ID: 916204108

View in Genome Browser
Species Human (GRCh38)
Location 1:162298482-162298504
Sequence GAGGATCAGCAGAGGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1258
Summary {0: 1, 1: 1, 2: 3, 3: 111, 4: 1142}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916204097_916204108 19 Left 916204097 1:162298440-162298462 CCCAGTGGGGACCTAGAACTCCC 0: 1
1: 0
2: 6
3: 40
4: 141
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204103_916204108 -5 Left 916204103 1:162298464-162298486 CCCACACCCAGCAGTAATGAGGA 0: 1
1: 2
2: 12
3: 47
4: 276
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204104_916204108 -6 Left 916204104 1:162298465-162298487 CCACACCCAGCAGTAATGAGGAT 0: 1
1: 2
2: 10
3: 44
4: 364
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204100_916204108 -1 Left 916204100 1:162298460-162298482 CCCACCCACACCCAGCAGTAATG 0: 1
1: 1
2: 7
3: 37
4: 283
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204101_916204108 -2 Left 916204101 1:162298461-162298483 CCACCCACACCCAGCAGTAATGA 0: 1
1: 0
2: 13
3: 80
4: 347
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204099_916204108 8 Left 916204099 1:162298451-162298473 CCTAGAACTCCCACCCACACCCA 0: 1
1: 0
2: 6
3: 49
4: 550
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142
916204098_916204108 18 Left 916204098 1:162298441-162298463 CCAGTGGGGACCTAGAACTCCCA 0: 1
1: 0
2: 3
3: 9
4: 110
Right 916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG 0: 1
1: 1
2: 3
3: 111
4: 1142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916204108 Original CRISPR GAGGATCAGCAGAGGCAGAG TGG Intronic
900009000 1:88948-88970 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
900491468 1:2951399-2951421 AAGGAACAGAAGATGCAGAGAGG + Intergenic
900691879 1:3985740-3985762 GAGGATCATCTGAGTCTGAGAGG + Intergenic
900742455 1:4339049-4339071 GAGGAACAGGAGAGAGAGAGAGG - Intergenic
900780420 1:4614252-4614274 GAGCAGCAGCAGAGTCAGACTGG + Intergenic
900948483 1:5844438-5844460 GAGGATGAGGCGAGGGAGAGAGG + Intergenic
901023596 1:6267484-6267506 GAGGATCTGCAGACACAGACAGG - Intronic
901192710 1:7422108-7422130 GAGGGTCTGAAGGGGCAGAGTGG + Intronic
901230985 1:7641617-7641639 GAGGGTCAGGAGGGACAGAGGGG + Intronic
901324146 1:8356921-8356943 GAGCAGCCACAGAGGCAGAGCGG - Intronic
901875326 1:12164163-12164185 CAGGGACAGCAGAGGCAGTGTGG - Intergenic
902318420 1:15641665-15641687 GAGCATCAGGACAGGCACAGTGG + Intronic
902364326 1:15961592-15961614 GAGGATTAGGAGAGGCTCAGGGG + Intronic
902465017 1:16612078-16612100 GAGGATCACCAGAGCCCGGGAGG - Intronic
902548664 1:17206311-17206333 GAGGATCACCAGAGGCCAGGTGG - Intronic
902599461 1:17531311-17531333 GTGGGTCAGCAGAGGCACAGGGG - Intergenic
902739629 1:18426962-18426984 GAGGCACAGCTGGGGCAGAGAGG - Intergenic
903183261 1:21615685-21615707 GAGGGTCAGAAGAGGCAGCTGGG - Intronic
903249950 1:22045630-22045652 CAGCATGAGCAGTGGCAGAGAGG + Intergenic
903544806 1:24117280-24117302 GAGGATCACCTGAGCCAGGGAGG + Intergenic
903855830 1:26337102-26337124 GAAGAGCAGCAGGGGAAGAGAGG + Intronic
904134957 1:28305088-28305110 CAGGATCACTTGAGGCAGAGAGG - Intergenic
904689195 1:32281147-32281169 GAGGATCACCTGAGCCAGGGAGG + Intronic
904774888 1:32900761-32900783 AAGGATCAGCAGCGGGGGAGCGG - Intronic
904810736 1:33161865-33161887 GAGGAACATGGGAGGCAGAGAGG - Intronic
904906408 1:33900350-33900372 GAGGAGCAGAAGAGAAAGAGGGG + Intronic
905323092 1:37131571-37131593 TAGGAGAAGCAGAGGCACAGGGG - Intergenic
905407495 1:37745090-37745112 TAGAATCATCAGAGGCAGCGTGG + Intronic
905803069 1:40858040-40858062 CAGGATCAGCAGCTGCAGAAGGG - Intergenic
905879726 1:41455710-41455732 CAGCATCAGCAAAGGCACAGTGG - Intergenic
905913722 1:41671107-41671129 GAGGCTTAGGAGAGGCAGGGTGG - Intronic
906066017 1:42980621-42980643 GAGGAACAGCAAATGCAGGGAGG + Intergenic
906197082 1:43936115-43936137 GCTGCTCAGCAGAGCCAGAGCGG - Exonic
906265345 1:44424692-44424714 GAGGAGGAGCAGTGGCAGAGGGG - Intronic
906540445 1:46581555-46581577 GAGGATCATCAGAGGAGAAGTGG + Intronic
906544810 1:46613457-46613479 GAGGTTGAGCAAAGGCTGAGAGG - Intronic
906579634 1:46925692-46925714 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
906604089 1:47153196-47153218 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
906653198 1:47528039-47528061 GAGGAGGAGGAGAGGAAGAGGGG + Intergenic
907159667 1:52360933-52360955 CAGGAGCATCAGAGGCACAGGGG + Intronic
907226620 1:52953427-52953449 GAGGATCACCTGAGGCCAAGAGG - Intronic
908142915 1:61206003-61206025 GAGGATCAGTTGAGCCAGGGAGG - Intronic
908530725 1:65031062-65031084 GAGGATCAGTTGAGCCAGGGAGG + Intergenic
908592788 1:65651826-65651848 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
908611489 1:65865676-65865698 GAGGAAGAGCAGAAGCAGAGTGG - Intronic
908932548 1:69334412-69334434 CAGGATCAGCAGTGGCAGTGTGG + Intergenic
909053090 1:70791015-70791037 GAGTATCAGCATTGGAAGAGTGG - Intergenic
910163227 1:84296592-84296614 GAGGAGCAGGAGAGGGAGAGAGG + Intergenic
910168118 1:84349059-84349081 AAGTATCAGGAGAAGCAGAGGGG + Intronic
910827916 1:91428731-91428753 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
910834370 1:91493568-91493590 GAGGATCACCTGAGCCTGAGAGG - Intergenic
910906715 1:92189076-92189098 GAGGATCACCTGAGCCCGAGAGG - Intergenic
911399530 1:97357973-97357995 GAGGATGAGCTGAAGCAGTGGGG + Intronic
911684607 1:100760558-100760580 GAGGACCAGCAGAGACCAAGTGG - Intergenic
911838555 1:102652308-102652330 GAGAAGCAGATGAGGCAGAGGGG - Intergenic
912245814 1:107960658-107960680 GAGGAACAGCAGGGTCAGTGTGG - Intronic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912521172 1:110245717-110245739 GAGGAAGAGAAGAGGCAGTGTGG - Intronic
912894948 1:113576453-113576475 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
913102815 1:115584819-115584841 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
914095131 1:144538792-144538814 GAGGATCACTAGTGCCAGAGTGG + Intergenic
915017855 1:152752923-152752945 GAGATGCAGCAGGGGCAGAGGGG + Intronic
915061443 1:153188947-153188969 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
915088767 1:153406770-153406792 GGGGATCAGCAGTGGCTGGGAGG + Intergenic
915096132 1:153464065-153464087 GGGGATCAGCAGTGGCTGAGAGG - Intergenic
915263195 1:154694431-154694453 GAAGACCACCAAAGGCAGAGGGG - Intergenic
916115235 1:161480368-161480390 GAGGGATAGCAGAGGGAGAGAGG - Intergenic
916204108 1:162298482-162298504 GAGGATCAGCAGAGGCAGAGTGG + Intronic
916612881 1:166410202-166410224 GAGGGCGAGCAGAAGCAGAGTGG - Intergenic
916731678 1:167572196-167572218 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
917509953 1:175661761-175661783 GAGGATGAGCAGATGTAGAGGGG - Intronic
917588459 1:176452464-176452486 GTGTAGCAGGAGAGGCAGAGAGG + Intergenic
918062663 1:181075342-181075364 GAGGATCATTTGAGCCAGAGAGG + Intergenic
918163278 1:181920580-181920602 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
918502035 1:185207809-185207831 GAGGATCATCTGAGCCTGAGAGG + Intronic
919476938 1:198040876-198040898 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
919620309 1:199857686-199857708 GAGGATCACCTGAGGCTGAGAGG - Intergenic
919682864 1:200453564-200453586 GAGCATCTGCAGAGGAAGAGTGG - Intergenic
919767486 1:201136598-201136620 GGGGATCAGCAGAGTCAGATAGG - Intronic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
919860237 1:201735105-201735127 GGGGGTCAGCAGATGCACAGTGG - Intronic
920181186 1:204132521-204132543 GAGGATCATCAGAGCCCGGGAGG - Intronic
920263674 1:204706666-204706688 GAAGATAAGCAGAGGAAGTGGGG + Intergenic
920289092 1:204904185-204904207 GAGGATCACCTGAGGCTGGGAGG - Intronic
920383564 1:205550358-205550380 GAGGATCACCTGAGCCAGGGAGG + Intergenic
920784643 1:209029273-209029295 GAGGATCACCTGAGCCAAAGAGG + Intergenic
920975324 1:210780495-210780517 GTGGAACAGCAGATGCAGTGGGG + Intronic
920985508 1:210885255-210885277 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921047130 1:211485478-211485500 GAGGAAGAACAGAGACAGAGAGG + Intronic
921265771 1:213419487-213419509 GAGGAACCTGAGAGGCAGAGAGG + Intergenic
921278654 1:213544076-213544098 GATGATAAGCAGAGGAGGAGGGG + Intergenic
921369602 1:214407981-214408003 GAGAAGGAGCAGAGGCAGTGTGG - Intronic
921631261 1:217437077-217437099 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
921896633 1:220408167-220408189 GAGGATCATCAGAGCCTGGGAGG - Intergenic
922066129 1:222145642-222145664 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
922072050 1:222204291-222204313 GAGGAGCAGTAGAGGGAGAAAGG + Intergenic
922202519 1:223418137-223418159 GAGGATCACCTGAGCCAGGGAGG + Intergenic
922240184 1:223750719-223750741 GAGGATCACAAGAGCTAGAGGGG - Intronic
922715928 1:227872034-227872056 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
923853345 1:237820368-237820390 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
924248587 1:242108558-242108580 GGGGGCCGGCAGAGGCAGAGTGG - Intronic
924299736 1:242625328-242625350 GAGGATCAACTGAGACCGAGGGG - Intergenic
924582514 1:245334610-245334632 GAGGGTCAGCAGAGGAGAAGGGG + Intronic
924621984 1:245669937-245669959 GAGGGTCCACAAAGGCAGAGTGG + Intronic
924743723 1:246813491-246813513 GAGAATCAGCAAAGGGAGACAGG - Intergenic
924894120 1:248317260-248317282 GAGAGTGAGCAGAAGCAGAGTGG - Intergenic
924947509 1:248856248-248856270 GAGAATGAGCAGAGCAAGAGAGG - Intronic
1063055962 10:2504532-2504554 GATTATCAGCAAAGACAGAGAGG - Intergenic
1064030657 10:11880637-11880659 CAGGATGGGCGGAGGCAGAGCGG - Intergenic
1064225304 10:13478322-13478344 GGGGAACAGCAGATGCAGGGAGG - Intronic
1064264641 10:13815641-13815663 CAGGGTCAACAGAGGTAGAGTGG - Intronic
1064476617 10:15696917-15696939 GAGGATCAGTTGAGCCTGAGAGG + Intronic
1065386444 10:25138340-25138362 GAGGATCACCGGAGCCTGAGAGG - Intergenic
1065588362 10:27241441-27241463 GAGGAGCAGCCGAAGGAGAGAGG + Intronic
1066406955 10:35127291-35127313 GTGGAGCAGCAGAGGCCGAGCGG + Intronic
1067125822 10:43514607-43514629 GATGGACAGCAGAGGCAAAGTGG - Intergenic
1067130895 10:43564617-43564639 GAGGATCACCTAAGCCAGAGAGG - Intronic
1067150988 10:43733711-43733733 GAAAATTACCAGAGGCAGAGAGG + Intergenic
1067281225 10:44874762-44874784 GAGGAACTGAAGAGTCAGAGGGG - Intergenic
1067344533 10:45428001-45428023 GAGGTGCTGCAGAAGCAGAGGGG - Intronic
1067478645 10:46581783-46581805 GAGGCTCAGCAGAGACGGATGGG + Intronic
1067616092 10:47760018-47760040 GAGGCTCAGCAGAGACGGATGGG - Intergenic
1067674284 10:48357481-48357503 GAGGATCACCTGAGCCCGAGAGG - Intronic
1067742138 10:48903644-48903666 GAGGATGATCAGAGAAAGAGTGG + Intronic
1067825642 10:49570708-49570730 GATGAGCAGCAGAGGCTGAGAGG - Intergenic
1068357188 10:55923806-55923828 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1068580521 10:58734144-58734166 GAAGATAATCAGAGGCAGGGTGG - Intronic
1068654561 10:59561361-59561383 AATTATCAGCAGAGGCTGAGTGG - Intergenic
1068740428 10:60462991-60463013 GAGGATCACCAGAGCCTGGGAGG - Intronic
1068900525 10:62264739-62264761 TAGAATCATCTGAGGCAGAGAGG + Intronic
1069185430 10:65416998-65417020 GTGGAACAGCATATGCAGAGAGG - Intergenic
1069836072 10:71308958-71308980 GAGGAGGAGAAGAGGCAGTGTGG - Intergenic
1070213086 10:74347277-74347299 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1070765106 10:79051936-79051958 GAGGAGCAACAGAGGAGGAGTGG + Intergenic
1070891431 10:79944589-79944611 GAGGAGCAGCAGGGGTACAGGGG + Intronic
1071441591 10:85702758-85702780 GAGGATAAACGGAGGCAGAGAGG + Intronic
1071496599 10:86171577-86171599 GAGGTTCTGCAGAGGCAGGTAGG + Intronic
1071844275 10:89505596-89505618 GAGGGTGAGCCGAAGCAGAGTGG + Intronic
