ID: 916203547

View in Genome Browser
Species Human (GRCh38)
Location 1:162294333-162294355
Sequence TCCCCACATCTCCCAGGGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 303}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916203543_916203547 -4 Left 916203543 1:162294314-162294336 CCAAAGTTGTCTGTCGGGATCCC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG 0: 1
1: 0
2: 2
3: 29
4: 303
916203540_916203547 3 Left 916203540 1:162294307-162294329 CCAGAAGCCAAAGTTGTCTGTCG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG 0: 1
1: 0
2: 2
3: 29
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916203547 Original CRISPR TCCCCACATCTCCCAGGGAC GGG Intronic
901018412 1:6244273-6244295 CCCCCACACCTCCCGGGGAAGGG - Intronic
901218161 1:7566291-7566313 TCCCAACATCCTCCAGAGACAGG - Intronic
901455632 1:9361372-9361394 TCTCCAGATATCCCAGGGAGTGG - Intronic
901701373 1:11046443-11046465 TCCCCACCTTTCCCAGGGCAGGG - Intronic
901794674 1:11673439-11673461 TACCCACTCCTCCCAGGGCCAGG + Intronic
902095916 1:13945778-13945800 TCACCCCATCTACCAGGCACCGG - Intergenic
902568832 1:17333507-17333529 TCCCCAGATCCCCCAGGACCCGG + Intronic
903159036 1:21471695-21471717 GCCGGACAACTCCCAGGGACGGG + Exonic
903257958 1:22115230-22115252 TCCCCAGACTTCCCATGGACTGG + Intergenic
904613520 1:31737819-31737841 TCCCCTCATCTACCATAGACTGG + Intronic
904774263 1:32897003-32897025 TCCTCACTTCTCCCAGCAACTGG - Intronic
905735686 1:40324275-40324297 ACACCACATCCCTCAGGGACAGG + Intergenic
906102865 1:43274191-43274213 CCCTCACCTCTCCCTGGGACTGG - Intergenic
906608505 1:47187057-47187079 TCCCCAAAACTCACAGGGAGTGG + Intronic
908519882 1:64931446-64931468 TCCCCACCTCCCCCAGCAACAGG + Intronic
909706855 1:78595735-78595757 TCCTCACACCTCCCAGCCACTGG - Intergenic
911047788 1:93642815-93642837 TCCCTCCATCACCCAGGCACTGG - Intronic
911544663 1:99202379-99202401 ATCTCACATCTCCCAGGAACAGG - Intergenic
915139814 1:153760448-153760470 TCCCCTAATCTCCCAGTGAACGG + Intronic
916203547 1:162294333-162294355 TCCCCACATCTCCCAGGGACGGG + Intronic
919358033 1:196551355-196551377 TCCCCACATCTACCTGCCACTGG - Intronic
919660269 1:200237288-200237310 TCCCCAACTCTTCCAGGTACAGG + Intergenic
919786669 1:201262476-201262498 TCCCCAAATCCCCCAGGGCCAGG + Intergenic
920032512 1:203045825-203045847 TCCCCTCTTCTCCCAGGCTCTGG + Intronic
920033558 1:203051370-203051392 TTCCAACATCTCCCAGTGCCTGG + Exonic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920451707 1:206064635-206064657 CCCCCACCTCCCCCCGGGACGGG - Intronic
921057261 1:211552518-211552540 TCCCCGCAGCTCCCAGCCACTGG + Intergenic
921708682 1:218352032-218352054 TGCACACCTCTCCCAGGGCCAGG - Intronic
921762799 1:218936828-218936850 TCTCCCCATCCCCTAGGGACGGG + Intergenic
921814627 1:219549620-219549642 TCACCACCACTCCCAGGGGCTGG + Intergenic
922594341 1:226802549-226802571 TTCCCACCTCCTCCAGGGACAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1063643196 10:7852088-7852110 CCCCACCATCTCCCAGAGACGGG + Intronic
