ID: 916203626

View in Genome Browser
Species Human (GRCh38)
Location 1:162294960-162294982
Sequence CAGCAGCAGCAGCAGTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1133
Summary {0: 1, 1: 3, 2: 25, 3: 189, 4: 915}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916203626_916203628 -2 Left 916203626 1:162294960-162294982 CCTCACCACTGCTGCTGCTGCTG 0: 1
1: 3
2: 25
3: 189
4: 915
Right 916203628 1:162294981-162295003 TGCTAGTGCTCCTGCTCCAGCGG 0: 1
1: 0
2: 0
3: 29
4: 203
916203626_916203629 -1 Left 916203626 1:162294960-162294982 CCTCACCACTGCTGCTGCTGCTG 0: 1
1: 3
2: 25
3: 189
4: 915
Right 916203629 1:162294982-162295004 GCTAGTGCTCCTGCTCCAGCGGG 0: 1
1: 0
2: 3
3: 28
4: 209
916203626_916203635 28 Left 916203626 1:162294960-162294982 CCTCACCACTGCTGCTGCTGCTG 0: 1
1: 3
2: 25
3: 189
4: 915
Right 916203635 1:162295011-162295033 GCCTGAGCCTGGACTCATAGTGG 0: 1
1: 0
2: 0
3: 10
4: 130
916203626_916203632 17 Left 916203626 1:162294960-162294982 CCTCACCACTGCTGCTGCTGCTG 0: 1
1: 3
2: 25
3: 189
4: 915
Right 916203632 1:162295000-162295022 GCGGGAGCCCTGCCTGAGCCTGG 0: 1
1: 0
2: 5
3: 138
4: 1837

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916203626 Original CRISPR CAGCAGCAGCAGCAGTGGTG AGG (reversed) Intronic
900237557 1:1599986-1600008 CAGCAGCAGCAGCAGCGGCGGGG + Exonic
900749768 1:4387964-4387986 CTGGAGCAGCATGAGTGGTGGGG + Intergenic
900895297 1:5479109-5479131 CAGCAGCAGCAGCACAGGCAGGG - Intergenic
901261605 1:7875665-7875687 AAGCAGTAGCAGCAGTGGGTGGG - Intergenic
901283953 1:8061495-8061517 TAGCAGCAGCAGCTGAGGAGTGG - Intergenic
901437454 1:9256434-9256456 CGACAGCAGCACCAGTGTTGGGG - Intronic
901658702 1:10785571-10785593 CAGGAGGAGAAGCAGAGGTGGGG - Intronic
901818010 1:11805926-11805948 CTGCAGCGGCCACAGTGGTGCGG - Intronic
902490109 1:16775348-16775370 CAGAAGCAGCAGGAGGGGCGTGG + Intronic
902504481 1:16930331-16930353 GAGGAGGAGCAGCAGAGGTGAGG + Exonic
902597024 1:17516526-17516548 CAGCAGCAGCAGCAGAGGTCAGG - Intergenic
902776381 1:18677281-18677303 CAGCAACTGCCCCAGTGGTGGGG + Intronic
903192105 1:21662642-21662664 CAGGGGCAGGAGCAGGGGTGGGG - Intronic
903302043 1:22386129-22386151 CATCATCAGCAGCAGGGGTGTGG - Intergenic
903349849 1:22711005-22711027 CAGCGGCAGCAGCAGCAGCGCGG - Exonic
903544692 1:24116639-24116661 CAGCACCAGCAGGGGAGGTGGGG + Intergenic
904110666 1:28123604-28123626 CAACAGGAGCAGCAGTGGAGGGG + Intergenic
904264005 1:29307382-29307404 GAGCAGGGGCAGCAGTGTTGGGG + Intronic
904810308 1:33159473-33159495 GAGGAGCAGCAGCAATGGTGAGG - Intronic
904810444 1:33160178-33160200 GAGGAGCAGCAGCAATGGTGAGG + Intronic
904927880 1:34062720-34062742 CACCAGCAGAAGCAAGGGTGTGG - Intronic
905101817 1:35530938-35530960 CAACAGCAGCAGCAGTGCGCAGG + Intronic
905501791 1:38445390-38445412 CAGCAGTGGCAGCAGTGTGGTGG - Intergenic
905805730 1:40875904-40875926 CAGCAGCAGCAGCAATGTGGAGG - Intergenic
905805731 1:40875907-40875929 CAGCAGCAGCAGCAGCAATGTGG - Intergenic
906150394 1:43584116-43584138 CAACCCCAGCATCAGTGGTGGGG - Intronic
906184417 1:43850810-43850832 CAGCAACCCCAGCAATGGTGTGG + Intronic
906191206 1:43900540-43900562 CACCAGCAGCCCCAGGGGTGGGG + Intronic
906199975 1:43953670-43953692 AAGCAGCAGCAGCTGTGGAGGGG - Intronic
906573109 1:46861966-46861988 CAACAGCAGCAGCAGCTGTTGGG - Intergenic
906598762 1:47105199-47105221 CAGCCACAGCAGCTGTGGTGGGG + Intronic
906964084 1:50439613-50439635 CAGGAACAGCAGCAGGGGTGTGG - Exonic
907387637 1:54136349-54136371 AAGCAGCAGCAGCTGGGGTTAGG + Intronic
907488075 1:54790758-54790780 CAGCAGCAGCAGCAGCAGCCAGG - Intronic
907534500 1:55137544-55137566 CTCCAGCAGCAGCAGCAGTGGGG - Exonic
908595178 1:65681029-65681051 CATCAGCAGGAGCAGGGGTTGGG + Intergenic
908825979 1:68133064-68133086 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
908854110 1:68405321-68405343 CAGCAGCAGCAGCAGCAATACGG + Intergenic
908861434 1:68494588-68494610 CAGCAGGAGAAGCAGTGGATTGG - Exonic
908930840 1:69314881-69314903 CAGTAGTGGCAGCAGTGGGGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
909610162 1:77543020-77543042 CTGCAGCAGCAGAATTGCTGAGG - Intronic
909806150 1:79875925-79875947 CTGCAGCTGCAGTAGTGGAGAGG - Intergenic
910101663 1:83583792-83583814 CAGCTGCAGCAGGGGAGGTGTGG - Intergenic
911361068 1:96877038-96877060 CAGCATTAGTTGCAGTGGTGAGG - Intergenic
912318976 1:108692661-108692683 CAGCAACAGCAGCAGTGCGGCGG + Exonic
912515030 1:110211748-110211770 CAGCGGCAGCAGCGGCGGCGGGG + Exonic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
912638179 1:111318612-111318634 CAGGACCAGCACCAGAGGTGGGG - Exonic
913032409 1:114922499-114922521 AAGCAGGAGCAAGAGTGGTGGGG + Intronic
913182633 1:116336923-116336945 CAGTGACAGCAGCAGTGGTGGGG + Intergenic
913250992 1:116911448-116911470 CATCAGCAGCAGGAGTCATGGGG - Intronic
914513704 1:148355486-148355508 CAGCAACAACAGCAGTGTTCTGG - Intergenic
915325331 1:155078982-155079004 CAGCAGCGGCAGCAGCGGCACGG - Exonic
915354901 1:155250319-155250341 TGGCAGCAGCAGCGGTGGTGGGG + Exonic
915368120 1:155326649-155326671 CAGCAGGAGCAGCAGCTCTGTGG - Exonic
915396983 1:155592478-155592500 CAGCAGAAGCAGCAATGCTTGGG - Intergenic
915427067 1:155835709-155835731 CAGCCGCAGCAGCAGACCTGCGG - Intronic
915457611 1:156051164-156051186 AAGCCGGAGGAGCAGTGGTGGGG - Exonic
915690901 1:157689834-157689856 CAGCAGCAGCAGCAAGGACGAGG + Exonic
916028450 1:160855694-160855716 CAGTAGCAACAGCAGTGGCAGGG - Intronic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
916568033 1:165998728-165998750 AAGCAGCAGCAGTAGTGATGTGG + Intergenic
916787571 1:168097553-168097575 CAGCAGCAGCAGAATTGATCTGG - Intronic
917820237 1:178755340-178755362 CACCACCAGCAGGAGTAGTGAGG - Intronic
918243742 1:182641666-182641688 CATCAGGAGAAGCAGGGGTGTGG - Intergenic
918966569 1:191357552-191357574 AAACAGCAGCAGCAGTTGAGTGG - Intergenic
919338177 1:196266948-196266970 CAGCAGCAGGAGCATTTTTGTGG - Intronic
919477035 1:198041822-198041844 CAGCAACAGCAACACAGGTGTGG + Intergenic
920084209 1:203403125-203403147 CCACAGCAGAAGCAGTGCTGTGG + Intergenic
920131221 1:203733357-203733379 CAGCAGGAACAGAAGTGGTGGGG - Intronic
920346113 1:205306734-205306756 TAGCAGCTGCAGGAGAGGTGGGG - Intronic
920533333 1:206721179-206721201 GAGCAGGAGCAACAGGGGTGGGG - Intronic
920798499 1:209163756-209163778 CAGAAACAGCAAAAGTGGTGGGG - Intergenic
920866606 1:209758680-209758702 GAGAAGCAGCAGCAGCTGTGAGG + Exonic
920866609 1:209758683-209758705 AAGCAGCAGCAGCTGTGAGGGGG + Exonic
920876244 1:209838877-209838899 CAGCAACAGCAGCCTTAGTGGGG - Intronic
921739257 1:218665365-218665387 CAGCAACAGCAGCTGAGCTGTGG + Intergenic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
921767057 1:218984022-218984044 CAGCTGCAGCAGGGGAGGTGTGG - Intergenic
922208234 1:223467465-223467487 CTGTGGCAGCAGCAGTGGAGAGG + Intergenic
922219838 1:223550189-223550211 CTGCAGGAGCAAGAGTGGTGTGG + Intronic
922344724 1:224686987-224687009 CTGCAGCAGAGGCAGTGGCGTGG - Intronic
922466269 1:225847131-225847153 CAGCAGCAGCAGCAGACCTATGG - Exonic
922481841 1:225944769-225944791 AAGCAGCAGCAGCAGGGGCCTGG - Intergenic
922872321 1:228912839-228912861 CAGCAGCAGCAGCTATGTGGAGG - Intergenic
922872322 1:228912842-228912864 CAGCAGCAGCAGCAGCTATGTGG - Intergenic
922947669 1:229530878-229530900 CAGCAGCCGCAGAACTGGAGGGG + Intronic
923097013 1:230783506-230783528 CAAAAGCAGGAGCAGGGGTGGGG - Intronic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923530328 1:234807182-234807204 CAGAAGCAGCAGGAGGGGCGTGG - Intergenic
924218307 1:241848030-241848052 CAGCAGCGGCTGCAGTCGTATGG + Intronic
924458129 1:244234421-244234443 CAGCAGCAGCAGCAGCAGCCAGG - Intergenic
924922512 1:248645509-248645531 ACACAGGAGCAGCAGTGGTGAGG + Intergenic
1062800869 10:379269-379291 CAGCAGCAGCCCTAGTGATGGGG - Intronic
1064103039 10:12479519-12479541 CGGCAGCAGCAGCACTGCTGGGG - Intronic
1064419569 10:15179261-15179283 CAGCAGCAGCAGTATCTGTGAGG - Intergenic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1066290854 10:34013203-34013225 CAGCTGCAGGAGCAGGGGTCTGG - Intergenic
1067455021 10:46413022-46413044 CAGCAGAAACAGCAGAGGTGGGG - Intergenic
1067560354 10:47300686-47300708 CAGCAGCAGCAGCTGGGGCCCGG - Exonic
1067560356 10:47300692-47300714 CAGCAGCAGCAGCAGCAGCTGGG - Exonic
1067632183 10:47971612-47971634 CAGCAGAAACAGCAGAGGTGGGG + Intergenic
1067691193 10:48503486-48503508 TAGCCGCAGCAGCAGGTGTGGGG - Intronic
1067761837 10:49054357-49054379 GAGCAGCTGCAACAGTGCTGTGG - Intronic
1068053533 10:51982804-51982826 CAGCAGCAGCAGCAGTGTAGTGG + Intronic
1068657594 10:59591347-59591369 CAGCAGCAGCAGCAGCCATATGG - Intergenic
1069092757 10:64222307-64222329 CAGAAGCTGCAGCATAGGTGAGG - Intergenic
1069900662 10:71704994-71705016 CATCAACAGCAGCAGCGGCGTGG + Intronic
1069916563 10:71790397-71790419 CATCAACAGCAGCACCGGTGAGG + Intronic
1069921388 10:71817883-71817905 CAGCAGCAGAACCAGCTGTGGGG + Intronic
1069921389 10:71817886-71817908 CAGCAGAACCAGCTGTGGGGTGG + Intronic
1070436838 10:76401933-76401955 CAGCTGTGGCAGCAGAGGTGGGG + Intronic
1070459724 10:76652288-76652310 TATCAGCACCAGCAGTAGTGAGG - Intergenic
1070816653 10:79328653-79328675 CTGTGGCAGCAGCAGAGGTGGGG - Intergenic
1071086739 10:81874975-81874997 CAGCAGCAGCAGCGGGCGCGGGG + Intergenic
1071414002 10:85424091-85424113 CAGCAGCAGCAGCAATGAAAGGG + Intergenic
1071424190 10:85531913-85531935 CACCAGCAGCCTCAGGGGTGAGG - Intergenic
1071588204 10:86846061-86846083 CAGGACCAGCTGCAGTGGTAGGG - Intronic
1072096022 10:92180785-92180807 CAGCAGCATCAGCATTGCTTGGG - Intronic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1072733748 10:97865655-97865677 CAGTGGCAGCAGCAGCGGTGGGG + Exonic
1073860358 10:107731911-107731933 CAGTAACAGCAACAGGGGTGGGG + Intergenic
1074062318 10:109978099-109978121 CAGCAGCAGCCACAGGGCTGGGG - Intergenic
1074722673 10:116276182-116276204 CATAAGCAGCAGCAGTACTGGGG + Intergenic