1071982202 10:91014614-91014636 GAGGATCAACAGAGCCTGGGAGG + Intergenic
1072281092 10:93866013-93866035 GAGGATCACCTGAGCCCGAGAGG + Intergenic
1072325210 10:94291451-94291473 GAGACTCAGCTGAGGAAGAGAGG + Intronic
1072493788 10:95934683-95934705 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1072616656 10:97054088-97054110 GAGGCTCACCAGAAGCCGAGCGG - Intronic
1072806378 10:98426156-98426178 CAGGAGCAGCTGAGGGAGAGGGG - Intronic
1072822953 10:98576525-98576547 GAGGACAAGGAGAAGCAGAGAGG + Intronic
1072936190 10:99716079-99716101 GAGGATCACCTGAGCCAGGGAGG - Intronic
1072953664 10:99870273-99870295 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1073051528 10:100670441-100670463 TAGGGGCACCAGAGGCAGAGAGG - Intergenic
1073206944 10:101774584-101774606 GAGGGTCAGCTGGGGAAGAGAGG - Intronic
1073255903 10:102151208-102151230 GAGGATCAACTGAGCCAGGGAGG - Intergenic
1073297415 10:102449737-102449759 GAGGATCACCTGAGCCCGAGAGG - Intergenic
1073299140 10:102460226-102460248 GAGGATCATCTGAGCCAGGGAGG + Intergenic
1073374262 10:103019177-103019199 GAGGATCACCTGAGCCAGGGAGG + Intronic
1073977796 10:109119983-109120005 GAGGATGTGTATAGGCAGAGTGG - Intergenic
1074015463 10:109529867-109529889 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1074417336 10:113278665-113278687 GAGGATCTGAAGAGGCAGATGGG + Intergenic
1074540625 10:114362555-114362577 TAGAATCAGCAGAGGGAGCGCGG + Intronic
1074858646 10:117492276-117492298 GTGGATCTGGAGAGGCTGAGAGG + Intergenic
1075175387 10:120155855-120155877 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1075285715 10:121184180-121184202 GAGAATGAGAAGAGGCACAGGGG - Intergenic
1075563271 10:123483776-123483798 GAGGAAGAGAAGAGGTAGAGGGG + Intergenic
1076667921 10:132103355-132103377 GAGGAACATCAGGGGGAGAGAGG + Intergenic
1076778278 10:132709998-132710020 CAGCATCAGCTGAGGCTGAGGGG + Intronic
1077061843 11:620992-621014 CAGGATCAGGAGAGGAAGGGCGG - Intronic
1077378077 11:2214961-2214983 GAGGATGAGCAGAGGCAGAGTGG - Intergenic
1077481500 11:2816936-2816958 GGGGACCTCCAGAGGCAGAGGGG - Intronic
1077774834 11:5259017-5259039 AAGCATCAGCAGAGGCAGTCAGG - Intronic
1078125242 11:8555230-8555252 GATGATTACCAGAGGCTGAGGGG + Intronic
1078267859 11:9768306-9768328 GAGAATAAGATGAGGCAGAGGGG - Intergenic
1078364741 11:10697234-10697256 GGGGCCCAGCAGAGGCAGACTGG + Intergenic
1078392987 11:10952555-10952577 GAGGGTCAGCCGAAGCAGGGTGG - Intergenic
1078999630 11:16740490-16740512 GAGGATCACCTGAGCCAGGGAGG - Intronic
1079867821 11:25758137-25758159 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1080424210 11:32141382-32141404 GAGGATCACCTGAGGCAGGGAGG - Intergenic
1080709982 11:34737670-34737692 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081118198 11:39231917-39231939 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081252436 11:40851431-40851453 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1081465804 11:43315728-43315750 AAGGAGTAGCAGAGGCAGAGTGG - Intronic
1081492266 11:43578005-43578027 GAAGATTATCAGAGGCAGAGGGG + Intronic
1081691826 11:45083520-45083542 GAGGATAGACAGAGGCAGTGGGG + Intergenic
1081805739 11:45889559-45889581 GAGGAACAGCAGAGACAAAGGGG + Intronic
1081868452 11:46372356-46372378 TGGGAGCAGCAGAGGGAGAGGGG - Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1082814894 11:57501193-57501215 GAGGATCCCCAGTGGCAGGGTGG + Exonic
1082872225 11:57953829-57953851 GAGGTTGAGCAGAAGCAGGGTGG - Intergenic
1082876400 11:57992971-57992993 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1083346999 11:62000855-62000877 AAGTCTCAACAGAGGCAGAGTGG - Intergenic
1083376855 11:62230487-62230509 GAGGATCACCTGAGCCAGGGAGG + Intergenic
1083649933 11:64196834-64196856 GAGGATGAGAAGCGGCTGAGTGG - Intronic
1083662190 11:64256584-64256606 GAGGATCAGCAGGGTCAGCTGGG - Intronic
1083749672 11:64754217-64754239 GAGCATCAGATGGGGCAGAGGGG + Intronic
1083774111 11:64884827-64884849 GAGGATCACCTGAGCCAGGGAGG + Intronic
1083894798 11:65614399-65614421 GCGGGCCAGGAGAGGCAGAGAGG + Intronic
1083919929 11:65777022-65777044 GAGGATCACCTGAGCCTGAGAGG + Exonic
1083941131 11:65896550-65896572 TAGGACTGGCAGAGGCAGAGAGG - Intronic
1084030457 11:66477828-66477850 GAGCATCTCCAGAGGCAGAGAGG + Intergenic
1084601515 11:70148630-70148652 GAAAATCAGCAGAGGCTGAGGGG - Intronic
1084919473 11:72457615-72457637 GAGGATCAGCAGACAAAGAATGG + Intergenic
1085024645 11:73229440-73229462 CAGGGTCAGGAGAGGCAGAAGGG + Intronic
1085029185 11:73259317-73259339 GAGGATCACCAGAGCCCGGGAGG + Intergenic
1085104618 11:73831406-73831428 GAGCATGTGCAAAGGCAGAGAGG - Intronic
1085104902 11:73833944-73833966 GAGGATTACCTGAGCCAGAGAGG - Intronic
1085287340 11:75372147-75372169 GAGGAGCAGGAGGGGCAGATGGG + Intergenic
1085450711 11:76630416-76630438 CAGGAACAGCAAATGCAGAGAGG - Intergenic
1085499305 11:77004666-77004688 GAAGATTATCAGAGTCAGAGAGG - Intronic
1085571305 11:77560205-77560227 GAGGATCAGCAGAAGCCAAAAGG - Intronic
1085814876 11:79727313-79727335 GAGAAGCAGCAGTGGCAGCGCGG + Intergenic
1086279225 11:85166503-85166525 GAGGATCAGCACAGGCTGTGTGG - Intronic
1087127485 11:94641894-94641916 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1087128292 11:94647196-94647218 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1087373832 11:97319021-97319043 GATGGACAGCAGAGGCAAAGTGG + Intergenic
1088078379 11:105879186-105879208 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1088494929 11:110423168-110423190 GATGATCAGCAGAGACCTAGAGG + Intergenic
1088724134 11:112619608-112619630 GAGGCCCAGCAAAGGCAGGGTGG + Intergenic
1088741425 11:112770471-112770493 GAGGATAAGGAGAGGTAGAAGGG - Intergenic
1088850270 11:113698505-113698527 GACAATCAGGAGAGGGAGAGTGG + Intronic
1089061564 11:115630211-115630233 GGGGGTCAGAAGAGGGAGAGGGG - Intergenic
1089196448 11:116696403-116696425 GAGGGACAGAGGAGGCAGAGAGG - Intergenic
1089210780 11:116800460-116800482 GAGGATCACCAGAGCCTGGGAGG + Intergenic
1089529249 11:119116011-119116033 GAGGGGAAGCTGAGGCAGAGAGG - Intronic
1089807115 11:121100607-121100629 GAGGGTCACTGGAGGCAGAGGGG - Intergenic
1089809867 11:121122761-121122783 GAGGATCACTGGAGCCAGAGAGG + Intronic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090228265 11:125084471-125084493 GAGGGTCAGCAGAGGCACCTTGG + Intronic
1090509770 11:127362913-127362935 GTGGAGCAGCAGAGGAGGAGAGG - Intergenic
1090811620 11:130249640-130249662 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1091105336 11:132913898-132913920 GAGCTGCAGCAGAGGCAGAGAGG - Intronic
1091356467 11:134941570-134941592 GAGGAGGAGCTCAGGCAGAGTGG - Intergenic
1091730733 12:2878080-2878102 AAGGATCACCTGAGGCCGAGAGG + Intronic
1091884787 12:4008681-4008703 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1092006014 12:5071171-5071193 GTAGCTCAGAAGAGGCAGAGGGG - Intergenic
1092381109 12:7997801-7997823 AATGAACAGCAGAGGCAAAGTGG + Intergenic
1092398876 12:8154208-8154230 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1092440320 12:8495749-8495771 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1092513997 12:9188550-9188572 GGGCATCAGCATAGGAAGAGAGG + Intronic
1092637479 12:10467195-10467217 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1092758268 12:11785104-11785126 GAGGATAGGAAGAGGGAGAGTGG + Intronic
1093016546 12:14161149-14161171 GAGGGTCAGGAGAGGGAGGGGGG + Intergenic
1093215530 12:16357347-16357369 GAGGATCACCTGAGCCCGAGAGG - Intronic
1093774493 12:23056627-23056649 GAGGATCACCTGAGTCAGAGAGG + Intergenic
1093891565 12:24527349-24527371 AAGGATCAGAAGAGAGAGAGAGG + Intergenic
1094144919 12:27218823-27218845 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1094614587 12:32024573-32024595 GAGGATCAGTTGAGCCAGGGAGG + Intergenic
1094749370 12:33387837-33387859 GAGGATCACCTGAGCCCGAGAGG - Intronic
1094751879 12:33418964-33418986 GAGAAAAAGCAGAGGTAGAGGGG - Intronic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095511867 12:42959817-42959839 GAAGATAAGCAGAAGAAGAGAGG - Intergenic
1095513201 12:42976085-42976107 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1095898317 12:47302764-47302786 GAGAAACAGCAGATGCAGAAAGG + Intergenic
1095920699 12:47526870-47526892 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1096234463 12:49916831-49916853 GAGGATCACTGGAGCCAGAGAGG - Intergenic
1096515536 12:52153227-52153249 CAGGGTCAGCAGAGGCTGAGGGG - Intergenic
1096550253 12:52367411-52367433 GAGGCTGAGCAGAGTCTGAGAGG + Exonic
1096666538 12:53170088-53170110 GAGGATCTGGAGAGGCAGATTGG - Exonic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1097713867 12:62944443-62944465 GAGATTCAGCAGATGCAGAAAGG - Intergenic
1097738615 12:63211866-63211888 GATGATGAGCAGAGGTATAGTGG + Intergenic
1097855829 12:64460989-64461011 GAGGATCACCTGAGCCTGAGAGG + Intronic
1098139785 12:67439797-67439819 TGAGACCAGCAGAGGCAGAGAGG - Intergenic
1098334996 12:69394695-69394717 GAGGATCACCTGAGCCAGAAAGG - Intergenic
1098336558 12:69411217-69411239 GAGGATCACCTGAGCCAGAGAGG - Intergenic
1098374147 12:69795364-69795386 AAGTATCAACAGAGTCAGAGGGG - Intronic
1098426660 12:70372041-70372063 GGGGATGAGCAGAGACAGAAGGG + Intronic
1098517308 12:71392174-71392196 GAGGATGACCTGAGCCAGAGAGG + Intronic
1099022610 12:77424846-77424868 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
1099071449 12:78049504-78049526 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1099253801 12:80290186-80290208 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
1099341140 12:81436189-81436211 GAGGATCACCTGAGGCTAAGAGG + Intronic
1099373074 12:81862123-81862145 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1099415128 12:82375102-82375124 GAGAATCAGCAGAGGAAGCTGGG + Intronic
1099932891 12:89093818-89093840 GTCAATCAGCAGAGACAGAGAGG + Intergenic
1099982940 12:89628064-89628086 GAGGAAGAGCAGGGGTAGAGAGG + Intronic
1100089630 12:90954375-90954397 GAGCAGCAGCAAAAGCAGAGAGG + Exonic
1100191005 12:92191639-92191661 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1100492061 12:95090231-95090253 CAGCATGAGCAAAGGCAGAGAGG + Intronic
1100817854 12:98403159-98403181 GAGGATGAGCAGAAACACAGTGG + Intergenic
1101454398 12:104815000-104815022 GAGAATGTGCAAAGGCAGAGAGG - Intronic
1101755344 12:107617072-107617094 GAGGAGCTGCAGAGGAAGAGCGG - Exonic
1102717000 12:114982512-114982534 GAGGATCATCTGAGGCTGGGAGG + Intergenic
1103169238 12:118799447-118799469 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1103494519 12:121351281-121351303 GAGGATCACCTGAGCCTGAGAGG + Intronic
1103599628 12:122046245-122046267 GAGGGACAGCAGTGGCTGAGCGG + Intronic
1103606289 12:122088179-122088201 GAGGGACAGCAGAGGGGGAGGGG - Intronic
1103614425 12:122143164-122143186 GAGGGTGAGGAGAGGCAGGGAGG - Exonic
1103747604 12:123136446-123136468 GAAGATAAGCTGAGGCCGAGGGG - Intronic
1103810411 12:123609041-123609063 GAGGATCATCTGAGCCCGAGAGG - Intronic
1104462401 12:128966359-128966381 GCAGAGCAGCAAAGGCAGAGTGG - Intronic
1105010614 12:132753839-132753861 GAGGATCACCTGAGCCAGAAAGG + Intronic
1105028406 12:132865442-132865464 GAGGATCACCTGAGGCTGGGAGG - Intronic
1105032919 12:132897140-132897162 GAGGATCCACAGAGGAAGAAGGG - Intronic
1105325725 13:19369246-19369268 GAGGATCACCCGAGCAAGAGAGG + Intergenic
1105704830 13:22962356-22962378 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105857791 13:24387514-24387536 TGGGAGCAGCAGGGGCAGAGAGG + Intergenic
1105867778 13:24475872-24475894 GAGGATCACCTGAGCCAGAGAGG - Intronic
1106429339 13:29665429-29665451 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1106637603 13:31545534-31545556 GAGGATCTGGAGAGCCAGATAGG + Intergenic