1065201437 10:23316814-23316836 TCCCCACTTCTGCCAGAGTCTGG + Exonic
1067135833 10:43606605-43606627 TCCCCGCCTTTCCCAGGGGCGGG + Intronic
1067829913 10:49605660-49605682 TCTCTACAGCTCCCAGGGACAGG - Intergenic
1069830705 10:71280697-71280719 TCCCCACATCTCCCAGAACTGGG + Intronic
1070569646 10:77631402-77631424 TCCCCACACGGCCCAGGGCCTGG + Intronic
1070785840 10:79161875-79161897 TCCCCACACCTGCCAGTTACTGG - Intronic
1071240439 10:83699099-83699121 TCCCCACATCCACCAGCGAGTGG - Intergenic
1075538358 10:123290652-123290674 TTCCCTCATCTCCCTGGGCCTGG - Intergenic
1076217715 10:128710084-128710106 TCCCCAGACCACCCAGGGCCCGG + Intergenic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077096395 11:800906-800928 CCCCCAGCTCTCCCAGGTACTGG - Exonic
1078380545 11:10836118-10836140 CCCCAACATTTTCCAGGGACTGG - Intronic
1078546811 11:12252914-12252936 TGGCCACATCTCCCAGAGGCTGG + Intronic
1078606918 11:12785138-12785160 TCCCCACGGCTCCCAGGCACAGG - Intronic
1079172062 11:18105855-18105877 TCCCTACATCCCCCAGGCACCGG - Intronic
1079755423 11:24253507-24253529 TCCCCACATGTCACAGTGGCTGG + Intergenic
1081964472 11:47161287-47161309 ATCCCACATCTGCCAGGGAAGGG + Intronic
1083146040 11:60759603-60759625 TTCCCACATGTCCCTGGGAATGG + Intronic
1083204251 11:61138551-61138573 TCCCAAGAACTCCCAGGAACTGG + Intronic
1083685665 11:64373513-64373535 TCCCCAGGCCTCCCGGGGACAGG - Intergenic
1083714205 11:64566513-64566535 TCCTCAGTTCTCCCAGGGGCCGG + Intronic
1083799449 11:65038061-65038083 TCCTCACATTTCCCAGGTAAAGG - Intronic
1083896968 11:65624834-65624856 TCCCCTCAACTCCCAGAGGCTGG - Intronic
1084122584 11:67078057-67078079 TCCCCGCCTCTCCCAGTGCCGGG - Intergenic
1085038259 11:73312334-73312356 TCCCCAATTCTCCCAGGCCCAGG - Intronic
1085415229 11:76315274-76315296 TCCCCACACCTCCCTGGGCAGGG + Intergenic
1085502422 11:77036174-77036196 TCCCCAAATGTGCCAGGCACAGG + Intronic
1086849802 11:91796322-91796344 TCCCCATCTCTCCCAGGCTCTGG + Intergenic
1087762019 11:102111347-102111369 TCCCCACTCCTCCCAGAGTCCGG + Intronic
1088177064 11:107065707-107065729 TCCACACATCTCAAAGGGACAGG + Intergenic
1088376302 11:109145462-109145484 CCCCCCCATCTCCCAGAGACAGG - Intergenic
1088599698 11:111463373-111463395 TCACCACTTCTCTCAGGGACCGG + Intergenic
1089691062 11:120186909-120186931 TCCCCAGGTCTCCCAGGGGAGGG + Intergenic
1089809524 11:121120442-121120464 TCCCCACATCACCCTGGGTCGGG - Intronic
1091195390 11:133726652-133726674 TCCCCTCATCTCCAAGGTGCTGG + Intergenic
1091909893 12:4221091-4221113 TCCCCACTTCTCCCAGCCCCTGG + Intergenic
1092209190 12:6635496-6635518 ACCACACATCCCCCAGGGCCAGG - Intronic
1093008413 12:14077956-14077978 TCCCATCAGCTCCCAGAGACAGG + Intergenic
1093037666 12:14348041-14348063 TCCCCACTTCCCCCAGGCCCTGG + Intergenic
1094090749 12:26646525-26646547 TCCCCAAATCTCCTAGGGCAAGG + Intronic
1096597961 12:52709215-52709237 ACCCTACATTTCCCAGGGTCTGG + Intergenic
1097149908 12:56969074-56969096 TTCCCACATGTCCCTGGGAATGG - Intergenic
1098393831 12:69997309-69997331 TCTTCACATGTCCCAGGGAGAGG + Intergenic