1075092443 10:119451163-119451185 CAGCAGCCCCGACAGTGGTGTGG - Intronic
1075164148 10:120051835-120051857 AAGCAGCAGGAGCAGGTGTGGGG + Intergenic
1075233933 10:120709660-120709682 AAGCACCAGCAGCTGTAGTGAGG - Intergenic
1075468471 10:122670323-122670345 CATCAGCAGCAGCTCTGGTGTGG + Intergenic
1075534432 10:123258116-123258138 CAGCTGGAGCAGCAGCGGCGAGG - Intergenic
1076092803 10:127702906-127702928 CTGCAGGCACAGCAGTGGTGTGG - Intergenic
1076214754 10:128684510-128684532 CTGCAGCTGAAGCAGTGGTAAGG + Intergenic
1076331794 10:129675704-129675726 CAGCAGCAGCAGTGGGTGTGTGG - Intronic
1076587668 10:131560428-131560450 CAGCAACAGCCGCAGGGTTGAGG - Intergenic
1076624935 10:131815973-131815995 GAGCAGCAGCACCTGTGGAGAGG + Intergenic
1076921977 10:133459034-133459056 CAACGGCAGCAGCAGCTGTGAGG + Intergenic
1077063350 11:627114-627136 CAGCAGCAGCAGGAGGGGCCGGG + Exonic
1077195557 11:1278271-1278293 CAGCAGCTGCAGCAGTGCAAGGG + Intronic
1077214122 11:1388296-1388318 CAGCAGCAGCAGCGGGGGAAAGG + Intergenic
1077359410 11:2134091-2134113 CAGCAGCTCCAGGGGTGGTGTGG - Intronic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077439377 11:2560853-2560875 CAGCAGAGGCAGCAGTGGATGGG + Intronic
1077708592 11:4513160-4513182 CAACAGTAGCACCAGTGCTGAGG - Intergenic
1077919132 11:6630258-6630280 CAGCAGCAGCAGCGCGGGAGTGG + Exonic
1077976914 11:7256292-7256314 CAGCAGCAGCAGCAGCTGCTGGG + Intronic
1078074796 11:8148794-8148816 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1078148449 11:8738599-8738621 TAGCAGTAGCAGCAGGGATGGGG - Intronic
1078319642 11:10322644-10322666 AAGCTGCAGCAGCTGTGGGGTGG + Intronic
1079141959 11:17817041-17817063 CAACACCAGCAGCAGAGGAGAGG - Intronic
1079620064 11:22543135-22543157 AAGCTGCAGCAGCAGAAGTGAGG + Intergenic
1080540201 11:33257672-33257694 CAGCAGCAGCAGCAGCGGTCGGG + Exonic
1081662279 11:44895467-44895489 CTGCAGAAGCATCAGTGATGGGG + Intronic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1081812823 11:45922917-45922939 CAGCAGCAGCAACAGCGCGGCGG - Exonic
1081812824 11:45922920-45922942 CAGCAGCAGCAGCAACAGCGCGG - Exonic
1083169031 11:60911362-60911384 CAGCAACAGCAGCTTTGGTCTGG - Intergenic
1083393284 11:62371277-62371299 CAGCAGCAGCAGCGGCGACGAGG + Intronic
1083651527 11:64207351-64207373 CAGCAGCCGCAGCCATGGCGGGG + Exonic
1083729065 11:64643300-64643322 CGGCAGCGGCAGCAGCGGCGCGG - Intronic
1083812272 11:65112518-65112540 CAGCAGCAGTAGCAGAGCCGCGG - Exonic
1083926633 11:65811200-65811222 AAGATGCAGCAGCAGTGCTGAGG - Intergenic
1084086581 11:66857749-66857771 CAGCAGCAGCAGGAGCGGCGGGG - Exonic
1084144629 11:67258159-67258181 CAGCAGCAGCAGCAGAACTAGGG + Intergenic
1084444709 11:69196863-69196885 CCGGAGCAGGAGGAGTGGTGGGG + Intergenic
1084472500 11:69371260-69371282 CAGGAAAAGAAGCAGTGGTGGGG + Intergenic
1084697038 11:70761915-70761937 CAGCAGCAGCAGCAGCAGCCGGG - Intronic
1084942411 11:72620069-72620091 CAGGAGCTCCAGCAGAGGTGGGG - Intronic
1085401551 11:76238810-76238832 CAGCAGCAGCAGCTTCTGTGGGG - Intergenic
1085751489 11:79166123-79166145 CACCGCCAGCAGCAGTGTTGTGG + Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086486915 11:87315120-87315142 AAGCAGTAGCAGCAGTAGTAGGG - Intronic
1087392058 11:97548443-97548465 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1087443014 11:98208815-98208837 CAGCTGCAGCAGGAGAGGTGCGG - Intergenic
1087448829 11:98291616-98291638 CAGCAATAGCAGCAGTAGTTTGG + Intergenic
1087804958 11:102545507-102545529 CAGCCGCAGCAGCAGAGGCTAGG + Intergenic
1088401267 11:109423951-109423973 CAGCGGCAGCCGCGGTGGCGGGG + Exonic
1088647140 11:111926476-111926498 GAGCAGGAGCAACAATGGTGGGG - Exonic
1088832941 11:113553372-113553394 CAAGAGCAGCAGGATTGGTGTGG + Intergenic
1089066685 11:115667337-115667359 CACCAGCGGCAGCCGTGGTATGG + Intergenic
1090105573 11:123851314-123851336 CAGCAGCAGCAGCTGTGTTGGGG + Intergenic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090290113 11:125535946-125535968 TGGAAGCAGAAGCAGTGGTGGGG - Intergenic
1090840075 11:130479657-130479679 CTACAGCAGCAGCAGTGGGAAGG - Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091219318 11:133920793-133920815 CAGCAGCAGCAGCCCTGGGGAGG - Exonic
1091259434 11:134223286-134223308 CAGCAGCATCAGGAATGGAGCGG + Intronic
1091293232 11:134454106-134454128 CAGCAGCAGCAGCAGAAGCAGGG - Intergenic
1091326949 11:134698345-134698367 CAGCACCATCAGCAGTGGCTGGG + Intergenic
1093465022 12:19440029-19440051 CAGCAGCAGCGGCGGGGGTGAGG + Exonic
1093465045 12:19440134-19440156 CAGCAGCAGCAGCGGGGATGGGG + Exonic
1093492884 12:19725298-19725320 CAGCAGCTACTGCAGTGGGGTGG + Intergenic
1094523407 12:31216163-31216185 AAGCAGCAGCAGCAGTGAGGTGG - Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1094783267 12:33817920-33817942 CAGCAACTGCAGCAGTGTGGTGG + Intergenic
1095133515 12:38571234-38571256 GCCCAGCAGCAGCAGAGGTGTGG + Intergenic
1095212462 12:39509976-39509998 TGGCAGCAGCAGCAGTGGGTAGG - Intergenic
1095262698 12:40115571-40115593 TAGCAGCAGCAGTTGTAGTGGGG + Intergenic
1095726387 12:45457837-45457859 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1095879223 12:47114599-47114621 CAGTAGCAGAAGTAGTGGGGAGG - Intronic
1095879224 12:47114602-47114624 AAGCAGTAGCAGAAGTAGTGGGG - Intronic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096258005 12:50074439-50074461 CAGGAAAAGCAGCACTGGTGTGG - Intronic
1096522431 12:52191851-52191873 CAGCAGCCTCAGCAGCTGTGAGG - Exonic
1096581146 12:52586146-52586168 CATCAGCAGCACCAATGCTGGGG - Exonic
1096658641 12:53107256-53107278 CACCAAAAGCAGCAGTGGAGTGG + Intronic
1096664558 12:53154540-53154562 GAGGAGCAGCAGGAGTGGGGAGG + Intergenic
1096782549 12:53999536-53999558 CAGGAGCAGCAGGGGCGGTGAGG - Intronic
1096863838 12:54549625-54549647 CGGCAGCAGCAGCGGCGGTGCGG + Exonic
1096872710 12:54604138-54604160 CACAAGCAGCAGCAGAAGTGTGG + Intergenic
1097009000 12:55939271-55939293 CAGCAGCACTAGCAGTGGCACGG - Exonic
1097043323 12:56169558-56169580 CGGCGGCAGCAGCGGTGGAGAGG + Exonic
1097053066 12:56235205-56235227 CCGCAGCAGCAGCAGGGATAGGG - Exonic
1097140617 12:56899970-56899992 CAGGAGCAGCAGTGGTGGTGGGG + Intergenic
1097141699 12:56908132-56908154 TAGCAGCAGCAGTGGTGGTGAGG + Intergenic
1097173274 12:57128972-57128994 CAGCAGCAGGAGCAACGGCGGGG - Exonic
1097195676 12:57241364-57241386 CCCCACCAGCAGCAGTGTTGGGG - Intergenic
1098394824 12:70006322-70006344 GAGTAGCAGCAGCTGTGCTGTGG - Intergenic
1098404519 12:70109478-70109500 CAGCAGTAGCAACAGTGGTCTGG - Intergenic
1098949847 12:76628523-76628545 CAGCTGCAGTGGCAGTGGTCAGG + Intergenic
1099113158 12:78587344-78587366 CAGCAGGGGCAGCAGTGGGCAGG + Intergenic
1100266244 12:92978919-92978941 CAGCAGCAGTGGCACAGGTGGGG - Intergenic
1100559033 12:95728922-95728944 CAGGAGCAGCAGCAAGGGTAGGG - Intronic
1101007436 12:100414903-100414925 CTGCAGCAGCAGCAGCTCTGGGG - Intronic
1101044829 12:100794426-100794448 CATTAACAGCAGCAGTGGAGAGG + Intronic
1101510590 12:105389291-105389313 CGGCAGCAGCAGCAACAGTGGGG - Intronic
1102006300 12:109591163-109591185 CAGCTGCCCCAGCAGTGGGGTGG - Intronic
1102487154 12:113266283-113266305 CAGCAGCAGCAGCAGGGCCGTGG - Exonic
1102491202 12:113290550-113290572 CAGCTGCAGCAGCAGTGGTGTGG - Intronic
1102568346 12:113811912-113811934 CAGCAGCTGCCCCAGTGCTGGGG - Intergenic
1102965029 12:117119130-117119152 CAGCAGCAGCAGCAGCTTGGAGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103506205 12:121443576-121443598 CAGGAGAGGCAGCAGTGGGGTGG + Intronic
1103840911 12:123863537-123863559 CACCAGAAGCAGAAGAGGTGAGG - Intronic
1103908674 12:124340166-124340188 CGGCAGCAGCGGCGGGGGTGGGG - Exonic
1103908678 12:124340172-124340194 GAGCAGCGGCAGCAGCGGCGGGG - Exonic
1104021248 12:124993828-124993850 CAGCAGCAGCAGCAGGAGCCCGG - Exonic
1104873982 12:132020133-132020155 GAGCAGCAGAGGCCGTGGTGGGG - Exonic
1104958492 12:132477203-132477225 CAGCAGCTGCAGCAGGGCTGGGG - Intergenic
1105745507 13:23373968-23373990 CTGGAGCAGCGGCAGTGGAGGGG - Intronic
1106109287 13:26762187-26762209 CAGCAGCAGCAGCATCACTGGGG - Intergenic
1106664908 13:31841655-31841677 CAGCAGCAACAGACCTGGTGTGG + Intergenic
1106995557 13:35476295-35476317 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1107065728 13:36213041-36213063 CAGCAGCAGCTGCAGGGCTGAGG + Intronic
1107115320 13:36740373-36740395 CAGCAGAAGAAGCAGCGATGAGG - Intergenic
1107276712 13:38687427-38687449 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1107404432 13:40099312-40099334 CAGCAGCAACAGCAGCAGTTTGG + Intergenic
1107645725 13:42492505-42492527 CAGCAGCAACAGCATTGCTTGGG + Intergenic
1107862216 13:44671679-44671701 CCGCAGGAGCAGCAGGGCTGGGG - Intergenic
1107899255 13:44995822-44995844 CAGCAGCAGCAGCAGCAGCTGGG - Intronic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109523609 13:63545317-63545339 CAGCAGGAGCAACAGTGATTGGG - Intergenic
1109603462 13:64662630-64662652 CAGCTGCAGCAGGGGAGGTGGGG + Intergenic
1110273498 13:73617139-73617161 GGGCAGCAGCAGCTGCGGTGTGG - Intergenic
1110630146 13:77698077-77698099 CAGCAGCAGCAGGTGCGGGGCGG - Intronic
1110630147 13:77698080-77698102 CGGCAGCAGCAGCAGGTGCGGGG - Intronic
1111186601 13:84745133-84745155 CATAAGCAGCAGCAAAGGTGGGG + Intergenic
1111833766 13:93361758-93361780 CAGGAACAGCAGTAGTGGTTAGG + Intronic
1111986488 13:95071290-95071312 CAGAAGCTGCAGCAGTGGAGGGG + Intronic
1112391922 13:98992820-98992842 CAGCAGCATCAGGAGAGCTGTGG - Intronic
1112394464 13:99016032-99016054 CAGCAGCATCTGCAGCAGTGTGG - Intronic
1112507845 13:99985553-99985575 CGGCGGCAGCGGCAGTGGCGGGG + Exonic
1112554842 13:100457467-100457489 TTACAGCAGCAGCAGTGGTCAGG + Intronic
1112558479 13:100491051-100491073 CAGCAGCAGCAGCAGCATTCAGG - Intronic
1112870719 13:103967755-103967777 TAGAAGCAGTAGCAATGGTGAGG + Intergenic
