777 X:36759408-36759430 AGAAGAGGTAAAGCAGGAGTTGG - Intergenic
1189675702 X:43458474-43458496 AAATTAGGTAAGCCAAGAGCAGG - Intergenic
1189707907 X:43778166-43778188 AAAAGAGGGCATGCAGGAGTGGG + Intronic
1190125886 X:47705105-47705127 AAATTAGGTAAGCCAAGAGCAGG + Intergenic
1190189045 X:48260511-48260533 ACATGAAGTTAGGCAGGAGAAGG + Intronic
1190305228 X:49078160-49078182 AAATCAGGTGAGGCAGAACTTGG - Intronic
1192250685 X:69411037-69411059 AAATGAAATAAGGCAGTGGTTGG - Intergenic
1192800368 X:74459737-74459759 CAAGGAGGTGAGGTAGGAGTTGG - Intronic
1194109546 X:89816762-89816784 AAATGAGGTACAGAAGGAGCTGG - Intergenic
1194435512 X:93864614-93864636 AAGTGAGGTAACACAGGAATGGG + Intergenic
1196185479 X:112740478-112740500 AAAGGAAGGAAGGAAGGAGTTGG + Intergenic
1196296548 X:114004149-114004171 ACATGAGGTGAGGCAGGAAAGGG - Intergenic
1198163977 X:134035127-134035149 AAATGAGGTCAGGGAGTACTGGG - Intergenic
1199104856 X:143853473-143853495 AAATGAGGTCATACTGGAGTAGG + Intergenic
1199122049 X:144066639-144066661 AAGTGAGGTAACTCAGGAATGGG + Intergenic
1199474126 X:148227463-148227485 ATTTGAAGCAAGGCAGGAGTTGG - Intergenic
1199662036 X:150061162-150061184 AAAAGAGGTAAAGCAGATGTGGG - Intergenic
1200377273 X:155796364-155796386 AAGTGAGGTAACTCAGGAATGGG - Intergenic
1201349660 Y:13025818-13025840 AAAAGAGGGAAGGAGGGAGTGGG - Intergenic
1202296260 Y:23360581-23360603 TAATGAGCTAAGGCAGTTGTTGG + Intergenic
1202574547 Y:26310015-26310037 TAATGAGCTAAGGCAGTTGTTGG - Intergenic