1101879226 12:108614986-108615008 TCCCTGCCCCTCCCAGGGACTGG - Intergenic
1102417757 12:112779309-112779331 GTCCCATGTCTCCCAGGGACAGG + Intronic
1104079191 12:125415395-125415417 CCCCCACATCTCCCAGAGGAAGG + Intronic
1106137734 13:26986675-26986697 ACCACACTTCTCCCAGGGCCAGG - Intergenic
1107262752 13:38514753-38514775 ACCTCACAACTCTCAGGGACAGG - Intergenic
1107808771 13:44179329-44179351 TGCCCACCTCTGCCAGGGGCTGG + Intergenic
1107925010 13:45250559-45250581 TACCCACTTCTGCCAGGCACTGG - Intronic
1107966312 13:45601466-45601488 TCCTCACCTCTCCCAGGGGAGGG - Intronic
1107991256 13:45820749-45820771 TCCCCTCCTCTCCCAGGTTCTGG + Intronic
1110709996 13:78640226-78640248 TCCCCACATCTACAGGGGATTGG + Intronic
1111745246 13:92259937-92259959 TACCCAAATCTCGTAGGGACAGG + Intronic
1112344060 13:98576405-98576427 ACCTCACTTCTCCCGGGGACAGG + Intronic
1112585547 13:100715842-100715864 TGCCCCCATCTCCCAGGACCAGG + Intergenic
1112595643 13:100804704-100804726 TGCCCTCATCACCCAGGGCCAGG + Intergenic
1113396695 13:109954664-109954686 TCCCCAGATCCCCATGGGACAGG - Intergenic
1113761832 13:112853543-112853565 ACCCCAGATCTCCCAAGGAGAGG + Intronic
1113856437 13:113448881-113448903 TCCCCAGTTTTCCCAGGGAGTGG + Intronic
1114438285 14:22726247-22726269 TCCCCTCAACCCCCATGGACTGG - Intergenic
1114871130 14:26659795-26659817 GTCCCACATCTCCAAGGAACAGG + Intergenic
1116428431 14:44818640-44818662 TCACCACAACTCCCAGGTAGTGG + Intergenic
1116964544 14:51000577-51000599 TCCCCATCTCTCCTGGGGACAGG - Intronic
1117954962 14:61115689-61115711 ACCCAAAATCTCCCTGGGACTGG - Intergenic
1119765126 14:77183002-77183024 AGCCCATTTCTCCCAGGGACAGG - Intronic
1119805106 14:77477370-77477392 TCTGCACATCTCCAAGGGACTGG + Intronic
1120386752 14:83855930-83855952 TCCTGTCATCTCCCAGGGACAGG - Intergenic
1122274824 14:100586166-100586188 CCCCCACTACTCCCAGGGCCAGG - Intronic
1122389473 14:101370407-101370429 TCTCAACACCTGCCAGGGACCGG - Intergenic
1122716002 14:103697524-103697546 TCCTCACAACTCCTAGGGATAGG - Intergenic
1124124797 15:26929544-26929566 GCCCCACAGCTCTCTGGGACTGG + Intronic
1125731974 15:41897601-41897623 TCTCCCCAGCTCCCAGGGAGGGG - Exonic
1126696816 15:51333338-51333360 TTCTCACATCTCCCAGGCTCAGG + Intronic
1128783407 15:70377597-70377619 TTCCCACAACTCCCAGGCTCTGG - Intergenic
1129698034 15:77751746-77751768 CCCTAACTTCTCCCAGGGACTGG - Intronic
1129752500 15:78076156-78076178 CCCCCAGAACTCCCAAGGACAGG + Intronic
1130132168 15:81153295-81153317 TCCCCACTTCTCCCCAGGAGAGG - Intergenic
1130844941 15:87735641-87735663 CCCCCACTCCTCACAGGGACCGG + Intergenic
1130996873 15:88908937-88908959 TCCCCACATCTCCCTGAGGAGGG + Intronic
1132209383 15:100008662-100008684 TGCCCAAGTCTCCCTGGGACAGG - Intronic
1132567201 16:628957-628979 GGCCCTCATCTCCCAGGAACGGG - Exonic
1132577571 16:671018-671040 TCCCCACACTCCCCAGGCACAGG - Intronic
1133381582 16:5335541-5335563 TCCCCTAATCCCCCAGTGACGGG - Intergenic
1133427361 16:5704394-5704416 TCGCCACAACTCACAGGGAGTGG + Intergenic