1113301211 13:109021473-109021495 CAGCAGAAGCAGCAGCAGTGTGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113853408 13:113430793-113430815 CAGCAGCAGTAGGGATGGTGTGG + Intronic
1114024424 14:18511968-18511990 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1114272198 14:21107705-21107727 CAGCAGCAGCAGCCCAGGTCAGG - Intergenic
1115472166 14:33779243-33779265 AAGCAGGAGCATCAGTGGTGTGG + Intronic
1115713572 14:36076884-36076906 CAGCAGCAGCAACAGTGGGATGG - Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1117232633 14:53736915-53736937 CTGCCACAACAGCAGTGGTGAGG - Intergenic
1117638825 14:57775300-57775322 CAGCAGTGGCAGCAGCAGTGTGG - Intronic
1118038797 14:61895662-61895684 CAGCAGCAGCATCAGTGGTGTGG - Intergenic
1118071531 14:62251299-62251321 AAGGAGGAGCAGAAGTGGTGTGG - Intergenic
1118378565 14:65198696-65198718 GAGCAGCAGCATCAGTTTTGGGG + Intergenic
1119395168 14:74320924-74320946 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119775187 14:77243908-77243930 AATCAGCAGCAGAAGTGGTGTGG - Intronic
1119932862 14:78564977-78564999 CAGCAGCAGCAGCACTCATTTGG + Intronic
1119989844 14:79184001-79184023 CAGCCACAACAGCAGAGGTGGGG + Intronic
1120185876 14:81393417-81393439 CAGCAGCAGCAGGAAGAGTGAGG + Intronic
1120788834 14:88561219-88561241 CAGCAGAAGCAGGAGTTGTGGGG - Intergenic
1121195847 14:92071009-92071031 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1121262631 14:92577515-92577537 CGGCAGCAGCAGCAGCAGAGAGG + Intronic
1121459696 14:94065469-94065491 CGGGAGCAGCATCAGTGGTTAGG - Intronic
1121492956 14:94372848-94372870 CGGCAGAAGCAGCAGAGGTGAGG - Intergenic
1121563833 14:94894057-94894079 CAGCTGCAGCTGCAGCGGTATGG - Intergenic
1121784676 14:96648803-96648825 CAGCAGTGGCAGCAGTGGGCAGG + Intergenic
1121874635 14:97440136-97440158 CAGCAGCAGCAGCAGTCATGTGG + Intergenic
1122011077 14:98748248-98748270 CAGTAGCATTAGCAGTGCTGTGG - Intergenic
1122151015 14:99726285-99726307 CAGGAGTAGCTGCAGGGGTGGGG + Intronic
1122370395 14:101226164-101226186 GCACAGCAGCAGCAGGGGTGAGG + Intergenic
1122488526 14:102097490-102097512 GAACAGGAGCAGCAGTGGAGGGG - Intronic
1122716741 14:103700688-103700710 CGACAGCAGCAGCAGTGGCCTGG + Intronic
1122975269 14:105168370-105168392 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1123030014 14:105447158-105447180 CCGCTGGAGAAGCAGTGGTGGGG + Intronic
1123579430 15:21703251-21703273 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1123616057 15:22145762-22145784 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1124125789 15:26937312-26937334 CATCAGCACCAGCACAGGTGAGG + Exonic
1124257216 15:28153957-28153979 CAGCAGGGGCAGCTGTGTTGGGG - Intronic
1124685534 15:31778574-31778596 CAGCACCTGCAGCATTGGAGTGG - Intronic
1125241462 15:37582027-37582049 CAGCTGCAGCCGCAGCTGTGTGG - Intergenic
1125449857 15:39796874-39796896 CAGCACCTGGAGCAGGGGTGCGG - Intergenic
1125522960 15:40358342-40358364 CAGCAGCGGCGGCAGCGGTCCGG + Exonic
1125882157 15:43204321-43204343 CAGCAGCAGCAGCATTTAGGGGG - Intronic
1125882160 15:43204324-43204346 CAGCAGCAGCAGCAGCATTTAGG - Intronic
1125933958 15:43618681-43618703 CAGCAGCAGCAGCAGCAGCAGGG + Exonic
1125947055 15:43718143-43718165 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1125965582 15:43873170-43873192 CAACAGCAGCATCAGGGGTGGGG - Exonic
1126144107 15:45461349-45461371 CAGGAGCAGCAGCTGTGACGGGG - Intergenic
1126895863 15:53256642-53256664 CAGAAGCAAGAACAGTGGTGTGG + Intergenic
1127474076 15:59315772-59315794 CAGCAACAGCAGCAGCATTGGGG - Intronic
1127574122 15:60273450-60273472 CAAGCGCAGAAGCAGTGGTGGGG - Intergenic
1127884506 15:63187839-63187861 CAGCAGCAGCAGCAGCCCTCTGG + Intergenic
1127932116 15:63603794-63603816 CACCACCAGCTGCAGTGGAGTGG + Intergenic
1128554746 15:68623696-68623718 CAGGAGCAGCAGCAGCGGGTGGG + Intronic
1128655144 15:69455265-69455287 CTGGAGCAGCAGCAGTGGAGGGG - Exonic
1129070454 15:72946291-72946313 TGGCAGCAGCAGCAGTGGGCAGG - Intergenic
1129188531 15:73924748-73924770 CAGCTGCTGCAGCAGAGGAGGGG - Intergenic
1129276110 15:74446327-74446349 CAGCATCAGCAGCTTTGCTGAGG - Intronic
1129564988 15:76612209-76612231 CAGCAGCAGCAGCAGCTTTTTGG - Intronic
1130113914 15:80989723-80989745 CAGCAGCAGCAGCAGGTCAGAGG + Exonic
1130398675 15:83529313-83529335 CAGCAGTGGCAGCAGTGGGCTGG + Intronic
1130410119 15:83640051-83640073 CTGCAGCAGCAACAGTCTTGTGG + Intergenic
1130989535 15:88868066-88868088 CAGCAGCAGCAACAGTTCTCAGG + Intronic
1131027681 15:89158539-89158561 CAGCATCAGTGGCAGTGCTGGGG - Intronic
1131466054 15:92655615-92655637 CAGCAGCAGCGGCAGGAGCGGGG + Exonic
1131466055 15:92655618-92655640 CAGCAGCGGCAGGAGCGGGGCGG + Exonic
1132213918 15:100048790-100048812 CGGCAGCACCATCAGTGGTGGGG - Intronic
1202988300 15_KI270727v1_random:437496-437518 CAGGTGCAGCAGCAGGAGTGAGG + Intergenic
1132592418 16:731721-731743 CAGCAGCCCCAGCTGTGCTGAGG - Intronic
1132681306 16:1143187-1143209 CAGCAGCAGTGGCAGTGAGGGGG - Intergenic
1132712744 16:1276712-1276734 CAGCAGCAGCAGCAGCTGCGGGG + Intergenic
1132728572 16:1349517-1349539 CAGCAGCAGCTGCTGTGAAGAGG - Exonic
1132747519 16:1443184-1443206 AAGCAGCGGCAGGTGTGGTGGGG - Intronic
1132845501 16:1999242-1999264 CCACACCAGCAGCAGTGGTGTGG - Intronic
1133103398 16:3492580-3492602 CAGCAGCAGAGGCAGGGATGTGG - Intergenic
1133111391 16:3550133-3550155 CAGCTGCAGCAGCTTTGGTAGGG - Intronic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1133288418 16:4702102-4702124 CAGCAGCAGCAGCAGCAGTCGGG - Exonic
1133464855 16:6019497-6019519 CAGCAGCACCCGCGGTGGGGCGG + Intronic
1133507780 16:6429313-6429335 ACCCTGCAGCAGCAGTGGTGGGG - Intronic
1133563589 16:6971890-6971912 CATCAGCAGCCTCAGTGGGGTGG + Intronic
1134213437 16:12297164-12297186 CACCAGCAGCTGCACTGGGGCGG + Intronic
1134388351 16:13795099-13795121 CTGCAGCAGGGGCAGTGGCGGGG + Intergenic
1134592209 16:15463738-15463760 CAGCAGCAGGAGCTGGGGTGGGG - Intronic
1134609625 16:15598040-15598062 AAGCAGCACCAGCAGTGGGGAGG + Intronic
1134668337 16:16036374-16036396 GAGCAGCATCAGCAGGCGTGTGG + Intronic
1135994516 16:27238121-27238143 CAGCAGCAACAGAGGTGGCGTGG + Intronic
1136019336 16:27430088-27430110 CAGCAGCAGGAGCAAGGGGGCGG - Exonic
1136033869 16:27523815-27523837 CAGCCGCAGCAGCAGAGAGGTGG + Intronic
1136296586 16:29307489-29307511 CAGCAGCATCAGCAGTGGCAGGG - Intergenic
1136406468 16:30050793-30050815 CAGGAGCAGCAGCTGTGGTGAGG + Intronic
1136524531 16:30820683-30820705 AGGCAGCAGCAGCAGTGATGGGG + Intergenic
1136550464 16:30979920-30979942 CAGCAGCAGCAGCAGCGATGGGG + Exonic
1136550465 16:30979923-30979945 CAGCAGCAGCAGCGATGGGGAGG + Exonic
1137655249 16:50153524-50153546 CAGCAGCAGCAGCCGAGGCCGGG + Intronic
1137655305 16:50153771-50153793 CAGCAGCAGCAGCAGCAGCACGG + Exonic
1138548968 16:57736697-57736719 GTGCAGCAGCCGCAGTGGGGCGG - Intronic
1139099187 16:63744634-63744656 CAGCAGCAGCAGCAGGGTCAGGG - Intergenic
1139347963 16:66316642-66316664 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1139386014 16:66571728-66571750 CAGCACCATCAGCTGTGGTCAGG + Intronic
1139447461 16:67006666-67006688 CAGCAGAAGCAGCAGGAGTAGGG + Intronic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1139878221 16:70163506-70163528 CTGCCACAGCAGCAGTGGTGGGG - Intergenic
1139951516 16:70674500-70674522 CAGCAGCAGTAGCAGTGCCAAGG - Exonic
1140359342 16:74331306-74331328 CTGCCACAGCAGCAGTGGTGGGG + Intergenic
1140392867 16:74603114-74603136 CAGCAGCAGCAGCAGCAGCCAGG + Intronic
1140470135 16:75209225-75209247 GTGCAGCTGCAGCAGTGGTCGGG + Intergenic
1141071138 16:80955324-80955346 CAGCAGCAGCAGCAGCGTAGTGG - Intergenic
1141393728 16:83686164-83686186 CAGCAGTAGGCGCAGTGGTACGG - Intronic
1141622999 16:85247055-85247077 GAGCAGCAGCAGCAGCCCTGGGG - Intergenic
1141989611 16:87602570-87602592 CAGCAGCAGCAGCAATGCGGCGG - Intronic
1141989612 16:87602573-87602595 CGGCAGCAGCAGCAGCAATGCGG - Intronic
1142058208 16:88013800-88013822 CAGCAGCATTAGCAGTGGCAGGG - Intronic
1142518533 17:489592-489614 CGGCAGCAGAAGCGCTGGTGTGG + Intergenic
1142940818 17:3378630-3378652 CAGCTGCAGCAGGGGAGGTGCGG - Intergenic
1143550953 17:7630198-7630220 CAGCAACAGCAGCAGGCGCGAGG - Exonic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1143631183 17:8141199-8141221 CAGCGGTGGCGGCAGTGGTGAGG - Exonic
1144013298 17:11170607-11170629 CGGCAGCCTTAGCAGTGGTGGGG + Intergenic
1144478944 17:15613064-15613086 GAGAAGCAGCAGCTATGGTGAGG - Intronic
1144531654 17:16044861-16044883 CTGGAGCAGCAGCAGTGGAGTGG - Intronic
1144809946 17:17992640-17992662 CAGCACCATCAGCACTGGGGTGG - Intronic
1144919361 17:18750663-18750685 GAGAAGCAGCAGCTATGGTGAGG + Intronic
1145276998 17:21437505-21437527 CAGCAGCAGGAGCAGGGTTGAGG - Intergenic
1146608705 17:34285819-34285841 CAGCAGCCACAGAAGTGCTGCGG - Exonic
1146796433 17:35784592-35784614 CAGTAGAAGGAGCAGGGGTGTGG + Intronic
1147120954 17:38334826-38334848 CAGCAGCAGCAGCTCAGCTGTGG + Exonic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1147262789 17:39218271-39218293 CAGCAGCAGCAGCAGCGTGGGGG + Intronic
1147374468 17:40015685-40015707 CAGCAGCAGCTGCAGGGCTGGGG - Exonic
1147721594 17:42543069-42543091 CAGCACCAGCCGCAGTTCTGGGG + Exonic
1147754545 17:42760086-42760108 CACAAGAAGCAGCTGTGGTGTGG + Intronic
1147964789 17:44188721-44188743 TAGCAGCAGCAGCAAGGCTGTGG + Intronic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148805075 17:50259840-50259862 AAGCAGCGGCAGCAGGGCTGGGG + Intergenic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1149078214 17:52622474-52622496 CAGAAGCAGAATCTGTGGTGGGG + Intergenic
1149467817 17:56893523-56893545 CAGCTGCAGCAGGCTTGGTGGGG - Intronic
1149599707 17:57885522-57885544 GAGCAGCAGCGGCAGCGGCGGGG - Exonic
1150311086 17:64130000-64130022 CAGCAGCAGCAGCAGCCGCCGGG + Exonic
1150329644 17:64284582-64284604 CAGGATCAGCAGGAATGGTGTGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151361714 17:73593113-73593135 CTGCAGCAGGAGCTGGGGTGGGG - Intronic