1106874309 13:34055080-34055102 GAGGGTGAGCAGAAGCAGAATGG - Intergenic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1107875796 13:44789751-44789773 CAGGATGAGCAGCTGCAGAGAGG - Intergenic
1108219595 13:48219300-48219322 GAGGATCACCTGAGGCTGGGAGG + Intergenic
1108262879 13:48675943-48675965 GGGGGTGAGCAGAAGCAGAGTGG - Intronic
1108490299 13:50975036-50975058 GAGGGTCTGCAGAGGAAGTGTGG - Intergenic
1108850197 13:54718706-54718728 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
1108940488 13:55947500-55947522 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1109293661 13:60504784-60504806 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1109457570 13:62612017-62612039 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1109661682 13:65467716-65467738 GAGGGCGAGCAGAAGCAGAGCGG - Intergenic
1109731468 13:66419500-66419522 GAGGGCAAGCAGAAGCAGAGTGG + Intronic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110824598 13:79957955-79957977 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1110855090 13:80287982-80288004 GAGGATCATCTGAGACAGGGAGG - Intergenic
1111020020 13:82437329-82437351 GTGGATCAGGAGAGAGAGAGTGG - Intergenic
1111708313 13:91779448-91779470 GAGGATCACCTGAGCCAGGGTGG - Intronic
1111821452 13:93220970-93220992 GAGGATCACCAGAGCCTGGGAGG - Intergenic
1111964500 13:94847207-94847229 GAGGATCACCTGAGCCCGAGAGG + Intergenic
1112165766 13:96918541-96918563 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1112337057 13:98524497-98524519 TGGGTTCAGCAGAGGCAGCGAGG - Intronic
1112397716 13:99048344-99048366 GAAGATGAGCAGTAGCAGAGGGG - Intronic
1112810796 13:103216377-103216399 GAGGAGGAGCACAGCCAGAGTGG - Intergenic
1113069072 13:106401468-106401490 GAGGAAGAGCAAAGGCAGAGTGG + Intergenic
1113300974 13:109018792-109018814 GAGGGTGAGCTGAAGCAGAGCGG - Intronic
1113346045 13:109479635-109479657 GAGCACCAGCAGAGGCATTGTGG - Intergenic
1113546296 13:111153724-111153746 GAGGAGAAGCAGCGGCTGAGCGG + Intronic
1113772157 13:112917210-112917232 GAGGCTCTGCGGAGGCAGGGCGG - Intronic
1114052349 14:18931045-18931067 GAGGATCAGTTGTGCCAGAGAGG + Intergenic
1114110209 14:19470880-19470902 GAGGATCAGTTGTGCCAGAGAGG - Intergenic
1114161398 14:20171844-20171866 GAGGATCACCTGAGCCAGAAAGG + Intergenic
1114530064 14:23389895-23389917 GAGGGTGAGGAGAGCCAGAGAGG + Intronic
1114556387 14:23564765-23564787 GAGGATCATCAGAGCCTGGGAGG - Intronic
1114664404 14:24369464-24369486 GAAGAGGAGCAGAGGGAGAGGGG - Intronic
1114771284 14:25430635-25430657 GAGAATCAGCAAAGGGAGATAGG + Intergenic
1114844817 14:26308758-26308780 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1115256163 14:31404822-31404844 GAGGATCACTTGAGCCAGAGAGG + Intronic
1115319858 14:32068207-32068229 GAGGATCACCTGAGGCCAAGAGG + Intergenic
1115357083 14:32460429-32460451 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1115480013 14:33851433-33851455 GAGGATGAGCAGAGGTAGGGGGG + Intergenic
1115692922 14:35864349-35864371 GAGGATCACCTGAGCCCGAGAGG - Intronic
1115772711 14:36682999-36683021 GAGGAACTGCAAAGGGAGAGAGG + Intronic
1115856406 14:37633809-37633831 TGGGATCAGCAGAGGCCTAGTGG + Intronic
1116003614 14:39269607-39269629 GAGGATCACCTGAGCCAGAGAGG - Intronic
1116272848 14:42794770-42794792 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1116401813 14:44516134-44516156 GAGGGTCAGCTGAAGCAGGGCGG - Intergenic
1116455033 14:45110208-45110230 GAGGAACAGCAGGGTAAGAGTGG + Exonic
1116565323 14:46438329-46438351 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1117120976 14:52568149-52568171 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1117490750 14:56244592-56244614 GAGGATGAGCATTAGCAGAGTGG - Intronic
1117624134 14:57618382-57618404 GAGGGTAAGCAGAAGCAGGGTGG + Intronic
1117836873 14:59816841-59816863 GAGGATCACCTGAGCCTGAGAGG + Intronic
1117850145 14:59958904-59958926 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1118582789 14:67320375-67320397 GAGGAACTGCAGATGCAAAGCGG - Exonic
1118604069 14:67490312-67490334 GAGAATGAAGAGAGGCAGAGTGG + Intronic
1119078311 14:71667217-71667239 GAGGAGCAGCATGTGCAGAGCGG - Intronic
1119531214 14:75362595-75362617 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1119805626 14:77480194-77480216 GAGGATCATCTGAGCCAGGGAGG + Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120250875 14:82060998-82061020 GAGAATCAGCAAAGGGAGACAGG + Intergenic
1120624964 14:86813768-86813790 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1120993291 14:90397194-90397216 GAGGAAGAGCAGAGGGAGCGAGG - Exonic
1121645123 14:95513148-95513170 GAGGATCAGGAGAGTCGGGGGGG - Intergenic
1121726829 14:96158465-96158487 GAGGATGAACAGAGGTAGAAGGG + Intergenic
1121815809 14:96927557-96927579 GTGGAGCTGCAGAGGCAGACAGG + Intronic
1122194225 14:100073157-100073179 GAGTGTCAGCAAAGGCAGAGTGG - Intronic
1122199519 14:100114005-100114027 TGGGATAAGCGGAGGCAGAGAGG + Intronic
1122529013 14:102411625-102411647 GAGAGTCAGCAGAGGGAGATAGG - Intronic
1122630497 14:103105521-103105543 AAGGCTGAGCAGAGGCCGAGGGG + Intronic
1122642275 14:103166986-103167008 GAGGCTCAGGAGAGAGAGAGAGG + Intergenic
1123761285 15:23434800-23434822 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124199148 15:27661816-27661838 GAGGATCAGCTGAGTCTGGGAGG + Intergenic
1124268009 15:28254728-28254750 GAGCATCAGCAGAGGCAGCCTGG - Intronic
1124277222 15:28336194-28336216 GAGCATCAGCAGAGGCAGCCTGG + Intergenic
1124305479 15:28575412-28575434 GAGCATCAGCAGAGGCAGCCTGG - Intergenic
1124820893 15:33044635-33044657 GAGGATGACCAGCTGCAGAGAGG + Intronic
1124971179 15:34490678-34490700 GAGGAGCAGCAGAGGCGGTCGGG - Intergenic
1125483609 15:40097437-40097459 GAGTATCACATGAGGCAGAGCGG + Intronic
1125660370 15:41389681-41389703 GAGGATCACCTGAGGCTGGGAGG + Intronic
1126254621 15:46611177-46611199 GAAAATCAGCAGAGACACAGAGG - Intergenic
1126743416 15:51800793-51800815 GAGGATCACTTGAGCCAGAGAGG - Intronic
1126869912 15:52976691-52976713 GAAGAACAGCAGCTGCAGAGTGG - Intergenic
1127867952 15:63047219-63047241 GAGTCTCAGCAGAGGCTGTGAGG + Intronic
1127961555 15:63894405-63894427 CAGCATCAGCAGGGTCAGAGAGG + Intergenic
1128147304 15:65338990-65339012 GAGGATCACCTGAGCCTGAGAGG - Intronic
1128417097 15:67456983-67457005 TAGGATTAACAGAGACAGAGGGG + Intronic
1128486855 15:68100983-68101005 GAGGATCACCTGAGCCAGGGAGG - Intronic
1128512478 15:68321937-68321959 GAGGAATAGAAGAGGCAGAGAGG + Intronic
1128720400 15:69943517-69943539 GAGGCACAGCAGAGGCGGGGGGG + Intergenic
1128857595 15:71032273-71032295 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1129166415 15:73780738-73780760 GAGAGCCAGCAGAGGCAGGGGGG + Intergenic
1129353163 15:74969394-74969416 GAGGATCACCTGAGCCTGAGAGG - Intronic
1129446112 15:75619550-75619572 GAGGATCACCTGAGCCTGAGAGG + Intronic
1129454625 15:75670126-75670148 GAGGAGCAGGGGAGCCAGAGTGG + Intergenic
1130584439 15:85169540-85169562 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1130897648 15:88183507-88183529 GAGGATCAGCAGAGCTCAAGTGG + Intronic
1131141880 15:89983254-89983276 GAGGATCACCAGAATCAGGGAGG - Intergenic
1131355608 15:91743149-91743171 GAGGAGCAGCAGAGCTCGAGGGG - Intergenic
1131380241 15:91957508-91957530 GAGGAACAACAGAGCCAGTGTGG - Intronic
1131654426 15:94440907-94440929 CAGGAGCAGGAGAGTCAGAGTGG - Intronic
1131873921 15:96784956-96784978 GAGGATAATTAGAGGCAGAATGG - Intronic
1132311465 15:100860989-100861011 GAGGAGCAGAACAGGCACAGAGG - Intergenic
1132378412 15:101348176-101348198 GAGGAGCAGCGGAGGCGCAGGGG - Intronic
1132400292 15:101501078-101501100 CAGGAGGAGAAGAGGCAGAGGGG + Intronic
1132831490 16:1930350-1930372 GAGGAACAGCAGACTCTGAGGGG - Intergenic
1133404779 16:5514762-5514784 GGGAATCAGAAGAGGGAGAGAGG + Intergenic
1133485551 16:6215195-6215217 GAGGATAAGGAGAGGGAGAGGGG + Intronic
1133721447 16:8498239-8498261 CATGATCTGCAGAAGCAGAGCGG - Intergenic
1134074427 16:11280763-11280785 GGGGATGAGCAGAGGGGGAGAGG - Intronic
1134631214 16:15757417-15757439 GAGGATCACTTGAGGCAGGGAGG + Intronic
1135069397 16:19338922-19338944 GAGGATCATCTGAGCCTGAGAGG - Intergenic
1135512026 16:23094017-23094039 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
1135716286 16:24771313-24771335 GTGAGTCAGCAGAGGCAGTGTGG + Intronic
1135915079 16:26598147-26598169 GGAGATAACCAGAGGCAGAGGGG - Intergenic
1136050388 16:27646059-27646081 TAGCATAAGCAGAGGCACAGAGG + Intronic
1136286262 16:29244774-29244796 GAGCATCATCAGAGACAAAGAGG - Intergenic
1136286860 16:29249212-29249234 ATGGGACAGCAGAGGCAGAGTGG - Intergenic
1136456068 16:30380389-30380411 GAGGATCACCTGAGCCTGAGAGG - Intronic
1136622309 16:31437391-31437413 GAGGATCACTTGAGCCAGAGAGG - Intronic
1136751711 16:32642348-32642370 GAGGATCACTTGAGGCAGGGAGG + Intergenic
1137536261 16:49329077-49329099 GAAGACCACCAGAAGCAGAGAGG + Intergenic
1137551083 16:49438052-49438074 GATGGTGAGCAGAGGCATAGAGG + Intergenic
1138151468 16:54661507-54661529 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1138298514 16:55907656-55907678 GTGGACCAGCATAGTCAGAGAGG + Intronic
1138461587 16:57151546-57151568 GAGGAGCAGCAGAAACAGTGGGG + Intergenic
1138650644 16:58459062-58459084 GAAGATCAGCAGATGGAGATGGG - Intergenic
1138669942 16:58605746-58605768 GAGGATCATCTGAGTCAGGGAGG - Intronic
1138886830 16:61090613-61090635 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1139637361 16:68265804-68265826 GAGGACAAGGAGAGGAAGAGAGG - Intronic
1139734138 16:68972884-68972906 GAGCAGCAGCAGATGCAGAGGGG + Intronic
1139736002 16:68988953-68988975 GAGGATCACCTGAGGCTGCGAGG - Intronic
1140724406 16:77799190-77799212 GAGGACCGGGAGAGGAAGAGAGG - Intronic
1140798139 16:78459892-78459914 GAGGATCACCTGAGCCAGGGTGG - Intronic
1140805525 16:78529041-78529063 GAGGATCACTGGAGCCAGAGAGG - Intronic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141413223 16:83850582-83850604 GAGGATCACCTGAGACTGAGAGG + Intergenic
1141435246 16:83996180-83996202 GAGGATGAGGAGAGGCACTGTGG - Intronic
1142091606 16:88214970-88214992 GAGCATCATCAGAGACAAAGAGG - Intergenic
1142092459 16:88221847-88221869 ACGGGACAGCAGAGGCAGAGTGG - Intergenic
1142252408 16:88998383-88998405 GAGGATCAGCTGAGCCTGAAAGG + Intergenic
1142455335 16:90218016-90218038 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1203053847 16_KI270728v1_random:901602-901624 GAGGATCACTTGAGGCAGGGAGG + Intergenic
1142628271 17:1206160-1206182 GAGGATCACTTGAGCCAGAGAGG + Intronic
1142751366 17:1990133-1990155 GAGGATCACCTGAGGCCAAGAGG + Intronic
1143360823 17:6369223-6369245 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1143391776 17:6563074-6563096 GGGGATCTGGAGAGGCTGAGGGG + Intergenic
1143738197 17:8929442-8929464 GAGAATTACCAGAAGCAGAGAGG + Intronic
1144028697 17:11301117-11301139 CGGGCTCAGCACAGGCAGAGAGG - Intronic
1144630962 17:16872258-16872280 GAGGATGAGAAGACACAGAGAGG + Intergenic
1144650352 17:17003218-17003240 GAGGATGAGAAGACACAGAGAGG - Intergenic
1144665117 17:17097090-17097112 CAGGATCAGCCAAAGCAGAGGGG + Intronic
1145079943 17:19886524-19886546 GAGGATCAGCTGAGGCCAGGAGG - Intergenic
1145311280 17:21702372-21702394 GGCCATCGGCAGAGGCAGAGAGG + Intronic
1145398909 17:22515741-22515763 GGGGATGACCAGAGGCAGGGAGG + Intergenic
1145894055 17:28441652-28441674 GAGGATCACCAGAGCCTGGGAGG - Intergenic
1146126682 17:30236546-30236568 GAGGATCAGCTGAGCCCGGGAGG + Intergenic
1146194897 17:30803073-30803095 GAGGATCACCTGAGCCAGGGAGG + Intronic
1146293525 17:31630448-31630470 GAGGATAAGCAGAGGCACTGGGG - Intergenic