1135227399 16:20673651-20673673 TCTTTCCATCTCCCAGGGACTGG - Intronic
1136364561 16:29803715-29803737 TCCTCACCCCTCCCTGGGACTGG - Intronic
1136418623 16:30118306-30118328 TCCCCTCCTCCCCCAGGGTCTGG - Intronic
1136617985 16:31410400-31410422 TCCCCACAGCCCCCAGGAAGAGG - Exonic
1137017371 16:35391462-35391484 TCCCCAACTCTCCCAGGGAAAGG + Intergenic
1138402522 16:56758571-56758593 ATCCCACATCTCCCAGCGATTGG + Exonic
1138553841 16:57760989-57761011 TCCCCACAACCCCAAGGGGCAGG - Intronic
1139359417 16:66388206-66388228 TCCCCACCTCCCCCAGGTCCTGG - Intronic
1139545828 16:67649122-67649144 GCGCCACATGTCTCAGGGACCGG - Exonic
1142141180 16:88473532-88473554 GCCCCACTTCTCCCATGGCCGGG + Intronic
1142147463 16:88498577-88498599 ACCCCACATGTCCGAGGGGCAGG + Intronic
1142317499 16:89357309-89357331 TCACCACGTGTCCCGGGGACAGG + Intronic
1142550132 17:732988-733010 TCCCCACATCTGCCTGCGGCTGG + Intronic
1142602208 17:1059179-1059201 GCCCCACGTCACCCAGGGCCAGG + Intronic
1143129954 17:4671876-4671898 TCTCCACCTCTCCCTGGGAGGGG + Exonic
1144830170 17:18126728-18126750 CTCCCACACCTCCCAGGGATTGG - Intronic
1148463542 17:47851356-47851378 TCCCCTCCACTCCCAGGGAGAGG + Intronic
1148756192 17:49974154-49974176 TCCCCACCACTACCATGGACTGG + Exonic
1149439342 17:56661988-56662010 TCCCCTCACCACCCAGGGCCAGG + Intergenic
1150227784 17:63533250-63533272 TCCCCACATCTCCAAGGGTTTGG - Intronic
1152303529 17:79508681-79508703 TCTCCAAATCTCCCAGCGAGGGG - Intronic
1152805436 17:82353679-82353701 TCCCCCCATCACCCAGGGCCAGG - Intergenic
1154133899 18:11759765-11759787 TGCACACATCTCCCAAGGAGAGG - Intronic
1154437263 18:14356716-14356738 TCCTAACCTCTCCCAGAGACTGG + Intergenic
1162066844 19:8131177-8131199 TCCCCACATCTGGTAGGGGCAGG + Intronic
1162151619 19:8649668-8649690 TCCCCACCCTGCCCAGGGACTGG - Intergenic
1162171648 19:8794420-8794442 TCACCACATATCCCAGGGAAGGG - Intergenic
1162892198 19:13741824-13741846 TCTCCCCATCTCCCAAGCACAGG + Intronic
1163203231 19:15783083-15783105 TTCCCACATGTCCCTGGGAAGGG - Intergenic
1163322828 19:16584569-16584591 TCCCCACTGCTCCCAGGGTGTGG - Intronic
1163826099 19:19525796-19525818 TGCACACAGCTGCCAGGGACAGG - Intronic
1164474546 19:28565075-28565097 ACCCCACATGGCCCAGGGAGGGG + Intergenic
1164563343 19:29309059-29309081 TACACACTTCTCCCAGGGAGGGG + Intergenic
1165110509 19:33499487-33499509 GCCCTACATGTCCCTGGGACTGG + Intronic
1165730051 19:38139474-38139496 TCCCCACCTCTGCCCGGGCCTGG + Intronic
1165829566 19:38723809-38723831 TCCCCCCACCTCCCACGGAGAGG + Intronic
1165838606 19:38773677-38773699 TCCCCCCATCACCCAGGGCCCGG + Intergenic
1165840956 19:38789020-38789042 TCCCCCCATCACCCAGAGCCCGG - Intergenic
1166383885 19:42369849-42369871 TCCACACATCTCCCTGGGACAGG - Intronic
1166774076 19:45302052-45302074 GTCCCACATCTCCCAGGAGCTGG - Intronic
925110368 2:1330432-1330454 TACTTACATTTCCCAGGGACTGG + Intronic
925317032 2:2934346-2934368 TCCCCGCATCTGTCTGGGACTGG + Intergenic
927478087 2:23429294-23429316 TGCCCACATGTCCCTGGGAGAGG + Intronic
927621699 2:24667555-24667577 CCCTCATGTCTCCCAGGGACTGG - Intronic