1151671263 17:75572945-75572967 CAGCAGCAGCAGCACAGGGCAGG + Intronic
1151768068 17:76142211-76142233 CGGCTGCAGAGGCAGTGGTGGGG + Intergenic
1152147031 17:78574596-78574618 CAGCAGCAGCTGCAGAGCCGGGG - Intronic
1152154095 17:78621758-78621780 CAGCAGCAGCAGGAGTGACAGGG + Intergenic
1152415976 17:80162206-80162228 CAGCGGAAGCAGGAGTGGGGCGG + Intergenic
1152430612 17:80246503-80246525 CAGCAGCACCAGCACTCCTGCGG - Exonic
1152563977 17:81091997-81092019 CATCAGCGGCAGCTGAGGTGGGG - Intronic
1152588530 17:81199816-81199838 CAGGAGCAGCGGCAGCGGTCAGG - Exonic
1152821960 17:82441931-82441953 CAGCAACAGCAGCAGTTCTCAGG - Intronic
1152941744 17:83176441-83176463 CAGCAGCAGCAGCGGAGGCTGGG + Intergenic
1203156451 17_GL000205v2_random:8425-8447 CAGAACCAGCAGCAGTGTTCTGG + Intergenic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1153137299 18:1930573-1930595 CAGCAGTGGCAGCAGTGGGCAGG - Intergenic
1154019271 18:10648242-10648264 CAGCAGCAGCAGCAGCATAGTGG - Intergenic
1156570847 18:38251109-38251131 CAGCAGCAGCAAGAATGTTGTGG + Intergenic
1156637861 18:39052640-39052662 CAGCAGCAGCAGCAGAAATTGGG + Intergenic
1156856131 18:41783202-41783224 GATCAGAGGCAGCAGTGGTGGGG + Intergenic
1157535710 18:48455896-48455918 CACCAACAGCAGCTGAGGTGAGG + Intergenic
1157610075 18:48950534-48950556 CAGCAGCAGCAGCAGGGGCCCGG + Exonic
1158051698 18:53229029-53229051 CAGAAGTAGCAACAGTGGTCTGG - Intronic
1158452483 18:57579563-57579585 CACCAGCAACAGAAGAGGTGAGG + Intronic
1159060895 18:63512772-63512794 CAGCTTCAGCAGTGGTGGTGGGG + Intergenic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159921072 18:74227822-74227844 CAGCAGCAGCAGCAGCAGAAAGG + Intergenic
1160174501 18:76581485-76581507 CAGGAGCTCCCGCAGTGGTGGGG - Intergenic
1160230404 18:77044351-77044373 CGGCAGCTGCAGCAGAGTTGGGG - Intronic
1160318486 18:77869112-77869134 CAGCAGGGGCAGCAGGGATGGGG + Intergenic
1160570776 18:79816289-79816311 CTGCAGCAGCTGTAGTGGTGTGG + Intergenic
1160840044 19:1142326-1142348 CAGCAGAACCAACAGTGCTGCGG + Intronic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161610548 19:5240059-5240081 CAGGAGAAGCAGAAGGGGTGAGG + Intronic
1162440884 19:10691416-10691438 CGGCATCATCAGCACTGGTGAGG - Exonic
1162481105 19:10927682-10927704 CAGCAGCAGCAGCAGCAGCCGGG - Exonic
1162717154 19:12641374-12641396 GAGCCGCAGAAGCAGTGGCGGGG - Intergenic
1162839264 19:13343818-13343840 ATGCAGCAGAAGCAGTGCTGAGG + Intronic
1162992475 19:14312485-14312507 CAGGAGCCGCAGCCGGGGTGGGG + Intergenic
1163127496 19:15252097-15252119 CGGCAGCGGCAGGAGGGGTGTGG + Intronic
1163175939 19:15564122-15564144 CAGCAGCAGGAGCAGCCATGGGG - Intergenic
1163176425 19:15566867-15566889 CAGCACCAGCAGACGTGCTGAGG - Intergenic
1163608209 19:18287333-18287355 CAGCAGCTCCACGAGTGGTGAGG + Intergenic
1163639371 19:18452662-18452684 CAGCCCCACCAGCAGTGATGAGG - Intronic
1163700114 19:18782667-18782689 CAGCAGCAGCTGCAGCACTGAGG + Intergenic
1164161431 19:22627828-22627850 CAGCAGCAGCAGCAGCTTGGAGG + Intergenic
1165002476 19:32776365-32776387 CAGCAACAGCAACAGCAGTGTGG - Intronic
1166140155 19:40801031-40801053 CTGCAGCAGTGGCAGTGGTGAGG + Exonic
1166141540 19:40807941-40807963 CAGAAGCAGCAGCGGTGGCAGGG - Exonic
1166365070 19:42274119-42274141 TGGCAACAGCAGCAATGGTGAGG - Intronic
1166996265 19:46721052-46721074 CAGCTGCAGCGTCAGTGCTGCGG - Intronic
1167156202 19:47740870-47740892 CATCAGCAGCTCCTGTGGTGGGG - Exonic
1167240929 19:48342563-48342585 GAGCAGCAGCAGCAGGGAGGTGG + Exonic
1167265702 19:48482097-48482119 CAGCAGCAGCCTCAGGGATGAGG + Intronic
1167341992 19:48921854-48921876 CAGCAGCAGCAGCAGCAGCAAGG + Exonic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167621709 19:50564413-50564435 CAGGAACAGCAGCAGAGGTGAGG + Intronic
1167667901 19:50833327-50833349 CAGAAGGAGCTGCAGTGGTGGGG - Intronic
1167713227 19:51124967-51124989 CAGCAGCAGCAGCATGTCTGGGG - Exonic
1167715818 19:51142362-51142384 CAGCAGCAGCAGCATATCTGGGG - Exonic
1167721802 19:51184805-51184827 CAGCAGCAGCAGCATGTCTGGGG - Intergenic
1168050620 19:53826932-53826954 CACCACCTGCAGCAGTGGCGTGG - Intergenic
1168125244 19:54279182-54279204 CAGGAAGATCAGCAGTGGTGAGG - Intronic
1168136653 19:54356350-54356372 CAGAAGCCACAGCAGAGGTGAGG - Exonic
1168172014 19:54595543-54595565 CAGGAAGATCAGCAGTGGTGAGG + Intronic
1168368558 19:55811470-55811492 CAGCTGCAGCAGGGCTGGTGTGG + Intronic
1168605988 19:57760251-57760273 CAGCAGCAATGGCAGTGGTGGGG - Intergenic
925501424 2:4509297-4509319 GAGCTGCAGCTGCAGTGGTTTGG - Intergenic
925609914 2:5693768-5693790 CAGCAGCGGCAGCAGCGGCGAGG + Exonic
925694677 2:6563418-6563440 CAGTATCAGCAGCAGTGCTGGGG - Intergenic
926016242 2:9454420-9454442 AAGAAATAGCAGCAGTGGTGAGG + Intronic
926115762 2:10212260-10212282 CAGCAGCAGCAGCAGCAGAAGGG - Intergenic
926314094 2:11696969-11696991 CGTCAGCAGCATCTGTGGTGTGG + Intronic
926541046 2:14182342-14182364 GAGCAGCAGTGGCAGTGGTCGGG + Intergenic
926689911 2:15725974-15725996 CAGCAGCACCAGCAGTGGAGAGG - Intronic
927043688 2:19255656-19255678 GAGCAGCAGCAGCAGGATTGTGG + Intergenic
927063076 2:19442453-19442475 AAGTAGCCCCAGCAGTGGTGGGG + Intergenic
927217735 2:20677968-20677990 CAGCAGCAGCAGCAGCAGCTGGG + Intergenic
927217737 2:20677974-20677996 CAGCAGCAGCAGCTGGGCTTGGG + Intergenic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927743564 2:25594049-25594071 CAGCAGGAGCAGCAGTGAGACGG + Intronic
928391470 2:30914054-30914076 CAGCAGCAGCAGCAGCAGCCTGG - Intronic
928398181 2:30959097-30959119 CAGCGGCAGCAGCAGGAGAGAGG - Intronic
928490607 2:31778796-31778818 CAGCTGCAGCTGCAGTGTGGTGG - Intergenic
928647542 2:33370480-33370502 CAGCAGCAGCAGCAGCAGCTTGG - Intronic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604195 2:43224599-43224621 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
929925119 2:46201344-46201366 CGGCAGTAGGAGCAGTGCTGAGG - Intergenic
930047574 2:47186647-47186669 CAGCAGCAGCAGCAAGTGTAAGG - Intergenic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930096430 2:47570258-47570280 CAGCAGCAGCAGGAGGGGCGCGG + Exonic
930244546 2:48969800-48969822 TGGCAGCAGCACCAGTGATGTGG + Intronic
930721915 2:54646271-54646293 CAGCAGCAGCCTCAGCGCTGAGG + Exonic
930930462 2:56875542-56875564 CAACAGCAGTGGCAGTGTTGTGG - Intergenic
931323106 2:61191796-61191818 GAACAGCAGTAGCAGTGGAGAGG + Intronic
931434149 2:62232639-62232661 CAGCACCAGCCTCAGTGGGGTGG - Intergenic
931904807 2:66830995-66831017 CAGCAGCAGCTGCTGGGGAGGGG + Intergenic
931909895 2:66887820-66887842 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
932950548 2:76288151-76288173 CAGCAGCAGGGGCAATGGGGAGG + Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933747943 2:85584477-85584499 CGGCGGCAGCAGCGATGGTGAGG + Exonic
933892186 2:86782091-86782113 CATCAACAGCAGAAGTGGGGTGG + Intergenic
934503374 2:94875179-94875201 CAGCAGGAGGAGCTGTGGGGAGG + Intronic
934563988 2:95328337-95328359 GAGCAGCAGCAGCACTGCTCTGG - Intronic
934674360 2:96239239-96239261 CAAGAACAGCTGCAGTGGTGGGG + Intergenic
934715648 2:96541871-96541893 CAGCAGCAGCAGCAGCTATCAGG + Intronic
935312674 2:101801074-101801096 CAGCAGCAGCAGCTGGGGAAAGG - Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936661340 2:114547300-114547322 CAGCAGCAGCAGCCGTGACTGGG - Intronic
936919802 2:117676266-117676288 CAGAAGCAAGAGCAGTGGGGAGG + Intergenic
937024073 2:118682873-118682895 CAGCAGCAGCAGCAGCACAGAGG - Intergenic
937318108 2:120944868-120944890 CAGCAGCAGCAGCATCCCTGTGG + Intronic
937387360 2:121447919-121447941 CAGCAGCTGCAGCAGTGTGATGG - Intronic
937630165 2:124092365-124092387 CAGCAGCAACAACAGTAATGGGG - Intronic
937815977 2:126251254-126251276 CAGCAGCAGGAGCTGGGGTTTGG + Intergenic
937824771 2:126356739-126356761 CACAAGCAGCAGCCATGGTGTGG + Intergenic
937904295 2:127045411-127045433 CAGCAGCAGGGCCAGTGTTGGGG + Intergenic
938109209 2:128552917-128552939 CAGCTGCAAGAGCAGTGGTCTGG + Intergenic
938236769 2:129711805-129711827 CACCGGGAACAGCAGTGGTGAGG - Intergenic
938421084 2:131147379-131147401 CAGCAGCAGCAGCTAGGGTCAGG - Exonic
938876053 2:135531995-135532017 CAGCAGCAGCAGCCATGGCAGGG - Intronic
939244934 2:139610726-139610748 CCCCAGCAGCAGCAGCAGTGTGG - Intergenic
939668198 2:144976798-144976820 GAGCAGCAGCAGCAGTGGGAGGG - Intergenic
940031023 2:149261418-149261440 CAGCAGCAACAGCAGTAGTTTGG + Intergenic
940396466 2:153196902-153196924 CTGCACCAGCTGCAGTGGGGAGG - Intergenic
940396618 2:153197809-153197831 CCCAGGCAGCAGCAGTGGTGAGG + Intergenic
940575870 2:155503318-155503340 CAGCAGGGGCAGCAGTGGCACGG + Intergenic
941264140 2:163338524-163338546 CAGCAGCAGCAGCAGCAGTACGG + Intergenic
941806542 2:169716386-169716408 CATCAGCAGCTGCAGCTGTGTGG - Intronic
941906116 2:170716873-170716895 CAGCAGCGGCCGCAGAGGCGGGG - Exonic
941918543 2:170828045-170828067 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941918552 2:170828083-170828105 CAGCAGAAGGAGGAGGGGTGAGG - Intronic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
942033073 2:171982426-171982448 CAGCAGCAGCAGAGATGGAGAGG - Intronic
942465227 2:176200988-176201010 CTGGAGCAGCAGCAGTGGAGGGG + Intergenic
942521228 2:176806284-176806306 CAGCAGTAGCAGCAGCGCAGGGG + Intergenic
942914874 2:181293790-181293812 CAACCGCAGCAGCAGCGATGTGG + Intergenic
943093747 2:183404535-183404557 CAGCAGCAGCAGCAGCCATGTGG + Intergenic
943511230 2:188830233-188830255 CAGCCACAGCAGGAGTGGTGAGG - Intergenic
944155340 2:196601700-196601722 CAGCAGCAGCAGCAACTATGAGG - Intergenic
944871124 2:203913073-203913095 CAGGGGCAGATGCAGTGGTGAGG + Intergenic
945052412 2:205836575-205836597 CAGCAGAAGCAGCGGGGGTGGGG - Intergenic
946152406 2:217785434-217785456 CTGCAATAGCAGCAATGGTGGGG - Intergenic
946854190 2:223936589-223936611 CAGCAGCAGCAGGCCTGCTGTGG - Intronic
946977060 2:225164719-225164741 CAGCAGCAGCAGCAGCAGCAAGG - Intergenic