1146464272 17:33073905-33073927 GAGGGACAGAAGAGGGAGAGGGG + Intronic
1146501918 17:33372075-33372097 CAGCTTCAGGAGAGGCAGAGAGG - Intronic
1147732871 17:42614714-42614736 CAGGGCCAGCAGATGCAGAGAGG - Intronic
1147804852 17:43123812-43123834 GAGGAGTGGGAGAGGCAGAGTGG + Intronic
1147810722 17:43167963-43167985 GAGGAGTGGGAGAGGCAGAGTGG + Intergenic
1147961165 17:44168465-44168487 GAGGAGCCCCAGATGCAGAGGGG + Intergenic
1147964826 17:44188980-44189002 CAGCATCAGCAGAGCCTGAGGGG - Intronic
1148444388 17:47728647-47728669 GAAAGTCTGCAGAGGCAGAGAGG - Intergenic
1148835760 17:50464943-50464965 GTGCATCAGCAGAGGCTGTGGGG + Exonic
1148944606 17:51249168-51249190 GAGGATCACCTGAGGCAGGGAGG + Intronic
1148980960 17:51574551-51574573 GAGGGCCAGCAGAAGCAGAGTGG + Intergenic
1149281358 17:55108703-55108725 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1149485913 17:57042733-57042755 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1149508899 17:57220777-57220799 GAGGATCACCTGAGGCCGGGAGG - Intergenic
1149866416 17:60153690-60153712 GAGACTGAGCAAAGGCAGAGCGG + Intronic
1149939369 17:60846686-60846708 GAAAATAAGCAGAGACAGAGAGG - Intronic
1150031034 17:61735709-61735731 GAGGATCACCTGAGCCCGAGAGG + Intronic
1150032832 17:61757901-61757923 GAGGATCACCTGAGCCAGGGAGG + Intronic
1150442287 17:65201296-65201318 GAGCATCACCTGAGCCAGAGGGG - Intronic
1150599582 17:66639144-66639166 GAGCAGCTGCAAAGGCAGAGTGG - Intronic
1150945642 17:69743032-69743054 GAGCATCAGCTGTGGCAGTGTGG + Intergenic
1151032234 17:70754602-70754624 GAGGATCAGCAGGGCCAAATGGG + Intergenic
1151037845 17:70821949-70821971 AATGAACAGCAGAGGCAAAGCGG - Intergenic
1151583249 17:74992131-74992153 GAGACTCAGCAAAGGGAGAGGGG - Intronic
1151678693 17:75613118-75613140 GATGAACAGCAGAGCCAGCGTGG + Intergenic
1152045493 17:77932399-77932421 GAGGATCACTTGAGGCTGAGAGG - Intergenic
1152156981 17:78640834-78640856 GAGGATCACCTGAGCCAGGGAGG + Intergenic
1152215258 17:79028155-79028177 GAGGAGGAGAAGAGGCAGACAGG + Intronic
1152297513 17:79476722-79476744 GAGGATAGGCAGAGGCAGGGTGG + Intronic
1152491075 17:80635140-80635162 GAGGAGCAGCAATGGCAGAGAGG - Intronic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1152717433 17:81906733-81906755 GGGGAGCAGCAGAGGCCCAGAGG + Intronic
1152823663 17:82450190-82450212 GAGGATCACCTGAGGCCGGGAGG + Intronic
1153119114 18:1700113-1700135 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1153484474 18:5582866-5582888 GAGCGTCAGCAGAGGCAGTGAGG + Intronic
1153498188 18:5721607-5721629 GGGGGTCAGCAGAGGCTCAGTGG - Intergenic
1153580771 18:6571352-6571374 GAGGACTAGCAGGGGCACAGGGG - Intronic
1153684347 18:7529977-7529999 GATGATGAACAAAGGCAGAGAGG - Intergenic
1153796392 18:8626758-8626780 GAGAATCAGGAGAGGGAGAGGGG - Intronic
1154096091 18:11416546-11416568 GAGGCTGAGCAGCTGCAGAGAGG - Intergenic
1154137753 18:11795309-11795331 GAGGATCACCTGAGCCAGGGAGG + Intronic
1154498180 18:14977734-14977756 GAGGAGGAGCTCAGGCAGAGTGG + Intergenic
1154939262 18:21094657-21094679 GAGAATCATCTGAGCCAGAGAGG + Intronic
1155252351 18:23964628-23964650 GAGCACAAGCAGAGGCACAGAGG + Intergenic
1155294131 18:24370129-24370151 GAGGATCACCAGAGCCCAAGAGG + Intronic
1155433369 18:25785615-25785637 CGGCATCAGCAGAGGCAGAGGGG - Intergenic
1155659333 18:28228969-28228991 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1156353745 18:36323171-36323193 GAGGAGGAGCAGAGGCAGCCGGG - Intronic
1156870411 18:41939022-41939044 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1157227924 18:45884497-45884519 CAGGTACAGCAGAGGCTGAGAGG - Intronic
1157411059 18:47463948-47463970 CAGAATCAGGAGAGGGAGAGTGG - Intergenic
1157478545 18:48038271-48038293 GAGAATCTGCAGGAGCAGAGGGG - Intronic
1157718720 18:49907132-49907154 GAGGATCAGGAGAGCCAGGATGG + Intronic
1159047267 18:63381271-63381293 GAGGACCAGCATATGCAGATAGG - Intergenic
1159183785 18:64944433-64944455 GAGGATTAGTAGAGGCAGCATGG + Intergenic
1159901685 18:74053098-74053120 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1160356262 18:78230281-78230303 TGGGAGCACCAGAGGCAGAGAGG - Intergenic
1161094420 19:2381313-2381335 CAGGGTCAGCAGAGGCAGCTGGG + Intergenic
1161115826 19:2495887-2495909 GAGGAGGAGGAGAGGCAGGGCGG - Intergenic
1161817033 19:6505648-6505670 GAGGATCACCAGAGCCTGGGAGG - Intergenic
1161927664 19:7313124-7313146 GAGGCTCAGGAGAGACAGAATGG - Intergenic
1161947155 19:7444598-7444620 GAGGATCACCTGAGCCTGAGAGG - Intronic
1162191624 19:8951473-8951495 GAGGATCAGCTCAGCCACAGAGG - Exonic
1162209538 19:9080432-9080454 GAGGATCAGCAGAGGCCGGGAGG - Intergenic
1162395862 19:10417808-10417830 TGGGATCAGCAGCGGCAGGGTGG - Intronic
1162597754 19:11641922-11641944 GAGGATCACCTGAGCCAGGGAGG + Intergenic
1162803092 19:13121756-13121778 GAGGATCTGAGGACGCAGAGTGG - Intronic
1163140348 19:15343717-15343739 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1164249887 19:23467278-23467300 GAGGAGGAGAAGAGGAAGAGAGG - Intergenic
1164280417 19:23763556-23763578 GAGAATCACCAGAGCCTGAGAGG - Intronic
1164489159 19:28690743-28690765 GAGTATCAACAGAGGCTAAGGGG + Intergenic
1165204707 19:34173303-34173325 GAGGATGAGCCGAGGGAGATGGG - Intronic
1165800552 19:38546860-38546882 GAGGATCACCAGAGCCCGGGAGG + Intronic
1166087402 19:40486199-40486221 GAGGATCACCTGAGGCTGGGAGG + Intronic
1166287943 19:41844015-41844037 GAGGACCAGCAGAGAGAGGGAGG + Exonic
1166315801 19:41988751-41988773 GAGAGTCACCAGAGGCAGAAGGG - Intronic
1166337472 19:42117050-42117072 GAGGAGCAGAGAAGGCAGAGAGG + Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166703464 19:44895391-44895413 GAGGTGCAGCAGGTGCAGAGAGG + Intronic
1166867756 19:45851020-45851042 GAGGAGCAGGGGAGACAGAGAGG + Intronic
1167509799 19:49890016-49890038 GAGGACCAGCACAGCCAGGGTGG - Exonic
1167592723 19:50413286-50413308 GAGGCCCAGGAGGGGCAGAGTGG + Intronic
1167663739 19:50811566-50811588 GAGGATCATCCCAGGCAGTGAGG + Intergenic
1167663822 19:50811870-50811892 GAGGATCATCTCAGGCAGGGAGG + Intergenic
1167663826 19:50811889-50811911 GAGGATCATCCCAGGCAGGGAGG + Intergenic
1167663832 19:50811908-50811930 GAGGATCATCTCAGGCAGGGAGG + Intergenic
1167663843 19:50811946-50811968 GAGGATCATCTCAGGCAGGGAGG + Intergenic
1167731721 19:51262986-51263008 GAGGATCACCTGAGGTAGGGAGG - Intronic
1168249819 19:55135492-55135514 GAGGATCACTAGAGCCTGAGAGG - Intronic
1168524363 19:57077083-57077105 GAGGATCAGTTGAGCCTGAGAGG - Intergenic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925279242 2:2671149-2671171 GGGGATAAGCAGAGTCAGCGAGG + Intergenic
925334173 2:3080748-3080770 GAGGAGCTGCAGAAGCAGCGTGG + Intergenic
925485856 2:4329862-4329884 AAGGAACAGCAGATTCAGAGAGG - Intergenic
926111398 2:10186611-10186633 GATGAACAGCAGAGGCACAGAGG - Intronic
926156173 2:10455131-10455153 GAGAAACAGCAGAGGCACAGTGG + Intergenic
926191440 2:10731039-10731061 GAGGATCACTTGAGCCAGAGAGG - Intronic
926421012 2:12699392-12699414 GAGGATCAGGAGAAGGAGAAGGG + Intergenic
926590524 2:14735415-14735437 AAGCATCAGCAGAGCCAGAATGG - Intergenic
927102807 2:19800891-19800913 GAGGAGCACCAGGGTCAGAGAGG + Intergenic
927286839 2:21365897-21365919 GGGGATGAGGAGAAGCAGAGTGG - Intergenic
928009353 2:27593529-27593551 GAGGATCACTTGAGCCAGAGAGG + Intronic
928013570 2:27633393-27633415 GAGGATCACCTGAGCCAGGGAGG - Intronic
928098142 2:28418161-28418183 GAGGATCACCTGAGCCGGAGAGG - Intergenic
928157499 2:28890103-28890125 GAGGATCGCCTGAGCCAGAGAGG - Intergenic
928204061 2:29271647-29271669 GAGGACCTGCAGAGGCAGAATGG + Intronic
928536287 2:32244831-32244853 GAGGAGGAGGAGAGGGAGAGAGG + Intronic
928983027 2:37156020-37156042 GGGGAACAGCAAGGGCAGAGCGG + Intronic
929025782 2:37600164-37600186 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
929257833 2:39831267-39831289 GAGGGCAAGCAGAGGCTGAGTGG - Intergenic
929500115 2:42483029-42483051 GAGGATCGCCAGAGCCAGGGAGG + Intronic
929525709 2:42701210-42701232 GAGGATCACCTGAGCCTGAGAGG + Intronic
929536390 2:42786964-42786986 GAGGATAGGCAGGGACAGAGAGG + Intronic
929738550 2:44577527-44577549 GAGGATCATCTGAGTCTGAGAGG + Intronic
929870010 2:45751104-45751126 GAGTATAAGCAAAGGCACAGAGG - Intronic
930036971 2:47092436-47092458 GAGGATCACCTGAGCCACAGAGG + Intronic
930135216 2:47896417-47896439 GAGGATCATCTGAGCCAGGGAGG - Intronic
930155173 2:48099289-48099311 GAGTATCAACAGAGGTTGAGTGG + Intergenic
930158944 2:48133196-48133218 GAGGATCACCTGAGCCAGGGAGG + Intergenic
930198253 2:48530017-48530039 GAGGCTCAGCAGGGGAGGAGGGG + Intronic
930908959 2:56606797-56606819 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
930951248 2:57146391-57146413 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
931811285 2:65857291-65857313 GAGGATCACCTGAGCCTGAGAGG + Intergenic
932068184 2:68589126-68589148 GAGGGACAGAAGAGGCAGAGCGG + Intronic
932188690 2:69720450-69720472 GGGGAGGAGCAGAGGCAGTGAGG + Intronic
932212573 2:69944805-69944827 GAGGATCAGCAGTAGAGGAGGGG - Intergenic
932217332 2:69975397-69975419 GAGGAGCAGCACCGGCAGGGAGG - Intergenic
932232261 2:70092773-70092795 GAGGATCAGCTGAGTCGGGGAGG - Intergenic
932294023 2:70609408-70609430 GATGATCAGCAGAACCAAAGAGG + Intronic
932414684 2:71566524-71566546 GAGCACCAGCAGAGAGAGAGAGG + Intronic
932586376 2:73032302-73032324 TATGCTCAGCAGAGGCACAGAGG - Intronic
932819556 2:74887795-74887817 GTGCATCAGCAGTGGCAGACAGG - Intronic
933393762 2:81705979-81706001 GAGGTTCATTAGAGGCTGAGGGG + Intergenic
934037134 2:88097553-88097575 GGGGATCAGCACAGGCATGGAGG + Intronic
934677853 2:96262375-96262397 GAGGATCAGCACAGTCACACAGG + Intronic
934769431 2:96898562-96898584 GAGGATCACCTGAGCCAGGGAGG + Intronic
934776016 2:96937936-96937958 GAGGATCACCTGAGCCCGAGAGG + Intronic
935085786 2:99843370-99843392 GAGGATCAGAGGAGGCTCAGAGG - Intronic
935488005 2:103681803-103681825 GAGGATTTGCAGAGAAAGAGGGG + Intergenic
935593500 2:104862474-104862496 CCGGATCAGAAGAGGCGGAGGGG + Intergenic
935982724 2:108643343-108643365 GAGGATGAGCCGAAGCAGGGTGG + Intronic
936156704 2:110051633-110051655 GTGGATAAATAGAGGCAGAGAGG + Intergenic
936187988 2:110319811-110319833 GTGGATAAATAGAGGCAGAGAGG - Intergenic
936657520 2:114505513-114505535 GAGGAACAGCAGATGCAGGAAGG - Intronic
936900037 2:117472340-117472362 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
937089029 2:119193112-119193134 GGGGATGGGCAGAGGCAGACTGG + Intergenic
937455466 2:122037280-122037302 GATTTTCATCAGAGGCAGAGCGG + Intergenic
937465104 2:122125442-122125464 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
937573943 2:123396261-123396283 GAGGAGGAGGAGAGGAAGAGTGG - Intergenic
937679235 2:124626420-124626442 GAGAATGAGAAGAAGCAGAGTGG + Intronic
937998403 2:127712842-127712864 GAGGATCAGCTGAGGCCAGGAGG - Intronic
938081192 2:128371056-128371078 TAGGAACAGAAGAGGCAGGGTGG - Intergenic
938115532 2:128600796-128600818 GTGGCTCGGCAGAGGCAGAAAGG - Intergenic
938139021 2:128781643-128781665 GAAGAACAGCAGAGGCACTGAGG + Intergenic
938144658 2:128823534-128823556 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
938224357 2:129602877-129602899 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
938321647 2:130370211-130370233 GAGGGTCTGGTGAGGCAGAGGGG + Intronic
938376268 2:130808710-130808732 AGTGATCTGCAGAGGCAGAGTGG - Intergenic
938987311 2:136590382-136590404 GAGAAGCAGCAGAGAGAGAGAGG + Intergenic
939055510 2:137360385-137360407 GAGGGTGAGCTGAAGCAGAGTGG + Intronic
939179111 2:138783365-138783387 CAGAATGAGCAAAGGCAGAGTGG + Intergenic
939180306 2:138795794-138795816 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