928387545 2:30883254-30883276 TTCCCTTATCTCCCAGGGAGAGG - Intergenic
931331199 2:61286061-61286083 TTCTCACTTCTGCCAGGGACAGG - Intronic
932379500 2:71269480-71269502 TCCCTACATCTCCTTGGGAAGGG + Intergenic
932731439 2:74224768-74224790 TCTCCACTTTTGCCAGGGACAGG - Intronic
932989698 2:76771748-76771770 TCCTCACATACCCAAGGGACTGG + Intronic
934860571 2:97760960-97760982 GCCCCACACCTCCCCGAGACAGG - Intronic
934979444 2:98827837-98827859 TCCCCTCAGCTTCCAGAGACAGG - Intronic
936413381 2:112280844-112280866 TCCCCACATCCTTCAGGGTCTGG - Intronic
937252539 2:120533798-120533820 TTCCCACAGCTGCCGGGGACCGG + Intergenic
938672871 2:133602280-133602302 TCCCCAAATCTCCGAGGCTCAGG - Intergenic
943828336 2:192425681-192425703 TCCCTACATCTCCCAAGTCCTGG + Intergenic
944052648 2:195488667-195488689 TCCCCAAATTTCCCAGGAATAGG - Intergenic
944310216 2:198224843-198224865 TGCCCCCATCCCCCAGGGGCTGG + Intronic
944365954 2:198919861-198919883 TCCCTACATCTCCCAGTCAGAGG + Intergenic
944393781 2:199246928-199246950 TGACCAGTTCTCCCAGGGACTGG + Intergenic
946031500 2:216708582-216708604 GCCCCACACCTCCCAGGAGCTGG - Intergenic
946156192 2:217808239-217808261 TTCCCCCATTCCCCAGGGACAGG + Intronic
948634767 2:239328018-239328040 CCTCCACATCTGCCAGTGACTGG + Intronic
948953188 2:241268428-241268450 TCCACACACAGCCCAGGGACAGG + Intronic
1170163147 20:13336379-13336401 TCCTCTTATCTCCCAGGGATGGG + Intergenic
1170841831 20:19930127-19930149 TCCCCACATCCAGCAGGGAAGGG + Intronic
1172070350 20:32252184-32252206 TCACGACATCACTCAGGGACCGG - Intergenic
1172121004 20:32598704-32598726 TCACCTCAGCTCCCAGGGAAGGG - Intronic
1173507330 20:43598283-43598305 TCCCCACCTCCCCCAGGCCCTGG - Intronic
1173556616 20:43970753-43970775 TCTCCAAATCTCCCAGAGCCTGG - Intronic
1173843391 20:46173630-46173652 TCCCTACATCTCCCAGGGGAGGG - Intergenic
1174282647 20:49450374-49450396 TCCCCACCCCTCCCTGGCACAGG + Intronic
1175264281 20:57693146-57693168 ACCCCACGCCTCCCAGGGCCAGG + Intronic
1175906209 20:62380847-62380869 TCCCCACACCTCCTGGGGGCTGG - Intergenic
1175936127 20:62514888-62514910 CCCTCACCTCTCCCAGGGAAGGG - Intergenic
1175966891 20:62664358-62664380 GCCCCACTTCTCCCAGGGGCTGG + Intronic
1176365354 21:6029577-6029599 TCCCCACATACCCCTGGGCCGGG + Intergenic
1176688107 21:9872928-9872950 TCCCCTCACCTCTCAGGGTCAGG - Intergenic
1176839790 21:13828922-13828944 TCCTAACCTCTCCCAGAGACTGG - Intergenic
1176997394 21:15571387-15571409 TCTCCCCATCTCCCAGGTCCTGG - Intergenic
1178872146 21:36385651-36385673 ACCCCGCCTTTCCCAGGGACCGG - Intronic
1179525890 21:41975613-41975635 ACCCCACGTCTCCTTGGGACAGG - Intergenic
1180968465 22:19802603-19802625 TCTCCACTTCTCCCATGCACAGG + Intronic
1181517362 22:23422863-23422885 TCCTCACCTTTCCCAGGAACAGG + Intergenic
1182266437 22:29119424-29119446 CCCCCACATCCTCCAGGGAGAGG - Intronic
1182487842 22:30649862-30649884 TCCCCACAACCACCAGGGGCAGG - Intronic
1183742023 22:39674119-39674141 TCCTCACATCTGCCAGAGCCAGG + Intronic