946993640 2:225365159-225365181 GAGGAGAAGCAGCAGGGGTGAGG - Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947263493 2:228251554-228251576 CAGCAGCAGTGGCAGTGGGGTGG + Intergenic
947665765 2:231904466-231904488 CACCAGCACCTGCAGTGCTGGGG + Intergenic
947773517 2:232689635-232689657 CAGAAGCACCAGCAGGGCTGGGG + Intergenic
947867939 2:233414314-233414336 CAGCAGCAGCCGTAGAGGTTGGG + Intronic
947988769 2:234470712-234470734 CAGCAGCATCAAGAGTGATGAGG + Intergenic
948361240 2:237422016-237422038 CAGCAGGCGCAGAAGTGGAGGGG + Intronic
948371083 2:237489345-237489367 CAGCAGCAACAGCACTGGGAGGG - Intronic
948501419 2:238397663-238397685 CTGCAGCAGGAGCAGAGGTGGGG + Exonic
948501435 2:238397707-238397729 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501451 2:238397751-238397773 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501465 2:238397795-238397817 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501479 2:238397839-238397861 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501495 2:238397883-238397905 CTGCAGCAGGAGCAGAGGTGGGG + Intronic
948501509 2:238397927-238397949 CTGCAGCAGGAGCTGAGGTGGGG + Intronic
948501521 2:238397971-238397993 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501535 2:238398015-238398037 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501549 2:238398059-238398081 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501563 2:238398103-238398125 CTGCAGCAGGAGCAGAGGTGAGG + Intronic
948501649 2:238398363-238398385 CTGCAGCAGGAGCAGAGGTAGGG + Intronic
948764023 2:240210404-240210426 CAGCAGCACCAGAAGAGGTTTGG - Intergenic
948788216 2:240364104-240364126 CTGGAGCAGCATCAGTGGTGCGG - Intergenic
948858086 2:240739949-240739971 CAGCAACAGACGCAGAGGTGTGG + Intronic
1168920857 20:1534757-1534779 CAGAAGCAGCAGCAATGGACAGG - Intronic
1168958889 20:1854770-1854792 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1169111295 20:3035892-3035914 CAGAAGCAGCAGCAGCAGTCAGG + Exonic
1169328772 20:4699567-4699589 CAGCAGCTGGGGCAGTGGTGGGG + Exonic
1169488496 20:6052767-6052789 CGTCAGCAGCAGCAGCGGTAGGG + Exonic
1170330199 20:15201046-15201068 CAGCAGCAGCAGCACCTGGGAGG - Intronic
1170420373 20:16186531-16186553 CACCTGCAGGAGCAGTCGTGAGG - Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170629726 20:18056788-18056810 CAGCGGCAGCAGCAGCGCGGGGG - Exonic
1170769553 20:19320007-19320029 CAGCAGCTGCAGCATGGATGGGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171169445 20:23002186-23002208 CAGCTGCAGCAGGACTGGTTCGG + Intergenic
1171285883 20:23937888-23937910 CAGCTGCAGCAGGAGAGGTGTGG + Intergenic
1171293241 20:23994477-23994499 AAGCAGCAGGTGCAGTGATGGGG - Intergenic
1171369841 20:24654794-24654816 GAGCAGCTGCAGCAGTGAAGGGG + Intronic
1171461381 20:25299988-25300010 CAGCATCAGCAGCTGTGGGCTGG - Intronic
1172100845 20:32483431-32483453 CAGCAGCAGCTGGAGCTGTGGGG - Exonic
1172149343 20:32779550-32779572 CAGGAGGGGCAGCAGTGGGGAGG + Intronic
1172158253 20:32844912-32844934 CTGCAGCAAAAGCAGAGGTGGGG + Intronic
1172167636 20:32908611-32908633 CAGCAGCAGCAGCTGCAGAGAGG - Intronic
1172194538 20:33083155-33083177 TGGCAGTGGCAGCAGTGGTGGGG + Intronic
1172628694 20:36363897-36363919 CATCAGCATGAGCAGTGGTGAGG + Intronic
1172653956 20:36525660-36525682 CAGCACCAGCCCTAGTGGTGGGG - Intronic
1172748361 20:37231286-37231308 TAGCAGAAGCAGCAATGGTGTGG - Intronic
1173179743 20:40796822-40796844 CAGGAGCAGCAGCAGAGTGGGGG - Intergenic
1173229832 20:41185451-41185473 TAGCAGCAGGAGCAGTGGTTTGG + Intronic
1173282889 20:41645056-41645078 CAGCAGCAGCAGTAGCTATGGGG + Intergenic
1173563143 20:44020622-44020644 CAGCAGCAGCAGCATTGCCTGGG + Intronic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1173856000 20:46251223-46251245 CAGCAGCAGCAGTAGCGCGGGGG + Exonic
1174037544 20:47677526-47677548 CAGCATCAGGCGCAGTGGTTTGG + Intronic
1174157722 20:48527606-48527628 CAACAGCAGCAGCAATGGAGAGG - Intergenic
1174298853 20:49568063-49568085 TAGCAGCAGCAGCAACAGTGCGG + Exonic
1174368141 20:50068671-50068693 CAGCAGCAGGAGCTGTGGACTGG - Intergenic
1174882166 20:54291869-54291891 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1175420039 20:58825891-58825913 GTGCAGCAGCAGCAGTGGCAGGG - Intergenic
1175443530 20:59006351-59006373 CAGCAGGAGCCGCAGTATTGGGG + Exonic
1175549085 20:59805054-59805076 CAGCAGCATCTGCAGTGGCAGGG + Intronic
1175938518 20:62526370-62526392 CTGTAGCAGAAGCAGTGATGTGG - Intergenic
1176170348 20:63693767-63693789 CAGCAGCAGCATCACTTGTTGGG + Intronic
1176383090 21:6123108-6123130 CAGCAGCAGCAGCAGGAATGGGG - Exonic
1176674002 21:9760214-9760236 CAACATCAGCAGCACTGATGAGG - Intergenic
1177174401 21:17689037-17689059 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1177237569 21:18412722-18412744 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1177250254 21:18582968-18582990 CAGCAGCCACAGCAGTGGATAGG - Intergenic
1177995323 21:28089802-28089824 GAGCATCAGCTGTAGTGGTGTGG + Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1178521145 21:33289378-33289400 CGACACCAGCAGCAGCGGTGGGG - Intronic
1178728062 21:35072773-35072795 CAACAGCAGCAGCAGTGTGGTGG + Intronic
1178810975 21:35881169-35881191 GAGCAGCAAGAGCAGAGGTGTGG + Intronic
1178973380 21:37201008-37201030 GGGCAGCAGCAGCAGGAGTGTGG + Intronic
1179174914 21:39001181-39001203 CAGCAGCAGCAGAGATGGGGTGG - Intergenic
1179496220 21:41772757-41772779 AAGAAGCAGCAGCAGTGCAGAGG - Intergenic
1179570766 21:42277608-42277630 CAGCACTAGCTGCAGTGGAGAGG - Intronic
1179622925 21:42630734-42630756 CAGCAGTGCCAGCAGAGGTGCGG + Intergenic
1179678816 21:43003302-43003324 CAGCACCTGCAGCATGGGTGTGG - Intronic
1179740379 21:43415131-43415153 CAGCAGCAGCAGCAGGAATGGGG + Exonic
1179800514 21:43809639-43809661 CTGCAGCTGCGGCAGGGGTGAGG + Intergenic
1179930485 21:44568203-44568225 CAGGAGCAGGAGGAGGGGTGGGG - Intronic
1180018158 21:45101011-45101033 CAGCAGCAGCAGCGCCAGTGCGG + Intronic
1180108395 21:45634608-45634630 CAGCCGCCGCAGCAGATGTGGGG - Intergenic
1180182701 21:46124971-46124993 CACCAAGAGCAGCAGGGGTGGGG + Intronic
1180448590 22:15439495-15439517 CAGAAACAGCAGCAGTGTTCTGG - Intergenic
1180824301 22:18852192-18852214 AAGCAGCAGGTGCAGTGATGGGG - Intronic
1180863896 22:19104881-19104903 AAGCAGCAGCAGCAGCAGAGGGG + Intronic
1180871633 22:19150075-19150097 CAGCAGCAGCAGCAGGCGCAGGG + Exonic
1180962701 22:19769349-19769371 CAGCAGCAACAGCAGCAGTGTGG - Intronic
1181043015 22:20201754-20201776 CAGCACCAGGAGCAGGGGTGAGG + Intergenic
1181124729 22:20695346-20695368 AAGCAGCAGGTGCAGTGATGGGG - Intergenic
1181144300 22:20833360-20833382 CAGCAGCACCAGCAGTGCAATGG + Intronic
1181188433 22:21122356-21122378 AAGCAGCAGGTGCAGTGATGGGG + Intergenic
1181210765 22:21288137-21288159 AAGCAGCAGGTGCAGTGATGGGG - Intergenic
1181398743 22:22638751-22638773 AAGCAGCAGGTGCAGTGATGGGG + Intergenic
1181443807 22:22953080-22953102 GAGAAGCAGCAGCATTGGTCAGG + Intergenic
1181493942 22:23277504-23277526 CAGCAGCAGCAGCAGGGGATGGG - Intronic
1181493945 22:23277510-23277532 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1181560174 22:23695431-23695453 CAGCAGCAGCAGCAGAGGCCTGG - Intronic
1181650678 22:24257308-24257330 AAGCAGCAGGTGCAGTGATGGGG - Intergenic
1181691952 22:24567927-24567949 CAACAGCACCAGCGGTGGGGAGG - Intronic
1182123130 22:27799612-27799634 CAGCAGCAGCAGCAGCAGCATGG - Exonic
1182294061 22:29302837-29302859 CAGCAGTACCAGCAGCTGTGGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1182510799 22:30818782-30818804 CAGGAGCAGCAGCCCAGGTGGGG + Intronic
1182652217 22:31861326-31861348 AAGCAGCAGCAGCAGTTGCAAGG - Intronic
1182715212 22:32352685-32352707 CAGCAGCAGCAGCAAGTTTGGGG - Intergenic
1183334235 22:37237484-37237506 CAGCGGCAGGAGCAGGGATGGGG + Intronic
1183509868 22:38228415-38228437 CAGCAGCAGCAGCAGAGCCCAGG + Intronic
1183784840 22:40023338-40023360 CAGCAGCAGCAGCTGGTGTTAGG - Intronic
1184027247 22:41866952-41866974 CAGCAGCAGCAGCAATGGCAGGG + Exonic
1184249182 22:43250579-43250601 CAGGAGCAGCCTCAGGGGTGCGG + Intronic
1184301546 22:43563659-43563681 CACCAGCAGCAGCAGCAGCGCGG - Intronic
1184336282 22:43855090-43855112 CAGCAGCAGCGACGATGGTGCGG + Intronic
1184726144 22:46347799-46347821 CAGCAGAAGCAGCAGGGGCTGGG - Intronic
1184925290 22:47632204-47632226 CAGCAGCAGCAGCAGCAGCCCGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
1184988946 22:48154584-48154606 GACCAGCAGCTGCAGGGGTGGGG + Intergenic
1185075621 22:48680575-48680597 CAGGGGCAGCAGCAGTGCTGGGG - Intronic
1185306944 22:50124245-50124267 GAGCAGCACAAGCAGTGCTGAGG - Intronic
1185330597 22:50250558-50250580 CACCAGCAGGAGCAGGGGGGCGG + Intronic
1185344045 22:50303765-50303787 CAGCAGCAGCATCAGAGGCAGGG - Intronic
1203216182 22_KI270731v1_random:7293-7315 AAGCAGCAGGTGCAGTGATGGGG + Intergenic
1203274440 22_KI270734v1_random:78096-78118 AAGCAGCAGGTGCAGTGATGGGG - Intergenic
949376868 3:3400568-3400590 CAGCAGCAGTGGCAGTGGGGTGG + Intergenic
949477422 3:4461947-4461969 CAGTGGCAGAAGCTGTGGTGTGG - Intronic
949918795 3:8985590-8985612 CAGCAGCAGCAGCTCGGGCGTGG - Exonic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950796051 3:15511549-15511571 CTGCAGGAGCAGCATTGGTTGGG - Intronic
951078507 3:18425122-18425144 CAGCAGGAGCAGCGGCGGAGAGG - Intronic
951109233 3:18782426-18782448 CAGCAGCAGCAGCACTGCCTGGG + Intergenic
952287298 3:31981223-31981245 CAGCAGCAGCCGCCGTGCCGGGG - Exonic
952583982 3:34869235-34869257 CAGCAGCATCAGCAGAGTGGAGG + Intergenic
952608491 3:35179168-35179190 CAGCAGTGGCAGCAGTGGGCTGG + Intergenic
952662725 3:35871124-35871146 CAGCAGCAGCAGCATTGCCAGGG + Intergenic
952751424 3:36827886-36827908 GAGCAGCAGCAACTGAGGTGAGG + Exonic
952884687 3:38005281-38005303 CTGCAGCAGAAGCAGTGAGGGGG - Intronic
952959990 3:38583144-38583166 CAGCAGCAGCACGATTGATGGGG - Intronic
953018924 3:39101527-39101549 CAGCAGAAGCAGCAATGTAGTGG - Intronic