939482650 2:142769075-142769097 GAGGGTCATAAGAGGCAGTGGGG - Intergenic
939938420 2:148320441-148320463 GAGGATCACCTGAGCCTGAGAGG - Intronic
940163648 2:150742952-150742974 GAAGTTCACCTGAGGCAGAGGGG - Intergenic
940236490 2:151516460-151516482 GAGTCTCAGCAGATGCAGAGTGG - Exonic
940380084 2:153004741-153004763 CAAGATCAGTAGAGACAGAGAGG - Intergenic
940563090 2:155326342-155326364 GAGGATCACTTGAGGCAGGGAGG + Intergenic
940825425 2:158406710-158406732 GAGGATCACCTGAGTCTGAGAGG - Intronic
940995800 2:160148620-160148642 GAGGGTGAGCAGAAGCAGGGCGG + Intronic
941454224 2:165696058-165696080 AATGAGCAGCAGAGCCAGAGTGG - Intergenic
941682420 2:168413339-168413361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
941886877 2:170537257-170537279 GAGGATCACCTGAGCCTGAGAGG + Intronic
941935084 2:170975658-170975680 GCAGAGCAGCAGAGGCAAAGTGG + Intergenic
942099049 2:172559934-172559956 GAGGATCACCTGAGCCAGGGAGG - Intronic
942199821 2:173559758-173559780 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
942431380 2:175914596-175914618 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
942441786 2:176044496-176044518 GAGGATCATCTGAGCCTGAGAGG - Intergenic
942758067 2:179365154-179365176 TAGGATAAACACAGGCAGAGAGG + Intergenic
942962291 2:181845766-181845788 GAGGATCACCTGAGGCCTAGAGG - Intergenic
943437239 2:187881350-187881372 GTGCTTCAGGAGAGGCAGAGGGG - Intergenic
943836729 2:192524316-192524338 GAGGGTGAGCCGAAGCAGAGTGG + Intergenic
944267820 2:197748093-197748115 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
944589673 2:201205312-201205334 GAGGATCACCTGAGTCCGAGGGG - Intronic
944662503 2:201932969-201932991 GAGGAGCTGGAGGGGCAGAGAGG - Intergenic
945201807 2:207289353-207289375 AAGGGACAGCAGAGCCAGAGTGG - Intergenic
945210968 2:207381467-207381489 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
945813861 2:214579961-214579983 GAGGATCATCTGAGCCAGGGAGG - Intergenic
945851452 2:215013309-215013331 GAGGAAGGGCATAGGCAGAGGGG + Intronic
946267535 2:218559888-218559910 GAGGATCACCTGAGCCAGGGAGG + Intronic
946277408 2:218642039-218642061 AGGGATCAGCACAGGCATAGGGG + Exonic
946577289 2:221089474-221089496 GGGGATCAGCTGAAGCCGAGAGG - Intergenic
946649099 2:221871894-221871916 GAGGGTGTGCAGAAGCAGAGTGG + Intergenic
946912904 2:224484978-224485000 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
946927893 2:224643862-224643884 CAGGATCAGCACAGGCAGCCAGG - Intergenic
947486951 2:230559262-230559284 GAGAAACAGCAGATGCAGAAAGG + Intergenic
949030379 2:241794034-241794056 GAGGATCACCTGAGCCAGGGAGG - Intronic
949086816 2:242162742-242162764 GAGGACTAGCTGAGGGAGAGAGG + Intergenic
1168830857 20:844633-844655 GAGGCTCAGCCGCGGCTGAGAGG - Intronic
1168846988 20:952040-952062 TAGGATCACCAGAGGCAGATGGG + Intergenic
1168938711 20:1690759-1690781 GAGGGTAAGCAGAAGCAGGGTGG + Intergenic
1168942674 20:1726816-1726838 GAGGATCACCAGAGCCTGGGAGG + Intergenic
1169188902 20:3644571-3644593 AAAGAGCAGCAGAGGCAAAGGGG - Intronic
1169253844 20:4082830-4082852 GACTGTCAACAGAGGCAGAGTGG - Intergenic
1169348251 20:4846965-4846987 GAGGATGGGCAGAAGGAGAGGGG + Intergenic
1170116184 20:12862650-12862672 GAGGAATAGCAGGGTCAGAGTGG - Intergenic
1170470472 20:16663528-16663550 GAGAAACAGCAGATGCAGAAAGG - Intergenic
1170594324 20:17793848-17793870 GAGGCTGAGCAGAGGCAGGATGG - Intergenic
1170732139 20:18984841-18984863 GAGGATCAGGAGGGGCAGGCAGG + Intergenic
1170843198 20:19940540-19940562 GTAGATCAGCAGAGGCATGGAGG - Intronic
1170926161 20:20726280-20726302 GAGGCTCACCAGAAGCAGATTGG + Intergenic
1171420307 20:25013368-25013390 GAGGTACAGCAAAGGGAGAGGGG + Intronic
1172233513 20:33353196-33353218 GAGGATCACCAGAGCCAGGGAGG + Intergenic
1172274646 20:33673127-33673149 GAAGAGCAACAGAGGCAGAGAGG + Intronic
1172317675 20:33968877-33968899 GAGCTTTAGCAGAGTCAGAGAGG + Intergenic
1172704808 20:36875392-36875414 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1173331749 20:42080942-42080964 GGAGAGGAGCAGAGGCAGAGAGG + Intronic
1173497441 20:43529758-43529780 GAGGAGCAGCAAAAGCATAGAGG + Intronic
1173686687 20:44928772-44928794 GAGGATCACTTGAGGCTGAGAGG + Intronic
1173808979 20:45944877-45944899 GAGCATCTGCGGAGGCAGTGTGG + Exonic
1174153353 20:48501454-48501476 GAGGAGCTGGAGAGGCAGGGAGG - Intergenic
1174498493 20:50966592-50966614 AAGGATCAGAGGAGGGAGAGGGG + Intergenic
1175156993 20:56977827-56977849 GAGGAGCTGCAAAGCCAGAGGGG - Intergenic
1175179285 20:57133973-57133995 GAGCAGCATCAGAGGTAGAGTGG - Intergenic
1175233777 20:57494080-57494102 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1175328785 20:58148410-58148432 AGGGATCTGCAGAGGCTGAGAGG - Intergenic
1176044514 20:63085418-63085440 CAGGAACAGCAGAGGGAGGGAGG + Intergenic
1177821472 21:26035175-26035197 GAGGATCTCCAGAGCCAGGGAGG + Intronic
1178365949 21:31988918-31988940 GAGGATCACCTGAGCCAGGGAGG - Intronic
1178389854 21:32189366-32189388 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1178556162 21:33592230-33592252 GAGGATCACTAGAGCCTGAGAGG - Intronic
1178638913 21:34330158-34330180 GGGGTTTAGGAGAGGCAGAGAGG + Intergenic
1178728889 21:35080799-35080821 GAGGAGCATCCCAGGCAGAGAGG + Intronic
1178912549 21:36687312-36687334 GAGGATCACCAGAGCCTGGGAGG + Intergenic
1178993865 21:37379044-37379066 GAGCATCAGATGAGGGAGAGAGG + Intronic
1179065378 21:38019934-38019956 GAGGGGCAGGAGAGGCAGAAGGG - Intronic
1179255926 21:39715205-39715227 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1179771314 21:43619758-43619780 GAGGATAGCCAGAGGCAAAGTGG + Intronic
1179775889 21:43661840-43661862 CAGGAGAAGCAAAGGCAGAGAGG - Intronic
1180215055 21:46318434-46318456 GGGCAGCAGCTGAGGCAGAGGGG + Intronic
1180217040 21:46331244-46331266 GAGGATCACCTGAGTCAGGGAGG - Intronic
1181080180 22:20409014-20409036 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1181178667 22:21052422-21052444 GAGGAGCTGCAGAGACAGGGAGG - Intronic
1181854746 22:25773915-25773937 GAGGCTCAGTGGAGGCAGGGAGG + Intronic
1182356065 22:29722699-29722721 GAGGCCCTGCAGAGGCGGAGAGG - Intronic
1182461121 22:30484798-30484820 CAGCATGAGCAAAGGCAGAGGGG + Intergenic
1183243420 22:36675124-36675146 GAGGATCACCTGAGCCTGAGAGG - Intronic
1183266500 22:36829615-36829637 GAGGAGTAGCTGAGGCAGAGAGG + Intergenic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
1183546492 22:38456822-38456844 GAGGCTCAGGAGAGCCAGAGGGG - Intergenic
1183886688 22:40889597-40889619 GAGGATCACGTGAGGCAGCGAGG + Intronic
1183887963 22:40900841-40900863 GAGGATCACCAGAGCCTGGGTGG + Intronic
1184208856 22:43023510-43023532 GAGGCTCAGCAGAAGAAGGGGGG - Intergenic
1184530378 22:45051635-45051657 GAGGCTCAGGATGGGCAGAGGGG - Intergenic
1184645170 22:45891450-45891472 GAGGAGCAGCAGAGGATGAGGGG - Intergenic
1184687994 22:46105022-46105044 GAGGCTCAGGAGAGGCCGAGGGG - Intronic
1184920299 22:47600952-47600974 GAGGGTGCGCAGAGGCTGAGAGG - Intergenic
1184979155 22:48084035-48084057 GAGGGTCTGCAGAGGCAGGCAGG - Intergenic
1185312421 22:50163430-50163452 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1185324084 22:50217179-50217201 GAGGATCAGGAGGGTGAGAGGGG - Intronic
1185370833 22:50460194-50460216 GAGGATCAGGGCAGGCGGAGTGG - Intronic
1203296105 22_KI270736v1_random:44445-44467 CAGAAGCAGCACAGGCAGAGGGG - Intergenic
949456671 3:4246232-4246254 GAGGGTGAGCAGAAGCAGGGCGG - Intronic
949594668 3:5531270-5531292 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
949632613 3:5944545-5944567 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
949831485 3:8219629-8219651 GAGACTCAGCTGAGGCAAAGGGG + Intergenic
949889991 3:8726532-8726554 GGGGAACAGAAAAGGCAGAGAGG + Intronic
950030077 3:9846414-9846436 GGGGGTCAGCAGAGGCAGGATGG + Intronic
950507998 3:13407600-13407622 CAGCATCAGCAGAGGAATAGAGG - Intronic
950542569 3:13621067-13621089 CATGAGCAGCACAGGCAGAGGGG - Intronic
950666479 3:14498371-14498393 GAGGATCAGCTGAGCCTGGGAGG + Intronic
950735972 3:15008430-15008452 GAGGATCACTTGAGGCTGAGAGG + Intronic
950866162 3:16190803-16190825 GAGGACCAGCAGCAGCTGAGCGG - Intronic
951135879 3:19103707-19103729 GAGGATGAGCAGAATCAGGGTGG - Intergenic
951254582 3:20433409-20433431 GAGGACGAGCAGAAGCAGGGTGG - Intergenic
951299129 3:20972915-20972937 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
951676521 3:25247616-25247638 GAGGATGAGCAGAAGCAGGGTGG - Intronic
951741600 3:25931326-25931348 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
951826584 3:26875657-26875679 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
952333517 3:32385806-32385828 GAGGCCCAGCAGAGGGAGAGCGG - Intergenic
952641191 3:35598755-35598777 AAAGAACAGCAGAGCCAGAGTGG + Intergenic
952684345 3:36131772-36131794 GAGGCTCAAAAGAGGGAGAGGGG + Intergenic
952923430 3:38304475-38304497 GAGGATCACCTGAGCCAGGGAGG - Intronic
953055818 3:39386482-39386504 GAGGATCACCTGAGCCTGAGAGG + Intronic
953108186 3:39906421-39906443 GAGGAACACTAGAAGCAGAGAGG - Intronic
953267327 3:41404340-41404362 GAAAATTACCAGAGGCAGAGAGG - Intronic
953329239 3:42038412-42038434 GAGGATCACTTGAGCCAGAGAGG - Intronic
953555867 3:43946353-43946375 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
953740672 3:45536209-45536231 GAGGATCACCTGAGCCTGAGAGG - Intronic
953928587 3:46994875-46994897 GAGGCTCAGGAAAGTCAGAGGGG - Intronic
954143374 3:48621718-48621740 CAGGAGCAGCAAAGGCAGCGAGG + Exonic
954510577 3:51121287-51121309 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
954915046 3:54141517-54141539 GAAGAGAAGGAGAGGCAGAGGGG + Intronic
954953883 3:54501494-54501516 GAGGATCACCAGAGCCTGGGAGG - Intronic
954978770 3:54723679-54723701 GAGGGTGAGCCGAAGCAGAGTGG - Intronic
955510981 3:59679944-59679966 GAGGCTCAGCAGGGGCAGCAGGG - Intergenic
955685161 3:61541837-61541859 GAGCATCAGGAGAAGCAAAGTGG - Intergenic
955724161 3:61914823-61914845 GAGGATGGGCATAGGCAGAGAGG + Intronic
955931974 3:64066481-64066503 GAGGGTGAGAAGAGGTAGAGTGG + Intergenic
956048384 3:65220701-65220723 GAGGATGAGCGGAAGCAGGGTGG - Intergenic
956572162 3:70708989-70709011 GAGGAGCAGAAGTGGAAGAGGGG + Intergenic
956587988 3:70884337-70884359 GAGGGCCAGCAGAGGCAGCACGG - Intergenic
956793465 3:72698212-72698234 GATGAACTGCAGAAGCAGAGAGG - Intergenic
956919364 3:73910209-73910231 GAAGATGAGAAGATGCAGAGAGG + Intergenic
957011353 3:75009190-75009212 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
957053249 3:75426238-75426260 GCGGCTCAGCAGAGGGAGGGAGG - Intergenic
957247761 3:77735074-77735096 AAGGGACAGCAGAGGCAAAGTGG - Intergenic
957316340 3:78581307-78581329 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957317649 3:78588567-78588589 GAGAGTCAGCAGAGGGAGATAGG + Intergenic
957576743 3:82017261-82017283 GAGCATGAGCAAAGGCAGTGAGG + Intergenic
957747757 3:84366595-84366617 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
958026948 3:88059551-88059573 GAAGACCAGGAGACGCAGAGAGG - Intronic
958479685 3:94630772-94630794 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
959278136 3:104304157-104304179 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
959453689 3:106533909-106533931 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
959545516 3:107591575-107591597 GAGGATCAGTTGAGGCAGGCAGG - Intronic
960121092 3:113948692-113948714 GAGGTTAAGCAGAGAGAGAGAGG + Intronic
960122723 3:113963644-113963666 GAGGATCACCTGAGTCTGAGAGG + Intronic
960760163 3:121064267-121064289 GAGGAGGAGCAGAAGCAGGGTGG - Intronic
960773236 3:121217477-121217499 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
961141565 3:124560785-124560807 GAGGATCACTTGAGCCAGAGAGG + Intronic