1184263019 22:43330033-43330055 TCCCCATTTCTCCCAGGGTTAGG - Intronic
1185041747 22:48507782-48507804 TCCCGACAGCTCCCAGGCAGGGG - Intronic
949111398 3:265669-265691 TCCCCACATCTCCCACCCATAGG - Intronic
949544465 3:5060716-5060738 TCACCACATCTGCCAGTCACTGG - Intergenic
950646653 3:14381453-14381475 TCCCCACTTCTCCCAGCTCCAGG - Intergenic
951644074 3:24867646-24867668 TCCCCACTTCTGCCAGGAAAGGG - Intergenic
952160873 3:30691714-30691736 TCCCCACAGCTTACAGGGAGGGG - Exonic
953744899 3:45566890-45566912 GCCCCACATCTCTCAGGAATAGG + Intronic
954045533 3:47926538-47926560 TCTACACATCTATCAGGGACAGG + Intronic
954403777 3:50333806-50333828 TCCCCACCTCATCTAGGGACTGG + Intronic
954677834 3:52325403-52325425 TGGCCACATTTCCCAGGGCCTGG - Intronic
955412856 3:58667139-58667161 GCCCCACACCTCCCAGCGCCTGG - Intergenic
955705055 3:61719352-61719374 TCCCCACAACTCCCAGTTAGAGG - Intronic
960993518 3:123326553-123326575 TACCCACATCTCTCAGTGCCTGG - Intronic
961001644 3:123378212-123378234 TATCCACCCCTCCCAGGGACTGG - Intronic
961692630 3:128681012-128681034 TCACCGCGTCTCCCAGGGACAGG - Intronic
962255103 3:133865147-133865169 TCCCCATGTCTCTCATGGACAGG + Intronic
963080010 3:141382759-141382781 TTCCCACAGTTCCCAGGGCCTGG + Intronic
967089145 3:186120254-186120276 TGCCCACATCTACCTGGCACTGG - Intronic
967938013 3:194744750-194744772 TCCCCAGAGCTCCTAGGGACTGG + Intergenic
968705302 4:2074840-2074862 TCCCCACAGCACCCAGCCACTGG - Intronic
969634190 4:8356664-8356686 TCCCCTCACCTGCCAGGAACAGG - Intergenic
970391021 4:15614149-15614171 TCCCCACTTCCCCTAGGGATGGG + Intronic
972463382 4:39328203-39328225 TCCCCACATTTACCAGTGCCAGG + Intronic
974031324 4:56779311-56779333 TTCACACATCTCCCAGGGAATGG - Intergenic
976840986 4:89432115-89432137 TACCCATATGTTCCAGGGACAGG + Intergenic
977357729 4:95968377-95968399 TTCCCACCTCTCCCAAAGACAGG + Intergenic
984056254 4:174932928-174932950 TCCCCAAATCTCCTAGGGCCAGG + Intronic
985136388 4:186790225-186790247 GCTCCTCATTTCCCAGGGACTGG + Intergenic
985529347 5:424665-424687 GCCCCACATCTGCCAAGGGCTGG + Intronic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
987065518 5:14286254-14286276 TGCCAAGAACTCCCAGGGACGGG + Intronic
988598008 5:32612844-32612866 TGCCCACATCTCCCAGAATCAGG - Intergenic
989070203 5:37502354-37502376 TCCCCACCTCTCCCAAGAATTGG - Intronic
989180092 5:38567911-38567933 TCCCTACACCTCACAGAGACTGG + Intronic
990260792 5:54020358-54020380 TCCCCACCTCTCCCAGAGTGGGG + Intronic
990510194 5:56482421-56482443 CACCCACATCTCACAGGGGCTGG + Intergenic
992179278 5:74181060-74181082 GTCCCACATCTCCCAGGAACAGG + Intergenic
992308517 5:75468506-75468528 TCCTCACCTATCCCAGTGACAGG + Intronic
992369088 5:76124268-76124290 TCCCCACTTCTCCCAGATCCTGG + Intronic
993258569 5:85626841-85626863 ATCCCACATCTCCCAGGAAGGGG - Intergenic
994189833 5:96857211-96857233 TTCCCTGATCTCCCAGGGCCAGG + Intronic
994372801 5:98986246-98986268 TCCTGGCATCTCCCAGGAACAGG + Intergenic
994954269 5:106507193-106507215 TCCCCACAGCTCCCAGCCTCTGG - Intergenic
996548277 5:124704405-124704427 TCCCGACATCTCACAGTGAATGG - Intronic