953023127 3:39128665-39128687 CAGCAGTAGCAGCAGTGAACTGG + Intronic
953385436 3:42503255-42503277 CAGCATCAGAACCAGTGCTGGGG + Intronic
953782235 3:45881457-45881479 CAGCAGCAGCAGGAATGGGAGGG - Intronic
953801817 3:46030716-46030738 CAGCTGCAGGAGCAGCAGTGGGG + Intergenic
953880931 3:46690961-46690983 CAGCAGTAGCAGGAAAGGTGGGG - Intronic
954293280 3:49660950-49660972 CAGGAGCAGCGGCAGTGGCAGGG - Exonic
954419869 3:50413112-50413134 CAGCGGCAGCAGCAGCTGGGTGG - Intronic
954680267 3:52342133-52342155 CAGAAGGAGCAGCAGTGCAGAGG + Intronic
954992146 3:54850690-54850712 CAGCAGCTGCAGCAATGGCAGGG + Intronic
955208194 3:56916538-56916560 CAGCAGTAGCAGGAGAGGTGGGG - Intronic
956193468 3:66629574-66629596 CTGCAGCAGCAGCAGCGGGGAGG + Intergenic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
957633050 3:82743338-82743360 CAGCAGTGGCAGTGGTGGTGTGG - Intergenic
958161347 3:89819270-89819292 CAGCTGCAGCACAAGAGGTGTGG - Intergenic
958262943 3:91403980-91404002 CATCAGCAGTAGCAGTGCAGAGG + Intergenic
958659205 3:97043543-97043565 CTGCAGAAGCAGCAGTGTTGTGG + Intronic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959291086 3:104475133-104475155 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
959826803 3:110806927-110806949 GGGCAGCAGCAGCAATGGTGGGG - Intergenic
960198908 3:114807430-114807452 CAGCAGCAGCTGCAGGGGAGGGG - Intronic
960615289 3:119590864-119590886 CAGCATCTGAAGCAGTGGTGAGG - Intergenic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
961082997 3:124042501-124042523 AAGCAGCAGCAGAAATGGAGAGG + Intergenic
961262334 3:125612108-125612130 CAACAGCAGCAGTGGTGGTGGGG + Intergenic
961578012 3:127854296-127854318 GAGCAGCAGCAGCACAGCTGAGG + Intergenic
961653889 3:128430938-128430960 CAGGGGCAGGAGCAGTGGGGTGG + Intergenic
962001707 3:131305127-131305149 CACCAGCAGAAGCAGTGCTATGG + Intronic
962040761 3:131705256-131705278 CAACAGCAGCAGCAAGGCTGGGG + Intronic
962327508 3:134447933-134447955 CAGAAGGGGCAGCAGTGCTGGGG + Intergenic
962746909 3:138403640-138403662 CACCAGCAGCACCTGAGGTGGGG - Exonic
963100846 3:141602464-141602486 CAGCAGGAGCAGCAGTGGGTGGG - Intronic
963140963 3:141945856-141945878 CAGCACCAGCTGGTGTGGTGTGG + Intergenic
963644178 3:147893159-147893181 AAGCAGGTGCAGCAGAGGTGGGG + Intergenic
963732548 3:148987243-148987265 AAGCCGGAGGAGCAGTGGTGGGG - Intergenic
963809991 3:149766862-149766884 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
964768709 3:160202699-160202721 GAGCAGTAGCAGCAGGGCTGGGG - Intergenic
965420343 3:168450020-168450042 CTGCAGGAGCACAAGTGGTGAGG - Intergenic
965849729 3:173009614-173009636 CTGCAGCAGCCGCAGTGCTCAGG + Intronic
966089402 3:176114400-176114422 CAGCAGCAGGGGCAGTGGCATGG - Intergenic
966223853 3:177577329-177577351 CTGGAGCAGCAGAGGTGGTGTGG - Intergenic
966448178 3:180027116-180027138 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
966860608 3:184229488-184229510 CAGCAGCAGCAGGCGTGGCCAGG + Intronic
966949799 3:184805836-184805858 CAGGAGCAGTGGCAGGGGTGGGG + Intergenic
966964903 3:184981340-184981362 CAGCATGGACAGCAGTGGTGTGG + Intronic
967131011 3:186470715-186470737 TAGCAGCAGCAGCAATGGATGGG + Intergenic
967874636 3:194259264-194259286 CAGCAGCATCAGCATCGATGGGG - Intergenic
968262120 3:197333974-197333996 CAGCAGCAGCAGCAGGAGCTAGG + Intergenic
968539564 4:1157551-1157573 AAGCAGCAGCAGAATTGGAGAGG - Intergenic
968574180 4:1357325-1357347 TAGTACCAGCAGCAGTGCTGGGG + Intronic
968591950 4:1463884-1463906 CAGCAGGAGGACCAGGGGTGGGG - Intergenic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969043774 4:4321568-4321590 CAGCAGCCTCAGCTGTGGGGGGG + Exonic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969297606 4:6279055-6279077 CAGCTGCAGGCCCAGTGGTGGGG - Intronic
969481915 4:7451282-7451304 CAGCAGCAGCAGCGGCAGTGGGG + Intronic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
969837154 4:9851092-9851114 CAGCAGCTGCAACAGTGCAGTGG - Intronic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
970180275 4:13384370-13384392 CAGCAGCAGCAGCAGCAGCACGG - Intronic
971183090 4:24349306-24349328 CATCAGCTGCAGTAGTAGTGTGG + Intergenic
971674435 4:29607344-29607366 TAGCCGCAGCAGAAGTGGTGTGG - Intergenic
971867216 4:32189179-32189201 CAGCTGCAGCAGGGGAGGTGTGG + Intergenic
972083431 4:35182705-35182727 CAGCAGCAGTAGCAGTGTGGTGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973306689 4:48659986-48660008 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
973853639 4:54987273-54987295 TAGTAGTAGCAGCAGTGGAGTGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974685725 4:65225616-65225638 CAGCAGGAGCAGCAGTGCCCAGG - Intergenic
974812214 4:66959139-66959161 CAGCAGTAGCTGGAGGGGTGTGG + Intergenic
976122650 4:81800033-81800055 CAGCAGCAGCAGCAGAGGAAAGG + Intronic
976141001 4:81991497-81991519 CAGCAGCAGCAGTGGGGGTGGGG + Intronic
976433111 4:84986523-84986545 AAGCAGCAGCAGGAGTTGAGAGG + Intergenic
976880861 4:89923242-89923264 CAGCAGCAGCAGCAAGGCTGTGG + Exonic
977016653 4:91699954-91699976 CAGCACTACCAGCTGTGGTGGGG + Intergenic
977814351 4:101397115-101397137 CAGTAACAGCAGCAGTGCTCAGG - Intergenic
978205547 4:106076396-106076418 CAGCAACAGCAGCAGTATTGTGG + Intronic
979076331 4:116275320-116275342 CAGCAGAAGTAGCAGCAGTGTGG - Intergenic
979501013 4:121439829-121439851 CAGCAGCAGCAGCAATGAGCAGG + Intergenic
979552101 4:122002792-122002814 CAGCAGCAACTGCTCTGGTGAGG + Intergenic
979893658 4:126131920-126131942 CAGCACTACCAGCTGTGGTGGGG - Intergenic
980532149 4:134070303-134070325 CAGCAGCAGCGGCAGTGTGGTGG + Intergenic
980702038 4:136443260-136443282 ATGCAGCAGCTGCAGTGGGGTGG - Intergenic
980738172 4:136917757-136917779 CAGCTGCAGCTGCTGTTGTGGGG - Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981138594 4:141240479-141240501 CAACAGCAGCAACAGTGCTCTGG - Intergenic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981511963 4:145567024-145567046 CAGCAGCAGCAGCAGCAGCATGG - Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
981600360 4:146481400-146481422 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
981758065 4:148162728-148162750 GAAGAGCTGCAGCAGTGGTGAGG + Intronic
982157922 4:152539772-152539794 CACCAGCTGCTGCAGTGGGGCGG + Intergenic
982257627 4:153466237-153466259 CAGCAGCTGCGGCAGCGGCGGGG + Intergenic
982363983 4:154555224-154555246 CTCCAGAAGCAGCAGTAGTGAGG - Intergenic
982717516 4:158824534-158824556 GAGCTCCAGCAGCAGAGGTGGGG - Intronic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
984820518 4:183877660-183877682 CAGCAGCAGCAGCGGAAGTGCGG - Intronic
985827070 5:2200358-2200380 CAACAGCAGCAGATGAGGTGGGG + Intergenic
986229960 5:5854099-5854121 CATCAGTGGCAGCAGAGGTGAGG + Intergenic
986431525 5:7685650-7685672 CAGCAACAGTAGCAGTTGTTGGG + Intronic
986466925 5:8035000-8035022 CAGCAGCAGCACCAGGGAGGAGG + Intergenic
986561409 5:9063767-9063789 CAGCAGCAGCAGGTGGGCTGTGG + Intronic
986680864 5:10231654-10231676 CAGCAGAAGCAAAAGTGCTGTGG - Intronic
986974721 5:13381727-13381749 TAGCAGCTGCAGCAGGGGTGAGG + Intergenic
987190402 5:15471327-15471349 AAGGAGCAGCAGCAATGGTCAGG + Intergenic
988348500 5:30070280-30070302 CAGCAGCAGTGGCAGTGTGGTGG - Intergenic
988635036 5:32974012-32974034 CAGTAACAGGAGCAGTGGTTTGG - Intergenic
988862896 5:35303326-35303348 CAGAAGAAGCAGGAGGGGTGGGG + Intergenic
989086730 5:37684793-37684815 CAACAGTAGCAGCAGTGCAGGGG + Intronic
989175606 5:38522055-38522077 CAGCAGCAGTGGCTGTGCTGCGG + Intronic
990109553 5:52306518-52306540 CAGCACTACCAGCTGTGGTGGGG - Intergenic
990165537 5:52989491-52989513 CAGCAGCAGCGGCAGCGGCGCGG - Exonic
990509782 5:56480198-56480220 CTGCAGCAGCCGCAGGGCTGTGG - Intronic
990740054 5:58903403-58903425 CAGCAGGACCAGCAATGTTGGGG + Intergenic
992120304 5:73585773-73585795 CACCATCAGCAGCACTGGAGAGG + Intergenic
992494586 5:77280310-77280332 CAGCAGCAGTGGCACAGGTGTGG - Intronic
992614513 5:78535629-78535651 CTGCAGCATCAGCATTGGGGTGG - Intronic
992649180 5:78840758-78840780 CAGCAGCGGCAGCACTGCAGGGG + Intronic
992690423 5:79236211-79236233 CTGCAGCAGCACCAGGGGCGGGG + Exonic
993335004 5:86646120-86646142 AAGCAGCAGCAACAGTGGGGAGG - Intergenic
994150559 5:96442783-96442805 CAACAGCAGCAGCAGTGGTAGGG - Intergenic
994320717 5:98392013-98392035 CAGCCGCAGGAGCAGTAGTCTGG + Intergenic
994353907 5:98774150-98774172 CAGCAGCAGCTCCAGCGGCGGGG - Exonic
994613811 5:102078429-102078451 CCCCAGCAGCAGCAGTATTGTGG - Intergenic
995304713 5:110631541-110631563 CAGTGGCAGCAGCAGTGGCTGGG - Intronic
995963374 5:117873008-117873030 CAGCAACAGCAGCAGTTCAGAGG + Intergenic
996253561 5:121369527-121369549 GTGCAGCAGCACCAGTTGTGGGG + Intergenic
996552308 5:124743863-124743885 CAGCAGCAGCAGCAGCAGCAAGG + Intronic
996617131 5:125455595-125455617 TAGTGTCAGCAGCAGTGGTGGGG + Intergenic
996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG + Intergenic
996720762 5:126628094-126628116 CTGAAGCAGCAGCAGTGGAGGGG + Intergenic
996800422 5:127396821-127396843 CAGCAGCAGCATGAATGGAGAGG - Intronic
997182166 5:131841342-131841364 CAGCAGTAGCAGCAGTGTGGTGG + Intronic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997184332 5:131866472-131866494 AGGCAGCAGCAGCTGTGCTGTGG + Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997724065 5:136105589-136105611 ATGAAGCAGCAGCAGTGATGGGG + Intergenic
997743327 5:136277102-136277124 CAGCAGCAGAAGCATGGGAGAGG - Intronic
997895724 5:137715110-137715132 CAGAAGCAGCAGCTGTGGTCTGG + Intronic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
998510493 5:142709855-142709877 CAGAAGCAGCAGCATTTGAGAGG + Intergenic
999077344 5:148808878-148808900 GAGCAGCACCAGCCGGGGTGGGG + Intergenic
999229649 5:150054161-150054183 CGGCAGCAGCAGCAGTGAGCTGG - Exonic
999328710 5:150658822-150658844 CAGCAGCAGGAGCATTCCTGAGG - Intronic
999337549 5:150735159-150735181 AAGCATCAGCTGCAGTAGTGTGG - Intronic