961248239 3:125475886-125475908 GAGGATCACTAGAGCCTGAGAGG + Intronic
962156763 3:132956549-132956571 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
962250510 3:133833350-133833372 GAGGACAAGCAGTGGCCGAGAGG - Intronic
962302212 3:134252399-134252421 GAGGCTGAGAAGAGGAAGAGGGG + Intergenic
962391290 3:134974944-134974966 GAGGATGGGCAGTGGCAGGGAGG - Intronic
962489249 3:135875854-135875876 GAGGATCACTTGAGCCAGAGAGG + Intergenic
962494117 3:135922392-135922414 GAGGATCAACTGAGCCAGGGAGG + Intergenic
962522416 3:136209559-136209581 GAGGATCATCTGAGCCTGAGAGG + Intergenic
962712327 3:138098403-138098425 GAGAAACACCAGAGGCAGAGAGG + Intronic
962795090 3:138843022-138843044 GAGGATCAGTTGAGGCTGGGAGG - Intergenic
962818348 3:139022204-139022226 GAGGATCACCAGAGCCTGGGAGG - Intronic
962910226 3:139841667-139841689 GAGGATCTCCAGAGGCTGAAGGG + Intergenic
963083343 3:141414867-141414889 AAGTGTCAACAGAGGCAGAGAGG - Intronic
963355888 3:144208586-144208608 AATGAACAGCAGAGGCAAAGTGG - Intergenic
963445413 3:145399657-145399679 GAGGATTAGCAGAGGAGGAGAGG + Intergenic
963481515 3:145879976-145879998 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
964011919 3:151901861-151901883 GAGCATTAGCAGAGGCGAAGAGG - Intergenic
964108364 3:153063165-153063187 AAGAAGCAGCAGAGGGAGAGGGG - Intergenic
964391325 3:156201110-156201132 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
964796569 3:160503992-160504014 GAGGATCACCTGAGCCAGGGAGG + Intronic
965637858 3:170802403-170802425 GAGGTCCAGAAGAGACAGAGAGG + Intronic
967756823 3:193179532-193179554 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
968511641 4:998212-998234 GGGGACCAGCAGAGGCGGGGCGG + Intronic
968565325 4:1309574-1309596 GAGGAGGAGCAGAGGCAGGGAGG + Intronic
968736209 4:2297864-2297886 GAGGAACGGCAGAGGACGAGCGG + Intronic
968736236 4:2298069-2298091 GAGGAACGGCAGAGGACGAGTGG + Intronic
968736259 4:2298203-2298225 GAGGAACAGCAGAGGATGAGCGG + Intronic
968736271 4:2298274-2298296 GAGGAACGGCAGAGGATGAGTGG + Intronic
968982321 4:3856946-3856968 GAGGTGCAGCAGAGGTAGAAGGG + Intergenic
968993078 4:3927738-3927760 GAGGGTCAGCAAAGGGAGATGGG - Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
969212153 4:5696260-5696282 GAGGACCAGGAGAGCCAGAGAGG - Intronic
969455425 4:7297327-7297349 GAGGACAGGCAGAGGCAGAAGGG - Intronic
969543883 4:7811352-7811374 GAAGAACTGCAGAGGAAGAGCGG + Intronic
969671547 4:8592841-8592863 AAGGAGCAGCAGCGGCAGCGGGG - Exonic
969687137 4:8681945-8681967 CAGGCTGAGCAGAGCCAGAGTGG - Intergenic
969911297 4:10448998-10449020 GAGGATCAGCAGTGTCGGACTGG - Intronic
970214605 4:13745665-13745687 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
971276087 4:25198252-25198274 GTGGAAGAGCAGAGGAAGAGAGG - Intronic
971425361 4:26510116-26510138 GAGGATCAGTCCAGCCAGAGGGG - Intergenic
972021728 4:34323851-34323873 AAAGCTCAGCAGAGGAAGAGAGG + Intergenic
972528607 4:39940620-39940642 GAGGAACAGGAGAGAAAGAGAGG + Intronic
972964385 4:44491357-44491379 GAGGATCACCTGAGCCGGAGGGG + Intergenic
973766557 4:54168381-54168403 CAGCGTTAGCAGAGGCAGAGTGG - Intronic
974559859 4:63503476-63503498 GGTGATCATCAGTGGCAGAGTGG - Intergenic
974560014 4:63505805-63505827 GAGAGTGAGCAGAAGCAGAGTGG + Intergenic
974884263 4:67797284-67797306 GAAAATCACCAGAGACAGAGAGG - Intergenic
975177822 4:71308569-71308591 GAGGGTGAGCAGAAGCAGAGGGG + Intronic
975524168 4:75331146-75331168 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
975533190 4:75421571-75421593 GAGAATAAGAAGAGGCCGAGGGG - Intergenic
975638700 4:76477821-76477843 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
975733928 4:77363769-77363791 AATGAACAGCAGAGGCAAAGTGG - Intronic
975970216 4:80024670-80024692 GAGGATCACCTGAGCCAGAAAGG + Intronic
976169771 4:82291146-82291168 GAGGATCAACTGAGCCAGGGAGG + Intergenic
976392802 4:84523223-84523245 GAGGGTAAGGAGGGGCAGAGAGG + Intergenic
976816603 4:89155438-89155460 GAGGATCACCTGAGCCTGAGAGG - Intergenic
977294009 4:95192111-95192133 GAGGATGAGCAGGGGAGGAGGGG - Intronic
977327039 4:95587185-95587207 TAAGATCATCAGAGGAAGAGAGG + Intergenic
978096504 4:104785360-104785382 GAGGAACAGGTGAGGCAGCGGGG - Intergenic
978269920 4:106876663-106876685 GTGGAGCAGGAGAGGGAGAGGGG - Intergenic
978318308 4:107464774-107464796 GAGGATCACCTGAGCCTGAGAGG + Intergenic
978906712 4:114013466-114013488 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
979209321 4:118080046-118080068 GAGGATCAGGTGATGAAGAGGGG - Intronic
979487465 4:121284957-121284979 GAGGGTAAGCTGAGGCAGAGTGG + Intergenic
979612905 4:122708099-122708121 GAGGATCACTTGAGCCAGAGAGG - Intergenic
979801886 4:124919962-124919984 GAGGATCACCAGAGCCTGGGAGG + Intergenic
979927616 4:126587245-126587267 GAGGATCAGGTGAGCCAGTGAGG + Intergenic
980306221 4:131064647-131064669 TAGGATGAACAGATGCAGAGAGG - Intergenic
980733316 4:136849253-136849275 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
981131502 4:141162651-141162673 GAGGACAAGCAGAAGCAGGGTGG + Intronic
981436737 4:144732504-144732526 GAGTATCAGCAGAGAAACAGGGG + Intronic
981596359 4:146427243-146427265 GAGGATCACTTGAGCCAGAGAGG + Intronic
981796336 4:148599270-148599292 GAGGGTGAGCTGAAGCAGAGTGG - Intergenic
981818128 4:148854827-148854849 GATGATGAGCAGAGCAAGAGAGG - Intergenic
981993860 4:150955179-150955201 GAGGATCACCTGAGCCTGAGAGG + Intronic
982815468 4:159878220-159878242 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
982915498 4:161203793-161203815 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
983044602 4:162970167-162970189 GAGGGCCAGCAGAAGCAGGGTGG - Intergenic
983067578 4:163228967-163228989 GAGGATCACCTGAGCCTGAGAGG - Intergenic
983179366 4:164630281-164630303 GAGGGCTAGCAGAAGCAGAGTGG + Intergenic
983359137 4:166706046-166706068 AATGAACAGCAGAGGCAAAGAGG + Intergenic
983840777 4:172455059-172455081 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
984017909 4:174447593-174447615 GAGAAACAGCAGATGCAGAAAGG - Intergenic
984220386 4:176967484-176967506 GGGGATCAGCAGAGGCATGGAGG + Intergenic
984354113 4:178636826-178636848 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
984399457 4:179243559-179243581 GAGGATCACCTGAGGCTGGGTGG - Intergenic
984559862 4:181255482-181255504 GAGGATCACCTGAGCCTGAGAGG - Intergenic
984591124 4:181618930-181618952 GTGGATCTGCAGGGGCAAAGTGG - Intergenic
984840198 4:184060922-184060944 GAGGATCACCAGAGCCCGGGAGG + Intergenic
985092250 4:186375717-186375739 GAGGATCACCTGAGCCAGGGAGG + Intergenic
985150580 4:186943269-186943291 GACTATAAGCAGAGGAAGAGTGG + Intergenic
985716169 5:1463203-1463225 GTGGATCCACAGAGGCAGACAGG + Exonic
985937195 5:3106425-3106447 GAGGGAGAGCAGAGGGAGAGGGG - Intergenic
986322396 5:6643392-6643414 GAGGATCATCAGAGCCTGGGAGG - Intronic
986327183 5:6685040-6685062 GAGGGGCAGCACAGGCACAGGGG - Intergenic
986466946 5:8035075-8035097 GAGGAGCAGGAGACCCAGAGTGG + Intergenic
986469357 5:8058900-8058922 GAGGGGCAGCAGAGGCAGCACGG + Intergenic
986832616 5:11597661-11597683 GAGGATCACCTGAGTCTGAGAGG - Intronic
987688248 5:21232859-21232881 GAGGATCACCTGAGCCTGAGAGG + Intergenic
987755463 5:22094945-22094967 GAGGGTCAGCAAAGGGAGATAGG - Intronic
988618130 5:32794853-32794875 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
988781791 5:34529162-34529184 GAGGATCACTTGAGCCAGAGAGG + Intergenic
988795152 5:34646674-34646696 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
988970712 5:36465105-36465127 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
989081976 5:37631920-37631942 GAGAGCCAGGAGAGGCAGAGGGG + Intronic
989320795 5:40131346-40131368 GAGGGCAAGCAGAAGCAGAGTGG - Intergenic
989345331 5:40423184-40423206 GAGGATGAGCCGAAGCAGGGCGG - Intergenic
989358114 5:40567359-40567381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
989615403 5:43333087-43333109 GAGCATCAGCAAAGGGAGATGGG + Intergenic
990183851 5:53191630-53191652 GAGGGTGAGCAAAAGCAGAGTGG - Intergenic
990244922 5:53854670-53854692 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
990285643 5:54298372-54298394 GAGGATGACCAGAGACACAGAGG - Intronic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991252800 5:64582476-64582498 GAGGACAAGCAGAGTCAGAGGGG - Intronic
991577740 5:68122486-68122508 GGCGATCAGCAGGGGAAGAGGGG - Intergenic
991651692 5:68862216-68862238 CAGAATGAGTAGAGGCAGAGAGG + Intergenic
991965134 5:72083266-72083288 GAGGAAAAGGAGAAGCAGAGAGG - Intergenic
992077767 5:73206913-73206935 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992200786 5:74381602-74381624 GAGGATCATCTGAGACAGGGAGG + Intergenic
992287207 5:75247990-75248012 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
992386407 5:76288967-76288989 GAGGATCACCTGAGCCAGGGAGG - Intronic
992442412 5:76808500-76808522 GAGAGGAAGCAGAGGCAGAGGGG - Intergenic
992553640 5:77882941-77882963 CATGATCAGCACAGGCAGAAAGG - Intergenic
992740702 5:79770583-79770605 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
992792745 5:80228140-80228162 GAGGATCACCAGAGCCTGTGAGG + Intronic
993003948 5:82411133-82411155 GAGAATCATCTGAGCCAGAGAGG + Intergenic
993165793 5:84353295-84353317 GAGTATCAGCACTGGCAGAAAGG + Intronic
993563820 5:89447301-89447323 GAGGGAAAGAAGAGGCAGAGTGG + Intergenic
993757712 5:91751497-91751519 GAGGATGAGCCGAAGCAGGGTGG - Intergenic
994014963 5:94955109-94955131 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
994363192 5:98879142-98879164 GAGGATCATCTGAGGCCGGGAGG + Intronic
994850901 5:105053683-105053705 GAGGGTCAGCAGAAGCAGAGTGG - Intergenic
994880550 5:105488511-105488533 GAGGATCAGCTGAGCCCGGGAGG - Intergenic
995742446 5:115369012-115369034 GAGGATGACCAGCTGCAGAGAGG + Intergenic
995785816 5:115826197-115826219 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
996426701 5:123320609-123320631 GAGGATGAGCAGAAGAAGGGTGG - Intergenic
996428000 5:123335642-123335664 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
997710029 5:135996402-135996424 GAGCAGCAGCAGAGGCTGAAAGG - Intergenic
997764402 5:136485754-136485776 GAGGAACAGCAGATGCAAATGGG - Intergenic
997809608 5:136954339-136954361 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
997994116 5:138572044-138572066 GAGGATCAGCTGAGGCTGGCAGG - Intronic
998147031 5:139734796-139734818 CTGGATCAGCAGAGGCAGGCAGG - Intergenic
998149128 5:139747040-139747062 GAGGAACCTCAGAGCCAGAGAGG - Intergenic
998248843 5:140535393-140535415 GAGGAGCAGAAGAGGAAGATGGG - Exonic
998821293 5:146060059-146060081 GTGCATCAGCAGGGGCAGTGAGG + Exonic
998977002 5:147659328-147659350 GAGAACCAGCAGAAGCAGGGTGG - Intronic
999030160 5:148281580-148281602 GAGGGTAAACAGAAGCAGAGTGG - Intronic
999131811 5:149289368-149289390 GAGGGACGGCAGAGGCAGTGAGG - Intronic
1000071533 5:157744422-157744444 TAGGAGCAACAGAGGGAGAGTGG + Intronic
1000121012 5:158197917-158197939 CAGGGTGAGAAGAGGCAGAGCGG + Intergenic
1000627920 5:163560388-163560410 GAGGATCATTTGAGCCAGAGAGG - Intergenic
1000820951 5:165982764-165982786 GAGGATCATCAGAGCCCAAGAGG - Intergenic
1001251859 5:170152855-170152877 GAGGATCTGGAGAGGAAGAGAGG - Intergenic
1001696457 5:173673835-173673857 GAGGGTTGGGAGAGGCAGAGGGG + Intergenic
1001994071 5:176141144-176141166 GAGGATCACTTGAGGCAGGGAGG + Intergenic
1002035820 5:176468706-176468728 GAGGATCACCTGAGGCAAGGAGG + Intronic
1002579141 5:180197094-180197116 GAGGCTCATCAGAGGCAGGCTGG - Intronic
1002901306 6:1411682-1411704 GAGGATCACTAGAGCCAGGGAGG + Intergenic
1002902065 6:1417524-1417546 GAGGATGCGCACAGGGAGAGTGG - Intergenic
1003123183 6:3334826-3334848 AAGGATCAGCAGCTGCAGACTGG - Intronic