997294886 5:132763045-132763067 TCCCAAAATCTCCCAGGCCCAGG + Intronic
997622640 5:135308683-135308705 TCCCCACATTCCCCAGGGTTAGG - Intronic
998619758 5:143781067-143781089 TCACCTCACCTGCCAGGGACAGG + Intergenic
999106300 5:149074292-149074314 TCCCTACCACTCCCAGGGAAAGG + Intergenic
999111774 5:149127634-149127656 TCCCTACCACTCCCAGGGAAAGG + Intergenic
999388020 5:151169268-151169290 TCCCCTCCCCTCCCATGGACAGG + Intergenic
999808173 5:155103098-155103120 TCCCCTGATTTCCCAGGAACAGG - Intergenic
1001461474 5:171918861-171918883 TCGCCAAATGTCCCAGGGAAGGG + Intronic
1001919709 5:175590425-175590447 GCCCCACATCTCCCAGCCAAGGG + Intergenic
1002134032 5:177097276-177097298 GCCCCACCTCTCGCAGGTACGGG + Exonic
1002470975 5:179435983-179436005 TCCCCACCCCTCCCAGGCATGGG - Intergenic
1003642286 6:7886265-7886287 TCACCACATCTCCCAGGCTTGGG - Intronic
1004002467 6:11607730-11607752 TCCGTCCATCTCCCAGGGGCAGG - Intergenic
1005483520 6:26277203-26277225 TCCCAACAGCTCCAAGGGAGTGG + Intergenic
1005866758 6:29943059-29943081 ACCCCTCATCCCCCACGGACGGG + Intronic
1006990606 6:38211970-38211992 TCCCCACATCACCCAGCCATGGG - Intronic
1007928381 6:45668495-45668517 GCCACATACCTCCCAGGGACTGG + Intergenic
1010231160 6:73536509-73536531 TCCCTACCTCTACCAGGGCCTGG - Intergenic
1013155382 6:107488424-107488446 TCCCCTCGCCTCCCCGGGACGGG + Intergenic
1013853460 6:114542695-114542717 CCCCTACATCTCCCAGATACTGG - Intergenic
1013932839 6:115555486-115555508 TTCCCTCATCTCCCAGAGAGTGG + Intergenic
1015451002 6:133365739-133365761 TCCCTAAATCTCCCAGGGCCAGG - Intronic
1016389282 6:143558931-143558953 TCTCCCCTTCTCCCAGGGAGTGG - Intronic
1016868247 6:148790737-148790759 TCCCCACATCAACCAGGCATTGG - Intronic
1018698577 6:166409649-166409671 TCTCCACACCGCTCAGGGACCGG + Intronic
1019486927 7:1293642-1293664 TCCCCGCAGCCCCCAGGGTCCGG - Intergenic
1019513489 7:1429793-1429815 TCCCCTCCTGTCACAGGGACAGG + Intronic
1019623736 7:2004879-2004901 TCCTCACATGACCCAGGGCCTGG + Intronic
1019990416 7:4686512-4686534 TCGCCAGAGCTCCCAGGCACAGG + Intronic
1020131927 7:5563506-5563528 ACCCCACCTCTCCCAGGTGCAGG - Intronic
1020389352 7:7641586-7641608 CCCCCAAATCTCCCAGGAATCGG - Intronic
1020852693 7:13377129-13377151 TCCCAACTTCTCCCTGGAACAGG - Intergenic
1024026128 7:45411247-45411269 TCCTCACCTCTTCCAGGGTCTGG + Intergenic
1026878803 7:73895079-73895101 TCCCCACAACCCCCAGGGAGGGG + Intergenic
1027239875 7:76320142-76320164 TCCCCACCTCCCCCAGGCATAGG + Intergenic
1029437148 7:100569760-100569782 TCCTCACGTCGCCCAGGAACTGG - Intergenic
1030086033 7:105816573-105816595 TCCCCACAGCCCTCAGGGAAGGG + Intronic
1033877588 7:145842044-145842066 TCCCCAGATGTACCAGGGGCTGG - Intergenic
1034316237 7:150136102-150136124 CCCCTACATCTCCCAGGTAGTGG + Intergenic
1034790621 7:153964559-153964581 CCCCTACATCTCCCAGGTAGTGG - Intronic
1035627673 8:1084531-1084553 TCCCCACATCCCCCAGCCTCGGG + Intergenic
1037730973 8:21523892-21523914 TCCACACATCTCCCAGGGGCTGG - Intergenic