999363619 5:151006821-151006843 CAGCAGCACAATCAGTGGGGTGG - Intergenic
999462034 5:151765976-151765998 CTGAAGCAGCAGCAATGGAGGGG + Intronic
1000782537 5:165500563-165500585 AAGCAGCAGCAGCATTTGAGAGG - Intergenic
1000839786 5:166203919-166203941 CATCAGCAGCAGCAGTATTAAGG - Intergenic
1000971875 5:167723664-167723686 CAGCAGCAGCAGAGGTCTTGAGG - Intronic
1001106190 5:168856676-168856698 CAAAAGGAGGAGCAGTGGTGTGG - Intronic
1001108566 5:168876307-168876329 CAGCTTCAGCAGCAGTGGGGAGG - Intronic
1001200755 5:169714117-169714139 CAGGAGCTCCAGCAGTGTTGGGG + Exonic
1001438716 5:171721203-171721225 CAGCAGCCGAAGTAGGGGTGGGG + Intergenic
1002197417 5:177509014-177509036 CAGCAGCTGCAGCTGAGCTGCGG + Intronic
1002276677 5:178108500-178108522 CAGAAGCAGTAGCAGTGGCTTGG + Intergenic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002519979 5:179787059-179787081 AAGCAGCAGTGGCAGGGGTGGGG + Intronic
1002569725 5:180133279-180133301 CAGCTGGAGCAGCACTGGAGAGG - Intronic
1003156787 6:3603609-3603631 CAGCAGCAGCAGCTGCGGATGGG + Intergenic
1003162888 6:3651138-3651160 GAGCTGCAGCAGCAGTGATAAGG + Intergenic
1003592890 6:7450474-7450496 CAGCAGCAGCAGCAGGAGAAAGG + Intergenic
1004096173 6:12556669-12556691 AAGCAGCAGCAGCATTGCTTGGG - Intergenic
1004228984 6:13814211-13814233 CAGGAGGAGGAGCAGCGGTGAGG + Exonic
1004320349 6:14627000-14627022 CATCTGCAGCAGCAGCAGTGTGG + Intergenic
1004428717 6:15524344-15524366 TGGCAGCTGCAACAGTGGTGTGG - Intronic
1004675864 6:17841548-17841570 AAGCAGCAGCAGCAGAGGGGTGG + Intronic
1004732208 6:18368677-18368699 CAGCAGCAGCAGCGGCTGCGCGG - Intergenic
1005033921 6:21537823-21537845 CAGCAGCTGCAGCAGTTGGAGGG - Intergenic
1005088738 6:22034269-22034291 CAGGGGCAGCAGCAGTCCTGAGG - Intergenic
1005455688 6:26017687-26017709 CAGGAGCAGCAGAAGCGGCGGGG + Exonic
1005820933 6:29598596-29598618 CACCAGCAGCAGCTGTGATAGGG - Intronic
1005883638 6:30078233-30078255 CAGCCGCACCAGCAGTGGCTCGG - Intergenic
1005948314 6:30611667-30611689 CAGCAGCAGAAGCAGGGAGGAGG + Intronic
1006148035 6:31970837-31970859 GAGAAGCAGCAGCAGGCGTGGGG + Intronic
1006187866 6:32190809-32190831 CAGACTCAGCAGCAGTGGGGAGG + Exonic
1006193620 6:32223899-32223921 CAGCAGCAGCAGCAGTGAAGGGG + Exonic
1006260752 6:32867400-32867422 ATGGGGCAGCAGCAGTGGTGTGG + Intergenic
1006277770 6:33019833-33019855 CAGAAGCAGCATCAATGGTGTGG + Intergenic
1006867268 6:37219008-37219030 ATGAAACAGCAGCAGTGGTGTGG - Exonic
1006874639 6:37284808-37284830 CAGCAGCAGCAGCATTGCAAGGG - Intronic
1007221460 6:40282243-40282265 GAGCAGCAGCAGCAGCACTGGGG - Intergenic
1007341845 6:41195606-41195628 CAGAACAAGCAGCATTGGTGAGG + Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1007342581 6:41200982-41201004 CAGCAGCAGCAGGAAGGCTGGGG + Exonic
1007368864 6:41413275-41413297 CAGCAGCAGCAGAACTGGGAAGG - Intergenic
1007474067 6:42107378-42107400 CAGCAGCAGGGGAGGTGGTGGGG + Exonic
1007496840 6:42266004-42266026 CAGCAGCTCCAGGAGTGGGGCGG - Intronic
1007575491 6:42923057-42923079 CACCAGCAGCATGATTGGTGGGG - Exonic
1007576681 6:42929617-42929639 CAGCAGCAGCAGCAGCAGCAAGG - Exonic
1007646385 6:43384788-43384810 ATGCAGCAGAAGTAGTGGTGTGG + Intergenic
1007774512 6:44217476-44217498 CAGCAGCGGGAGCAGTGGCGTGG - Intergenic
1007886189 6:45232897-45232919 CAGGAGCAGCAACAGTGGCTGGG + Intronic
1008206768 6:48669586-48669608 AACCAGCAGCAGTAGTGCTGGGG - Intergenic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1008904377 6:56659932-56659954 GAACAGCAGCAGCGGGGGTGAGG + Intronic
1008992464 6:57618906-57618928 CATCAGCAGTAGCAGTGCAGAGG - Intronic
1009181085 6:60518019-60518041 CATCAGCAGTAGCAGTGCAGAGG - Intergenic
1009308887 6:62125163-62125185 TAGCAGCAGCAGTAGCTGTGTGG + Intronic
1009803908 6:68577332-68577354 CAGCAGCAGCAGCAGCATTTGGG + Intergenic
1010083140 6:71886860-71886882 CAGCAGCAGCAGCAGAGCCGGGG - Intronic
1011019902 6:82801336-82801358 AAGCAGCAGCAGCATTTGAGAGG + Intergenic
1011157888 6:84354085-84354107 GAGCAGCAGAATGAGTGGTGAGG + Intergenic
1011194483 6:84767172-84767194 AGGCGGCGGCAGCAGTGGTGCGG - Intergenic
1011530232 6:88312898-88312920 CAGCAGCTGCACCTGGGGTGGGG + Intergenic
1012045754 6:94270879-94270901 CAGCAGCAGCATTAGTGTTATGG + Intergenic
1012247165 6:96938632-96938654 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1012394319 6:98778366-98778388 CAGAAGAAGCAGAGGTGGTGGGG + Intergenic
1012743248 6:103047709-103047731 CAACAACACCAACAGTGGTGAGG - Intergenic
1012964401 6:105657686-105657708 CAGCAGGAGCAGCAGAGGGGTGG - Intergenic
1013839361 6:114371952-114371974 GAGCAGCAGAAGCAGTGTTCAGG + Intergenic
1014144431 6:117981014-117981036 ATGCAGCAGAAGCAGAGGTGGGG + Intronic
1014199094 6:118588999-118589021 CAACAGCAGCAGCGGCAGTGAGG - Intronic
1014279846 6:119429622-119429644 AAGAAGCAGCAGAAGTCGTGAGG + Intergenic
1014804297 6:125811989-125812011 CAACAGCACTAGCTGTGGTGCGG - Intronic
1015678928 6:135781858-135781880 CAGCAGCAGTGGCAGTGTGGTGG - Intergenic
1015693717 6:135956408-135956430 CAGCAGCAGAAGGTGGGGTGAGG + Intronic
1016505156 6:144771037-144771059 CAACAGCAGAAGTAGTGCTGTGG - Intronic
1016521714 6:144953900-144953922 CAGCAGCCTCAGCATTGCTGGGG + Intergenic
1016986658 6:149900505-149900527 CAGCAGCAGCAAAAGAGATGTGG + Intergenic
1016994384 6:149951413-149951435 CATCAGCAGCAGCAGCCATGTGG + Intergenic
1017327082 6:153151983-153152005 CTGCAGCAGCAGCAGTACTCTGG - Intergenic
1017840905 6:158222295-158222317 CAGCAGCAGAAGCAGTCATGGGG - Intergenic
1017973097 6:159329915-159329937 CAGCAGTGGCAGCAGCAGTGAGG + Intergenic
1018109744 6:160523573-160523595 CAGGAGCAGGAGCAAGGGTGGGG - Intergenic
1018166079 6:161098317-161098339 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1018826560 6:167412150-167412172 CAGCAGCAGCAGCATTGCCTGGG + Intergenic
1018840193 6:167510858-167510880 AAACAGCAGCAGCAATGGAGCGG + Intergenic
1019014146 6:168867534-168867556 CAGCAGGAGCAGGAGAGGTGAGG + Intergenic
1019337421 7:491950-491972 GAGCTGCAGGAGCTGTGGTGAGG - Intergenic
1019401527 7:856821-856843 CAGGAGCAGCAGCAGAGATGAGG - Intronic
1019450640 7:1095943-1095965 CGGCAGCAGCGGCAGCGGGGAGG + Intronic
1019484192 7:1281141-1281163 CAGCAGCAGCAGCAGCAGCCAGG + Intergenic
1019484193 7:1281144-1281166 CAGCAGCAGCAGCAGCCAGGAGG + Intergenic
1019508105 7:1403594-1403616 GAGCAGCCGCAGCTGGGGTGGGG - Intergenic
1019886147 7:3907718-3907740 CCGCAACAGCAGAGGTGGTGAGG + Intronic
1019959823 7:4449798-4449820 CAGCAGCAGGAGCAGGGGGAAGG - Intergenic
1020049471 7:5072387-5072409 CAGCAGCAGCAGCAACAGCGGGG - Exonic
1020086436 7:5313153-5313175 CAGCAGCAGCAGCAGCGGCTCGG - Exonic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021203711 7:17754060-17754082 CATTGCCAGCAGCAGTGGTGTGG - Intergenic
1021471148 7:21003440-21003462 CAGCAGTGGCAGCAGTGGGTAGG - Intergenic
1021640855 7:22735004-22735026 TATCCACAGCAGCAGTGGTGTGG + Intergenic
1022113513 7:27245103-27245125 GAGCAACGGCGGCAGTGGTGGGG + Exonic
1022459864 7:30594962-30594984 CGGCAGCAGCAGCAGCAGAGCGG - Exonic
1022589088 7:31643774-31643796 CAGCAGATGCAGCAGTGGGCAGG - Exonic
1024007887 7:45241018-45241040 CAGCCCCAGCAGCAGGGCTGGGG + Intergenic
1024414916 7:49095759-49095781 GGGCAACAGCTGCAGTGGTGTGG + Intergenic
1024857161 7:53795074-53795096 CAGCTGCAGCAGCGGAGGTGTGG - Intergenic
1025014485 7:55427903-55427925 CAGCAGCAGCAGCTGTGGAGGGG + Intronic
1025207876 7:57003949-57003971 CAGCAGCAGCAGCAGTGGCTCGG + Intergenic
1025664064 7:63572914-63572936 CAGCAGCAGCAGCAGCGGCTCGG - Intergenic
1026735077 7:72944187-72944209 CAGGAGCTAAAGCAGTGGTGTGG + Intronic
1026764986 7:73154820-73154842 CAGCAGCAGCAGCAGCACCGGGG + Intergenic
1026785419 7:73299113-73299135 CAGGAGCTAAAGCAGTGGTGTGG + Intergenic
1026822177 7:73557258-73557280 CAGCAGCCGCAGCAGGTGGGCGG + Intronic
1027108655 7:75420820-75420842 CAGGAGCTAAAGCAGTGGTGTGG - Intronic
1027859832 7:83563489-83563511 CAGCAGCAGCAGCAGCAGCTAGG + Intronic
1028611862 7:92720640-92720662 CATCATCAGCAGCCCTGGTGAGG - Intronic
1028961271 7:96751976-96751998 CAACTGCAGCAGCAGTGGGTGGG - Intergenic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029433396 7:100547171-100547193 AAGCAAAAGCAGCGGTGGTGGGG - Intronic
1029506481 7:100966478-100966500 CAGCAGCAGCACCAGCAGCGCGG - Exonic
1031629705 7:124032396-124032418 CAGCAGCAGCAGCAGCGGAGGGG - Exonic
1032119585 7:129146064-129146086 CAGAAGCAGCAGCTCTGGTGTGG - Intronic
1032773809 7:135089800-135089822 TACAAGCAGCTGCAGTGGTGTGG + Intronic
1032842891 7:135727848-135727870 GAGCAGCAGCAGCAAAGGTGTGG - Exonic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033447873 7:141437908-141437930 CAACAGCTGGTGCAGTGGTGAGG - Intronic
1033619550 7:143049860-143049882 CAGGGGCAGCAGCATTGATGTGG - Intergenic
1033765693 7:144488052-144488074 CAGCAGCAGCAGCATCCCTGGGG + Intronic
1034426346 7:151016201-151016223 CAGCAGCAGCAGGAGCCGTGGGG - Exonic
1034454004 7:151155031-151155053 CAGCAGGAGCTGCAGTAATGGGG - Intronic
1034499244 7:151439564-151439586 AAGAAGCCGCAGCAGTGGGGCGG + Intronic
1034504089 7:151472269-151472291 CCTCAGCGGCAGCAGTGGAGGGG - Intronic
1034737285 7:153440790-153440812 CAGCAGCAGCAGCACAGCAGGGG - Intergenic
1034800485 7:154052685-154052707 CAGCAGCAGCAGCAGCAGCAAGG - Intronic
1035530157 8:345111-345133 CAGCAGCAGCAACAGGGGCTGGG - Intergenic
1035580039 8:733889-733911 CAGGAGCAGGTGCAGTGGAGGGG - Intronic
1036579616 8:10061890-10061912 AGGCATCTGCAGCAGTGGTGGGG + Intronic
1036579689 8:10062230-10062252 CAGCAGCAGCAGCAGCTGGCTGG + Intronic
1036760251 8:11503775-11503797 CAGCAGCCTCAGCAGAGGTGAGG - Intronic
1037288263 8:17323633-17323655 CAGCAGAGGCCGCAGGGGTGGGG + Intronic
1037882889 8:22581503-22581525 CAGCTGCAGCCGCAGGGGCGAGG - Exonic
1037885340 8:22593206-22593228 CAGCAGTGGCAGCGGTGGTGGGG + Intronic
1038029509 8:23624896-23624918 CTCCAGCAGAAGCAGTGGAGGGG - Intergenic
1039158759 8:34593810-34593832 CAGCAGCACCTGCAGTGCTATGG - Intergenic