1003386324 6:5671303-5671325 CAGGAAGAGCAGAGACAGAGTGG - Intronic
1004080605 6:12388967-12388989 GAGGATCACGTGAGCCAGAGAGG + Intergenic
1004753131 6:18583916-18583938 TATCAGCAGCAGAGGCAGAGAGG + Intergenic
1005019833 6:21407050-21407072 GAGGATCACCAGAGCCTGGGAGG + Intergenic
1005486659 6:26306792-26306814 GAGGATCAGCTGAGCCTGGGAGG + Intergenic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006026343 6:31149530-31149552 GAGGATCACCTGAGGCTGGGAGG - Intronic
1006125874 6:31837731-31837753 GAGCAGCAGCAAAGGCAGGGAGG + Intronic
1006779960 6:36625740-36625762 CAGCATGAGCAAAGGCAGAGAGG + Intergenic
1006879104 6:37323438-37323460 GAGGATCATCTGAGCCAGGGAGG + Intronic
1007285657 6:40745542-40745564 GAAGACCAGCAGAGGCTGAGTGG + Intergenic
1007300101 6:40861492-40861514 GAGAATCAGCAAAGGGAGAGAGG + Intergenic
1007663575 6:43501305-43501327 GAGGGTCAGGGGAGGAAGAGGGG - Intronic
1007751200 6:44073025-44073047 GAGGTGCAGCAGAGGCAGGCGGG + Intergenic
1008106637 6:47446021-47446043 GAGGTTCAGAAAAGGCAAAGTGG + Intergenic
1008457752 6:51731008-51731030 GAGGATCACCTGAGCCTGAGAGG - Intronic
1008619220 6:53255417-53255439 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1008965241 6:57308210-57308232 GAGGATCACCTGAGGCTGGGAGG - Intergenic
1009424941 6:63503824-63503846 GAGAATCACCAGAGCCTGAGGGG + Intergenic
1009556965 6:65182876-65182898 GAGGATCACTTGAGCCAGAGAGG - Intronic
1009669036 6:66721535-66721557 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009669040 6:66721586-66721608 GAAATTCAGCAGAGGCAGAAAGG + Intergenic
1009775822 6:68205455-68205477 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1010574870 6:77518357-77518379 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1010963024 6:82168720-82168742 GAGGATCACCTGAGTCAGGGAGG - Intergenic
1011071778 6:83393020-83393042 CAGCACCAGTAGAGGCAGAGAGG - Intronic
1011105716 6:83778109-83778131 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1011235656 6:85213452-85213474 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1011247347 6:85333377-85333399 GAAGATCAGCATAGACAGAGTGG + Intergenic
1011541202 6:88432125-88432147 CAGTAGGAGCAGAGGCAGAGAGG - Intergenic
1011566142 6:88674447-88674469 GAGGATCACCTGAGCCTGAGAGG + Intronic
1011727993 6:90230109-90230131 GAGGAGAACCACAGGCAGAGAGG + Intronic
1011782180 6:90801812-90801834 CAGCATCAGCAAAGGCACAGAGG + Intergenic
1011831315 6:91374987-91375009 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1012067023 6:94560402-94560424 GGGTATCAACAGAGGTAGAGTGG + Intergenic
1012083159 6:94785735-94785757 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1012423638 6:99091642-99091664 GAGGATCTGGAGACACAGAGAGG + Intergenic
1012725908 6:102809418-102809440 GAGGGTGAGCTGAAGCAGAGCGG - Intergenic
1013037910 6:106404727-106404749 GAGGGTGAGCAGAAGCAGTGTGG + Intergenic
1013082323 6:106823516-106823538 GAGGATCACCTGAGCCTGAGAGG - Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013437210 6:110122519-110122541 CAGGAGTAGCAGAGGCAGAGAGG - Intronic
1013511870 6:110852140-110852162 GAGGATCACCTGAGGCTGGGAGG - Intronic
1013682506 6:112541095-112541117 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1013920239 6:115394892-115394914 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1014186985 6:118445886-118445908 GAGGACAAGCAGAGACAAAGTGG - Intergenic
1014527905 6:122522706-122522728 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1015695356 6:135973976-135973998 GAATATCAGCAGAGGAACAGAGG - Intronic
1015953428 6:138576556-138576578 GAAGCTCAGCAGTGGCAAAGTGG - Intronic
1016372200 6:143386740-143386762 GAGGAACAGCAGCTGCAGATTGG + Intergenic
1016447541 6:144149564-144149586 GAGGATCACTTGAGGCTGAGAGG - Intergenic
1016650692 6:146456133-146456155 GAGGGTCAGCAAAGGGAGATAGG + Intergenic
1016750970 6:147630633-147630655 GAGGGTCAGCAAAGGGAGATAGG - Intronic
1016819165 6:148331779-148331801 GAGGATCACCTGAGCCTGAGAGG - Intronic
1017418682 6:154249640-154249662 TGGGATCAGCCAAGGCAGAGAGG + Intronic
1017709967 6:157158655-157158677 GAGGAGCCACAGAAGCAGAGTGG - Intronic
1018008371 6:159644968-159644990 GAGGATCACCTGAGCCAGGGAGG + Intergenic
1018656381 6:166041026-166041048 GAGGTTTTGCAGAGGCAGAAAGG - Intergenic
1018941147 6:168309493-168309515 CAGGATCAGAACAGGCTGAGGGG - Intronic
1018968571 6:168508662-168508684 GAGGTTCAGCAGAAGCTGGGGGG - Intronic
1019071306 6:169347483-169347505 GAGGATCACCAGATACAAAGAGG - Intergenic
1019500004 7:1360080-1360102 GGGGCTCAGCAGAGGCAGAGAGG - Intergenic
1020143733 7:5627015-5627037 GAGGTTGAGGTGAGGCAGAGTGG - Intronic
1020193151 7:6016020-6016042 GAGGTTCAGCAGAGGCAGCCCGG + Intronic
1020339071 7:7089572-7089594 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1020608666 7:10368025-10368047 GAGGGTGAGCAGATGCAGGGTGG - Intergenic
1020629666 7:10625214-10625236 GAGGGCGAGCAGAAGCAGAGGGG + Intergenic
1020823930 7:13003261-13003283 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1021347751 7:19548540-19548562 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1022058930 7:26770750-26770772 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1022614274 7:31912595-31912617 GAGGATCACCTGAGCCAGGGAGG + Intronic
1022743680 7:33148320-33148342 GAGGATCAACAGGGGAAGTGTGG + Intronic
1023025167 7:36043149-36043171 GAGGATCAGTTGAGCCAGGGAGG + Intergenic
1023105837 7:36762559-36762581 GGGGCTCAGCAGATTCAGAGAGG - Intergenic
1023190514 7:37575751-37575773 GAGGATCACCTGAGCCTGAGGGG + Intergenic
1023422617 7:39998527-39998549 GAGGATCACCAGAGCCAAAGAGG + Intronic
1023511707 7:40959969-40959991 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1023894230 7:44418771-44418793 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1024657799 7:51466702-51466724 GAGGAGCTGCAGAGGAGGAGGGG + Intergenic
1024799516 7:53059799-53059821 GGGGATCACCAGAAGCCGAGGGG - Intergenic
1025020624 7:55476714-55476736 GAGGAGCAGCTGGGCCAGAGGGG - Intronic
1025078366 7:55962753-55962775 GCGGGGCTGCAGAGGCAGAGAGG - Intronic
1025605831 7:63039275-63039297 GATGAGCAGCAGAGGTGGAGAGG - Intergenic
1025714316 7:63941108-63941130 GAGGGTTAGCAGAAGCAGAGTGG + Intergenic
1026152376 7:67799092-67799114 GAGCATCAGAAGATGCTGAGAGG - Intergenic
1026623474 7:71971806-71971828 GAGGATCACCAGAGCCTGGGAGG + Intronic
1026831753 7:73614630-73614652 GCAGGGCAGCAGAGGCAGAGAGG - Intronic
1026837862 7:73650062-73650084 GGGGGGCAGCAGAGGCAGAAGGG + Intergenic
1026955841 7:74376061-74376083 AAGGAACACCAGAGGGAGAGTGG + Exonic
1027193924 7:76015158-76015180 GAGGATCACCTGAGCCAGGGAGG + Intronic
1028290360 7:89057661-89057683 GAGGCTGAGTAGAGGCAGAAAGG + Intronic
1028326941 7:89539806-89539828 GAGGATAAGCCAAAGCAGAGTGG + Intergenic
1028826902 7:95284015-95284037 CAGGATCTTCAGAGGCAGACTGG + Exonic
1028927767 7:96378159-96378181 CAGGAGCAGGAGAGACAGAGAGG + Intergenic
1029051812 7:97697538-97697560 CAGCTTCAGCAAAGGCAGAGGGG - Intergenic
1029303535 7:99602281-99602303 CAGGCTCAGCACAGACAGAGGGG + Intronic
1029327807 7:99824685-99824707 GAGGATCACCTGAGCCCGAGAGG - Intergenic
1029434194 7:100552922-100552944 GAGGATCACCTGAGGCCAAGAGG + Intronic
1029572261 7:101377993-101378015 GAGGATCACCTGAGTCCGAGAGG - Intronic
1029590456 7:101503604-101503626 GATGATCACCAGAGGCCGGGAGG - Intronic
1029591082 7:101507509-101507531 GAGGATCACCTGAGGCGGGGAGG - Intronic
1029989844 7:104953072-104953094 GAGGATCACCTGAGCCCGAGAGG - Intergenic
1030951994 7:115802324-115802346 GAGCACCACCAGACGCAGAGGGG + Intergenic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031698292 7:124888892-124888914 GAGCCTCAGGAGAGGGAGAGGGG - Intronic
1032020474 7:128405031-128405053 GAGCATCAGAAGGGGCAGAGTGG - Intronic
1032234843 7:130111619-130111641 GAGGATCACTTGAGGAAGAGAGG + Intronic
1032318704 7:130865263-130865285 GAGGATCATCTGAGGCTGGGAGG + Intergenic
1032355939 7:131210611-131210633 GAGGATCACCTGAGCCTGAGAGG + Intronic
1032655779 7:133928392-133928414 AGGCATCAGCAGAGACAGAGTGG - Intronic
1032659834 7:133970640-133970662 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1032893225 7:136222315-136222337 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1032947630 7:136870645-136870667 GAGGTTCGCCAGGGGCAGAGAGG + Intronic
1033168031 7:139058362-139058384 GAGGATCACCCGAGTCCGAGAGG + Intronic
1034314402 7:150116928-150116950 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1034487289 7:151373912-151373934 GAGGTGCCACAGAGGCAGAGGGG - Intronic
1034792493 7:153983841-153983863 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1034933428 7:155182442-155182464 GAGGAGCATCAGAGCCACAGGGG - Intergenic
1035006271 7:155663458-155663480 GAGGGTGAGCAGAGGCGGGGAGG + Intronic
1035497893 8:68527-68549 GAGGACTAGCTGAGGGAGAGAGG - Intergenic
1035793982 8:2336757-2336779 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1035798823 8:2384951-2384973 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1035879850 8:3234146-3234168 GAGGATCAGCAGAGGCAATCAGG + Intronic
1035954588 8:4062111-4062133 GAGGGTCAGCAGAGGGTCAGTGG + Intronic
1036183925 8:6608029-6608051 GAGGATTGGCAGGGGCTGAGGGG + Intronic
1036476179 8:9095608-9095630 GAGGATCACCTGAAGCAGGGAGG - Intronic
1036743911 8:11390695-11390717 GAGGCTGGGCAAAGGCAGAGGGG + Intronic
1036971561 8:13361140-13361162 GAGGATCACCTGAGCCAGGGAGG + Intronic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037285559 8:17294725-17294747 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1037583767 8:20262327-20262349 GAGGATCAGGTGGGGAAGAGGGG + Intronic
1037626059 8:20607932-20607954 GAGGATGAGCTGAAGCAGGGTGG - Intergenic
1037755099 8:21705304-21705326 CATGTTCAGCAGGGGCAGAGGGG + Intronic
1037821469 8:22137226-22137248 CAGGTGCAGCAGTGGCAGAGGGG + Intergenic
1037892134 8:22628999-22629021 GAGGCTCAGCGAAGGCAGGGAGG - Intronic
1037917231 8:22780036-22780058 GAGGATCACCTGAGCCAGAGAGG - Intronic
1038922651 8:32102225-32102247 GAGGATCACCTGAGCCTGAGAGG - Intronic
1039330397 8:36531149-36531171 AATGAACAGCAGAGGCAAAGCGG + Intergenic
1039910496 8:41823024-41823046 GAGCATGAGCGGAGGCAGAAGGG + Intronic
1039998654 8:42557947-42557969 GAGGATCACCAGAGCCCAAGAGG - Intergenic
1040469700 8:47727134-47727156 GAGGAGCAGAGGAGTCAGAGAGG + Intronic
1041050707 8:53931747-53931769 GAGGGTGAGCAGAAGCAGTGTGG + Intronic
1041053988 8:53963852-53963874 GAGGACTTGCAGAGGTAGAGTGG - Intergenic
1041154969 8:54976733-54976755 GAGGACAAGCAGAAGCAGGGAGG + Intergenic
1041337676 8:56806079-56806101 GAAAATTATCAGAGGCAGAGAGG + Intergenic
1041357246 8:57014039-57014061 CAGGATGAGCTGGGGCAGAGAGG - Intergenic
1041419160 8:57647278-57647300 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1041522198 8:58769157-58769179 CAGGAGCAACAGAGGCGGAGTGG + Intergenic
1041595995 8:59653706-59653728 GAGGATCACCTGAGCCCGAGAGG + Intergenic
1041819365 8:62012303-62012325 GAGGATCACCTGAGCCAGGGAGG + Intergenic
1042124041 8:65519250-65519272 GAGGATCACCTGAGTCAGGGAGG + Intergenic
1042478731 8:69280045-69280067 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1042541787 8:69914809-69914831 GAGGATCGCCAGAGCCTGAGAGG + Intergenic
1043080838 8:75763177-75763199 GAGGGTGAGCAAAAGCAGAGTGG + Intergenic
1043118240 8:76286849-76286871 GACGATGAGCAGAAGCAGAGTGG - Intergenic
1043253749 8:78106872-78106894 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1043485869 8:80698744-80698766 CAGCATCAGCAGAGGCAGCCCGG + Intronic
1043605180 8:81991078-81991100 GAGGATGAGCTGAAGCAGGGCGG - Intergenic
1044043714 8:87402542-87402564 GAGCATGAGCAAAGGCACAGAGG + Intronic