1037882527 8:22579945-22579967 TCCCCACCTCCCCCAGGGGCCGG - Intronic
1039598900 8:38816879-38816901 TCCCCACTCCTTCCAGGGAGGGG - Intronic
1039800469 8:40950245-40950267 GCCCCCCATCTCCCTGGGCCAGG + Intergenic
1042012284 8:64260569-64260591 TCCCCACATCTTCAGGAGACTGG - Intergenic
1042143418 8:65702749-65702771 TCCCCTCATCTCACAGGTAAGGG - Intronic
1042676383 8:71326620-71326642 GCCCCAGCTCTCCCAGGAACAGG - Intronic
1044168156 8:89015029-89015051 TTCCCACATGACCCAGGCACTGG + Intergenic
1045504734 8:102770310-102770332 CACCCACATGTCCCAGGAACGGG - Intergenic
1045505970 8:102779010-102779032 TCCCCTCTCCTCCCAGGGCCTGG - Intergenic
1045670133 8:104541669-104541691 TCCCCACATCCCCTAGCAACAGG + Intronic
1046724072 8:117655533-117655555 TCCCCACAGATCACAGGGAATGG - Intergenic
1049503847 8:142984388-142984410 CCCCCAGATCCCCCAGGGACCGG + Intergenic
1049746713 8:144266179-144266201 TCCTCCCCTCTCCCGGGGACGGG + Intronic
1049979666 9:892523-892545 CCCCCACATGTCCCTGGAACAGG + Intronic
1050222460 9:3408843-3408865 TCACCATCTCTGCCAGGGACGGG - Intronic
1055432475 9:76258041-76258063 TTTCCACAGCTCCCAGGTACAGG + Intronic
1056373255 9:85980337-85980359 ACCCCACAACTTCCAGGGATGGG - Intronic
1057005778 9:91557450-91557472 TCCCTACATCTGCCAGCGACTGG + Intergenic
1057110849 9:92469503-92469525 ACCCCACATCTCTCAGACACAGG + Intronic
1059194149 9:112354980-112355002 CACCCACATCTCCCAAAGACAGG - Intergenic
1059436716 9:114281574-114281596 GCCCCTCCTCTCTCAGGGACTGG - Intronic
1059438060 9:114288399-114288421 TCCCCACATTCCCCAGGAGCAGG + Intronic
1060295302 9:122339149-122339171 TCTCCTCATCTCCCTGGGTCTGG + Intergenic
1060405913 9:123373053-123373075 TCCCCACTTCCCCCAGCGAGTGG - Intronic
1061646620 9:132007942-132007964 TCCCCACAACTTCCAGGGCATGG + Intronic
1061695015 9:132366747-132366769 TCCCCACTTCTCTCAGGCTCTGG + Intergenic
1061758163 9:132830033-132830055 TCCCCACAACCCCCAGCCACCGG - Intronic
1061906997 9:133703974-133703996 TCCTCTCCTCGCCCAGGGACAGG + Intronic
1062178145 9:135175772-135175794 TCCCCACAGCCCCCAGAGCCAGG + Intergenic
1062334314 9:136058327-136058349 TCCCCACGGCTCCCAGTGCCTGG + Intronic
1062362910 9:136195979-136196001 CCCCTGCCTCTCCCAGGGACAGG + Intergenic
1185504307 X:620085-620107 TCCCCCCAACTCCAAGGAACGGG - Intergenic
1186473539 X:9839349-9839371 CACCCACATCTCCCTGGGTCTGG + Intronic
1187484760 X:19693097-19693119 GCCCCACATCCCCATGGGACTGG + Intronic
1189229162 X:39438653-39438675 TCCCCAAAACTCCCAGAGCCCGG - Intergenic
1190107710 X:47571569-47571591 CCCCCTCATCTCCCAGGGTGGGG - Exonic
1190897231 X:54632975-54632997 TTCCCACTTCTCCTAAGGACGGG + Intergenic
1192161179 X:68789074-68789096 TCCCCACTGTTCCCATGGACAGG - Intergenic
1199571379 X:149270299-149270321 CCCCCACATGTCCCAGGCACAGG + Intergenic
1200115731 X:153768953-153768975 TCTCCACGGCTCCCAGGGCCAGG + Exonic
1200143712 X:153914764-153914786 GCCCCACCTCTTCCAGGGAAAGG + Intronic
1200256026 X:154583975-154583997 TCCCCACCTTTCCCAGCGTCTGG + Intergenic
1200261743 X:154620428-154620450 TCCCCACCTTTCCCAGCGTCTGG - Intergenic