1039467982 8:37797303-37797325 CAGCGGCAGCAGCAGGCGCGCGG - Exonic
1039475539 8:37837640-37837662 CAGCAGCAGCAGCAGTGACAGGG - Intronic
1039691821 8:39872427-39872449 CAGCACTACCAGCTGTGGTGGGG - Intergenic
1039905792 8:41785645-41785667 GAGCAGGGGCAGCAGTGGTTGGG - Intronic
1039920596 8:41891628-41891650 CTGCAGAGGTAGCAGTGGTGGGG - Intronic
1041514641 8:58687359-58687381 CTGCTGCAGCTGCAGTGTTGAGG - Intergenic
1041694438 8:60720873-60720895 CATCAGCAGCAGCACCTGTGTGG + Intronic
1041787046 8:61646947-61646969 CAGCAGCAGGAGCAGGTGTGTGG - Intronic
1042752217 8:72170491-72170513 CAGCAGCAGCATTGGTGGTATGG + Intergenic
1042764747 8:72308761-72308783 CAGCAGCAGCAGTGGGGGTGTGG + Intergenic
1042791102 8:72607213-72607235 GAGGAGCAGCAGTATTGGTGTGG + Intronic
1043618857 8:82162661-82162683 CAGCAGCAGCAGAACTTGTCAGG - Intergenic
1044997753 8:97853408-97853430 CATCAGCATGACCAGTGGTGGGG + Intergenic
1045326766 8:101123118-101123140 AGGCAGCAGCAGTAGTGGGGTGG - Intergenic
1045705479 8:104917522-104917544 CAGCAACAGCACAAGTGGGGAGG + Intronic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1045930997 8:107626426-107626448 TATCAGCAGCAGTAGTGGTCAGG + Intergenic
1046056681 8:109086655-109086677 CAGCAGGAGCAGCAGCAGTGAGG - Exonic
1046868693 8:119179616-119179638 CAGCAGCAGTAGCAGTGCCAAGG + Intronic
1046895210 8:119464150-119464172 CAGCAGCAGTGGCAGTGCAGTGG - Intergenic
1046934565 8:119873888-119873910 CAGCACCAGCGGGAGTGGCGGGG + Exonic
1047221388 8:122921456-122921478 GAGGGGCAGCAGCGGTGGTGGGG - Intronic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1047493071 8:125390222-125390244 CAGCGGCAGCAGCAGCGTGGGGG - Intergenic
1047928202 8:129701566-129701588 AAGGTTCAGCAGCAGTGGTGGGG - Intergenic
1047939612 8:129816367-129816389 AATGAGGAGCAGCAGTGGTGAGG + Intergenic
1047961804 8:130016514-130016536 CAGCAGCAGCAGCAGCAGCCCGG + Intronic
1048006769 8:130425943-130425965 TGGAAGCAGCGGCAGTGGTGGGG - Intronic
1048036280 8:130680330-130680352 CTGTAGCAGCAGCTGTGGTGTGG + Intergenic
1048265461 8:132981641-132981663 CAGCAGCAACAGCAGCGCTGGGG + Intronic
1048274468 8:133055852-133055874 CAGCAGCAGCAGCAGCAGCAGGG + Intronic
1048544906 8:135377667-135377689 TAGCAGAAGCAGCAGTGTTCTGG - Intergenic
1048752629 8:137697379-137697401 CAGCAGCAGCAGCAGCAGCAGGG + Intergenic
1048762086 8:137805945-137805967 CATCAGCAGCATCTGTGGAGTGG + Intergenic
1048765329 8:137837545-137837567 AAGCAGCAGCAGCAGCAGTTTGG + Intergenic
1048876125 8:138838056-138838078 AGGCAGCAGAAGCAGTGGCGTGG + Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1048980908 8:139703138-139703160 CAGCAGCAGCAGCGGGGAGGCGG + Intergenic
1049095733 8:140547126-140547148 CAGCAGCAGCAGCTACCGTGTGG - Intronic
1049106428 8:140616661-140616683 CAGGGGCAGCAGCAGTGGGCAGG + Intronic
1049286605 8:141778966-141778988 CAACAGCAGCAGCAATTCTGGGG - Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1049713332 8:144077426-144077448 CAGCTGCAGCAGCAGGGTTGTGG + Intergenic
1049802581 8:144524936-144524958 CAGCAGCAGCGGCAGCAGTGCGG + Exonic
1049802584 8:144524939-144524961 CAGCAGCGGCAGCAGTGCGGGGG + Exonic
1049986130 9:953615-953637 CAGCTTAAGCAGCAGTGGAGAGG - Intronic
1050052773 9:1620547-1620569 CAGCAGCAGCAGCAGCTGTTTGG + Intergenic
1050259617 9:3827829-3827851 CATCAGGAGCAGCAAGGGTGAGG + Exonic
1050426482 9:5517016-5517038 CAGCTGCAGCAGTGGAGGTGTGG - Intronic
1050501906 9:6307454-6307476 CAGCAGCAGCAGCATTGCCTGGG + Intergenic
1051973066 9:22914156-22914178 CAGCAGCAGCAGCAGCAGCCTGG + Intergenic
1052218601 9:25995199-25995221 CAGAAGCAGGAGCATTCGTGGGG - Intergenic
1052798783 9:32948433-32948455 AACCAGCATCTGCAGTGGTGGGG - Intergenic
1053053113 9:34977585-34977607 CAGCAGCAGCAGCAAGAGTCAGG + Exonic
1053453110 9:38209943-38209965 AAGCAGAAGCAGCAGAGTTGAGG + Intergenic
1055231763 9:74074815-74074837 CAACAGCTGCAGCAGTGTGGCGG + Intergenic
1055840773 9:80500456-80500478 CAGCAGCAGCAGCAGCAGTACGG - Intergenic
1056322694 9:85451901-85451923 AAGCATCAGCTGCAGTAGTGTGG + Intergenic
1056756013 9:89382585-89382607 CAGCAGCAGCAGCAGAGACCTGG + Intronic
1057549023 9:96038591-96038613 CAGGGGCAGAAGCAGAGGTGTGG + Intergenic
1057557390 9:96098820-96098842 CACCAGCAGCAGCAGTGCACAGG + Intergenic
1057711222 9:97446947-97446969 CAGCAGAAGCAGAAGTGAAGAGG + Intronic
1057864342 9:98667331-98667353 CAGCAGCAGGAGCACTGGGTGGG + Intronic
1057932948 9:99211979-99212001 CTGCAGCAGCAGCAATGGTTGGG + Intergenic
1058514709 9:105758458-105758480 CAGCAGGAGAAGCAGTGGATTGG + Intronic
1058744551 9:107976960-107976982 CTGAAGCCACAGCAGTGGTGAGG - Intergenic
1059386269 9:113967212-113967234 CATAAGCAGCAGAAGTGGTACGG - Intronic
1059401117 9:114071156-114071178 CAGCAGCAGCCGCCCTGCTGTGG + Intronic
1060367441 9:123032490-123032512 CTGAAGCAGCAGCAGTTGTCTGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060878974 9:127104438-127104460 TAGCAGCAGCAGGATAGGTGGGG + Intronic
1060897410 9:127226183-127226205 CATCACCCGCAGCAGTGGTAGGG + Intronic
1061089959 9:128420894-128420916 CAGCAGCTGGAGCAGCGGCGCGG - Exonic
1061293509 9:129665538-129665560 CAGCGCCAGCAGCCGGGGTGGGG + Intergenic
1061382002 9:130264422-130264444 CAGAAGCAGCCTCAGAGGTGGGG + Intergenic
1061413164 9:130431869-130431891 TACCAGCAGCAGCAGCTGTGCGG - Intronic
1061515398 9:131087085-131087107 CAGAACCAGCAGCAGAGCTGGGG - Intronic
1061629936 9:131865966-131865988 CAGCTGCAGCAGCTGAGGAGCGG + Intronic
1061835247 9:133324289-133324311 CAGCAGGGGAAGCAGCGGTGGGG + Intergenic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062145044 9:134984461-134984483 CAGCAGCAGCAGGAGCCCTGTGG - Intergenic
1062173741 9:135149355-135149377 CAGCTGCAGCAGGAGGGCTGTGG + Intergenic
1062307330 9:135915542-135915564 CAGCAGCATCAGCAGTGTCCGGG + Intergenic
1062360310 9:136185154-136185176 CAGCAGCAGCTCGAGTGGGGAGG - Intergenic
1062403702 9:136383536-136383558 CAGCAGCAGCAGCAGCGAGGAGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1062467394 9:136687313-136687335 CAGCAGCAACAGCAGCGCCGCGG + Exonic
1062673998 9:137729209-137729231 CAGCAGCAGCAGCATTCACGAGG - Intronic
1185644879 X:1609477-1609499 CAGCGGCAGCAGGAGAGGAGGGG - Intergenic
1185737626 X:2505024-2505046 CACCAGGAGCAGCAGGGGAGTGG + Intergenic
1185927140 X:4160040-4160062 CAGCATCAGAAGCACTGGTTTGG + Intergenic
1186196291 X:7113079-7113101 CAGCTGGGGCAGCAGTGGAGGGG + Intronic
1186470343 X:9816579-9816601 CAGCAGCAGCAGCAGCAGCAGGG - Intronic
1188437121 X:30173694-30173716 CAGCAGCAGCAGCAGCACTTGGG + Intergenic
1188441561 X:30218775-30218797 CCGCAGCAGCGGCAGTGGTTGGG - Exonic
1188515299 X:30979408-30979430 CTGCAGCAGCAGGCTTGGTGAGG - Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188963561 X:36523298-36523320 CAGCAGTAGTAGCAGTGTGGAGG + Intergenic
1189104316 X:38220748-38220770 CGGCAGCAGCAGCAGCAGCGCGG + Exonic
1189577315 X:42368098-42368120 GAACAGCAGTAGCAGTGCTGTGG + Intergenic
1189926468 X:45960095-45960117 CAGTAACAGCAGCAGGGGTGGGG - Intergenic
1189992818 X:46610626-46610648 CAGCAGCAGCAGCAGGACCGAGG + Intronic
1190237923 X:48631665-48631687 CAGCAGCAGCAGCAGGGAACAGG - Intergenic
1190237924 X:48631671-48631693 CAGCAGCAGCAGCAGCAGCAGGG - Intergenic
1190287696 X:48971755-48971777 CAGGAGCAGCAACAGCGGTGGGG + Intergenic
1190324872 X:49200178-49200200 CAGCAGCATCAGCAATGCAGGGG + Exonic
1191029955 X:55959051-55959073 AAGCACCAGCTGCACTGGTGGGG - Intergenic
1191642436 X:63441868-63441890 TAGCAGCAGCTGCAGCAGTGTGG - Intergenic
1191695551 X:63986076-63986098 CAGCAGCAGTGGCAGTGTGGTGG - Intergenic
1191813895 X:65222170-65222192 CAGCAGCAGCAGCATAGAAGGGG + Intergenic
1192232828 X:69277837-69277859 CAGCAGCAGCAGCAACTTTGGGG + Intergenic
1192687554 X:73323084-73323106 CAGCACTACCAGCTGTGGTGGGG + Intergenic
1193467993 X:81869744-81869766 CTGCACCAGCTGCAGTGGGGAGG - Intergenic
1193740817 X:85215190-85215212 CAGCTGGAGCCGAAGTGGTGGGG + Intergenic
1193883745 X:86960023-86960045 CAGCAGCAGTGACAGTGTTGTGG + Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194066024 X:89263199-89263221 ATGCAGCAGCAGCAGTGCTGTGG - Intergenic
1194081023 X:89465419-89465441 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1194085685 X:89524960-89524982 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1194217377 X:91147822-91147844 CAGCAGCAGTGGCAGTGCAGTGG + Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1195018420 X:100800808-100800830 CAGCAGCAGCATCTGTGAAGTGG + Intergenic
1195687988 X:107602686-107602708 CTGCAGCAGCAGCAGCCCTGAGG + Exonic
1195974876 X:110515721-110515743 TAGAAACAGCAGCAGAGGTGAGG - Intergenic
1196047370 X:111270388-111270410 CAGCAGCAGCAGCAGCAGCAGGG - Exonic
1196467713 X:115990372-115990394 CACCCGCAGCAGCAGTGGCCTGG + Intergenic
1196473688 X:116058404-116058426 TAGCAGCAGCATCAGTAGTATGG + Intergenic
1197035128 X:121864264-121864286 GAGCAGCTGGAGCAGTGCTGAGG + Intergenic
1197141558 X:123122464-123122486 CAGCAGCAGCAGCAGCTTGGTGG - Intergenic
1197393980 X:125903387-125903409 CAGAAGCACCAGCATTGATGAGG + Intergenic
1197567901 X:128111169-128111191 CAGCAGCCACAGCAGTGCAGTGG - Intergenic
1197855914 X:130913742-130913764 TAGCAGCAGCAGCAGTAATCAGG - Intergenic
1198737284 X:139800594-139800616 CAGCAGCAGCAGCATTACTGGGG - Intronic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1199996269 X:153028562-153028584 GAGCTGCAGCAGTAGGGGTGGGG + Intergenic
1200110073 X:153736541-153736563 CTGCAGCAGCAGCAGGGGCGGGG - Intronic
1200138502 X:153886158-153886180 CGGCAGCAGCGGCTGTGGCGGGG + Intronic
1200433695 Y:3121622-3121644 CACCAGCTGCAGCAGTAGTGGGG - Intergenic
1200438331 Y:3180843-3180865 CAGCAGCTGCAGCAGTGTGGCGG + Intergenic
1200553891 Y:4611614-4611636 CAGCAGCAGTGGCAGTGCAGTGG + Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1200720192 Y:6597323-6597345 ATGCAGCAGCAGCAGTGTTGTGG - Intergenic
1201270805 Y:12252064-12252086 CATCAGCAGCAGCCATTGTGTGG + Intergenic