1044312458 8:90709335-90709357 GAGGATGAACAGAAGCAGAGTGG - Intronic
1044340497 8:91041017-91041039 GAGGAGCAGCAGTGGAGGAGCGG + Exonic
1044509559 8:93058759-93058781 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044674571 8:94716638-94716660 GAGGATCACCTGAGCCAAAGAGG - Intergenic
1044723182 8:95169969-95169991 GAGCATGATCAGAGGCACAGAGG + Intergenic
1044940346 8:97335434-97335456 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1044954757 8:97468404-97468426 GAGGAACAGAAGAAGCAGGGAGG - Intergenic
1045185265 8:99830895-99830917 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1045199581 8:99967069-99967091 GAGCATGAGCAGAAGCAGGGTGG + Intronic
1045390499 8:101710120-101710142 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1045730590 8:105234804-105234826 GAGGAGGAGAAGAGGAAGAGAGG - Intronic
1045799421 8:106084905-106084927 GAGAAAGAGCAGAAGCAGAGTGG - Intergenic
1045897827 8:107239798-107239820 GAGGAACTGCAGAGGCATACAGG - Intergenic
1046014550 8:108589901-108589923 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1046947555 8:119988306-119988328 GAGGGCGAGCAGAAGCAGAGTGG - Intronic
1047435376 8:124831456-124831478 GAGGATGAGAAGAAGCAGAAAGG - Intergenic
1047704898 8:127488556-127488578 GAGTCTCAGCGGAGGCTGAGTGG - Intergenic
1047959737 8:130002369-130002391 GAGGATCACCTGAGCCAGAGAGG + Intronic
1048245805 8:132797469-132797491 TAGCATGAGCAAAGGCAGAGAGG + Intronic
1048270207 8:133022225-133022247 GAGGAGGAGCAGGGGCAGTGAGG - Intronic
1048346598 8:133580540-133580562 GAGGCTCTGCAGAAGCAGTGAGG - Intergenic
1048433605 8:134394683-134394705 GGGGATCAGCTGAAGCAGTGAGG - Intergenic
1048742148 8:137572981-137573003 AAGGAACAGAAGAGGCAGAAGGG + Intergenic
1048884789 8:138901454-138901476 GAGGATCACCAGAGCCTGGGAGG - Intronic
1048963416 8:139598100-139598122 GAGGATGAGGATAGCCAGAGGGG + Intergenic
1049144832 8:140991904-140991926 GAGGATCACCTGAGGCTGGGAGG + Intronic
1049188034 8:141269395-141269417 GTGAATCTGCAGCGGCAGAGGGG + Intronic
1049207044 8:141368427-141368449 GAGTATCAGCAGAAGCACACGGG - Intergenic
1049331475 8:142056362-142056384 CGGCATGAGCAGAGGCAGAGAGG + Intergenic
1049405885 8:142451691-142451713 GGGGAACAGCAGAGGCCGCGCGG + Intronic
1049762070 8:144336251-144336273 GAGGAGCGGCGGAGGCAGCGCGG + Exonic
1049773833 8:144395710-144395732 GAGGAGCCCCAGAGGCTGAGTGG - Intronic
1049829406 8:144690732-144690754 GAGGATCACCAGAGCCAAGGAGG - Intergenic
1050681166 9:8113411-8113433 CAGGATGAGCAAAGGCAGAATGG + Intergenic
1051322025 9:15914941-15914963 GAGGGTGAGCAGAAGCAGAGTGG - Intronic
1051452057 9:17207635-17207657 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1051695895 9:19767597-19767619 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1051993451 9:23182662-23182684 GAGGCTCAGCTGAGGCAGTTTGG + Intergenic
1052144127 9:25026158-25026180 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1052329287 9:27251328-27251350 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1052363628 9:27587348-27587370 GAGGATTACCAGAGGCTCAGAGG - Intergenic
1052643507 9:31200703-31200725 GGGTATCAACAGAGGCTGAGGGG + Intergenic
1053063123 9:35046814-35046836 GAGGATCACCTGAACCAGAGAGG + Intergenic
1053400475 9:37815881-37815903 GAGGATCAGCTGAGTCAGGGAGG - Intronic
1053410944 9:37915772-37915794 GAGGATCACCAGAGCCTGGGAGG + Intronic
1053443443 9:38134214-38134236 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1053736293 9:41104878-41104900 GAGGATCCTCAGAGCCAGCGGGG - Intergenic
1054692080 9:68326522-68326544 GAGGATCCTCAGAGCCAGCGGGG + Intergenic
1054701734 9:68419590-68419612 GAGGATCAGCAGAGGAATTGTGG - Intronic
1054725418 9:68645440-68645462 GAGGATAAGCACAGGCCGTGAGG - Intergenic
1055012297 9:71579998-71580020 GAGCAAAAGCAGAGGCAAAGTGG - Intergenic
1055023534 9:71695181-71695203 CAGCATCAGCAAAGGCAGAGTGG - Intronic
1055210237 9:73782887-73782909 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1055345124 9:75327443-75327465 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1055628676 9:78200799-78200821 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1056366742 9:85912555-85912577 GAGGAACAGGAAAGGGAGAGTGG + Intergenic
1056385227 9:86091052-86091074 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1056417386 9:86390112-86390134 GAGGATTAGCTGAAGCAGGGTGG + Intergenic
1056522069 9:87411029-87411051 GAGAGTCAGCAAAGGCAGATAGG - Intergenic
1056666746 9:88587476-88587498 AAGGAGCAGCAGAGGAAGGGTGG + Intergenic
1057594207 9:96401134-96401156 GAGGATCAGCTGAGCCTGGGAGG + Intronic
1057749903 9:97783977-97783999 GAGGATGGTCAGAGGCATAGCGG + Intergenic
1057791417 9:98127444-98127466 GTGGCTCAGGACAGGCAGAGTGG + Intronic
1057971894 9:99566758-99566780 GATGGTGAGCAGAGGGAGAGTGG + Intergenic
1058182436 9:101815365-101815387 GAGGGTGAGCAGAAGCAGCGTGG + Intergenic
1058265712 9:102897255-102897277 GAGGGTGAGCAGAAGCAGGGAGG + Intergenic
1058452400 9:105109538-105109560 AAGGATTAGAAGAGACAGAGGGG + Intergenic
1059207912 9:112483828-112483850 GAGGATCGACTGAGGCAGGGAGG + Intronic
1059370332 9:113825626-113825648 GAGTGTCAACAGAGGCTGAGTGG + Intergenic
1059726670 9:117015098-117015120 GAGGATCACCTGAGCCAGGGAGG - Intronic
1060220654 9:121762493-121762515 GAGGGACAGCAGGGGCAAAGGGG - Intronic
1060504554 9:124188200-124188222 GAGGAGCAGCAAAGGCTGGGGGG - Intergenic
1060628614 9:125136198-125136220 GAGGATCAGCTGAGACTGGGAGG - Intronic
1061223954 9:129269669-129269691 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1061307317 9:129739635-129739657 GAGGATCTGCAGAGCCATGGAGG + Exonic
1061521489 9:131120838-131120860 GGGGATCAGCTGGGGCAGCGGGG - Exonic
1061784485 9:133018346-133018368 GAGGATCACCAGAGCCCGGGAGG + Intergenic
1061808136 9:133147866-133147888 CAGGACCAGCAGAGGGAAAGAGG - Intronic
1062163878 9:135096035-135096057 GAGGATAAGGGGAGGGAGAGGGG - Intronic
1062170853 9:135133874-135133896 GAGGGGCAGCGCAGGCAGAGTGG - Intergenic
1062310598 9:135933862-135933884 GAAGGTCAGCAGATGCAGAAAGG + Intronic
1062315625 9:135965701-135965723 GAGGAACAGCAATGCCAGAGAGG + Intergenic
1203776692 EBV:77244-77266 AAGGGTCAGCACAGCCAGAGAGG + Intergenic
1186599890 X:11025091-11025113 GAAGGTGAGCAGAAGCAGAGTGG - Intergenic
1186773393 X:12839656-12839678 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1186798167 X:13066694-13066716 CAGGAAGAGCAGAGGCACAGAGG - Intergenic
1187093948 X:16127078-16127100 GATGATCACCAGAGTCACAGGGG + Intronic
1187391274 X:18887923-18887945 GAGGTTGGGGAGAGGCAGAGAGG + Intergenic
1187412590 X:19063860-19063882 GAGGGTCCCCAGAAGCAGAGTGG + Intronic
1187660759 X:21544734-21544756 GAGGGTGAGCAGAAGCAGGGTGG + Intronic
1187840496 X:23482177-23482199 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1188193129 X:27196830-27196852 GAGGATGAGCAGAAGCAGGGTGG + Intergenic
1188289453 X:28369698-28369720 GAGGATCACCTGAGCCAGGGAGG - Intergenic
1188521106 X:31039015-31039037 GACGATGACCACAGGCAGAGAGG - Intergenic
1189523488 X:41795574-41795596 GAGGATCACCTGAGCCCGAGAGG + Intronic
1189709810 X:43797756-43797778 GAGGATGAATGGAGGCAGAGAGG - Intronic
1190280083 X:48923624-48923646 GAGGCTTACCAAAGGCAGAGGGG + Exonic
1190405458 X:50082400-50082422 GAGGATCATCTGAGCCAGGGAGG - Intronic
1190718992 X:53131253-53131275 GAGGATATGAACAGGCAGAGTGG + Intergenic
1190963805 X:55278395-55278417 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191004996 X:55702268-55702290 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191024202 X:55896238-55896260 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1191135488 X:57059245-57059267 GAGGATGAGCAGAAGCAGGGTGG - Intergenic
1191148181 X:57190691-57190713 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1191174241 X:57482534-57482556 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1191591253 X:62887957-62887979 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191676556 X:63797624-63797646 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1191809865 X:65175174-65175196 GAGGGTAAGCAGAAGCAGGGTGG - Intergenic
1191987306 X:66995435-66995457 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1192108756 X:68342849-68342871 GAGGATCACCTGAGCCTGAGAGG + Intronic
1192499366 X:71639403-71639425 GAGGCCAAGGAGAGGCAGAGAGG - Intergenic
1192759273 X:74078346-74078368 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193010558 X:76670876-76670898 GAGGGTGAGCAGAAGCAGAGTGG + Intergenic
1193019981 X:76781082-76781104 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193065357 X:77253906-77253928 GAGGGCAAGCAGAAGCAGAGTGG + Intergenic
1193087817 X:77463187-77463209 GAGGATCACCAGAGCCCGAGAGG - Intergenic
1193122361 X:77836804-77836826 GAGGATCACCTGAGCCAGGGAGG + Intronic
1193266772 X:79481847-79481869 GAGGGTGAGCTGAAGCAGAGTGG + Intergenic
1193341384 X:80352970-80352992 GAGGGTAAGCAGAAGCAGGGTGG - Intronic
1193356077 X:80521465-80521487 GAGGGTGAGCCGAAGCAGAGTGG - Intergenic
1193398182 X:81010527-81010549 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1193514314 X:82445443-82445465 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1193571597 X:83151536-83151558 GAGGACGAGCAGAAGCAGGGTGG + Intergenic
1194203193 X:90979359-90979381 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1194315371 X:92369793-92369815 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1194427710 X:93760414-93760436 CAGTAGCAACAGAGGCAGAGCGG + Intergenic
1194631539 X:96291548-96291570 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1194643487 X:96429882-96429904 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1195109582 X:101632984-101633006 GAGGATCACCTGAGCCTGAGAGG + Intergenic
1195299591 X:103514437-103514459 GAGGATCACCTGAGCCAGGGAGG - Intronic
1195565393 X:106333855-106333877 GAGAAATAGCAGAGGCAGAAAGG - Intergenic
1195844358 X:109209872-109209894 GAGGGTGAGCAGAAGCAGAGTGG - Intergenic
1195891176 X:109696952-109696974 GAGGATCACCAGAGTCTGGGAGG + Intronic
1196133315 X:112181025-112181047 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic
1196476518 X:116092469-116092491 GAGGGTGAGCAGACGCAGGGTGG - Intergenic
1196545818 X:116962885-116962907 GAGGGTTAGCCGAAGCAGAGTGG - Intergenic
1196603049 X:117623388-117623410 GAGGGTCAGCAGAAGCAGGGTGG - Intergenic
1196738719 X:119005200-119005222 GAGGAGCAGCACAGGAAGAAGGG - Intronic
1196844615 X:119888335-119888357 GAGGAGCAGGTGGGGCAGAGCGG - Intergenic
1197051097 X:122060879-122060901 GAGGGCCAGCAGAAGCAGGGTGG + Intergenic
1197134138 X:123041431-123041453 AAGGATCAGCAGTTGCAGAGGGG + Intergenic
1197355796 X:125436530-125436552 GAGGATGAGAAAAGTCAGAGAGG + Intergenic
1197614400 X:128675351-128675373 GAGGGTGAGCAGAAGCAGGGAGG - Intergenic
1198018233 X:132633137-132633159 CAGCATGAGCAGAGGCACAGAGG + Intronic
1198071278 X:133150923-133150945 TAGAATCAACAGAAGCAGAGTGG + Intergenic
1198320662 X:135515995-135516017 GAGGATCACTTGAGCCAGAGAGG + Intergenic
1198753460 X:139958778-139958800 GAGGGCGAGCAGAAGCAGAGTGG + Intronic
1198853789 X:140994935-140994957 CAGGATATGCAAAGGCAGAGAGG - Intergenic
1198944624 X:141996603-141996625 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1199171661 X:144740686-144740708 GAGGGTCAGGAGAAGCAGAGGGG - Intergenic
1199861081 X:151801074-151801096 GAGGATGACCAGCTGCAGAGAGG - Intergenic
1200046926 X:153408180-153408202 GAGGATCAGCAGAGGGCCAGTGG + Intergenic
1200549026 Y:4554785-4554807 GAGGGTGAGCAGAAGCAGGGTGG - Intergenic
1200623420 Y:5481328-5481350 GAGGGTGAGCAGAAGCAGGGTGG - Intronic
1200664047 Y:5998794-5998816 GAGGATGAGCTGAAGCAGGGTGG + Intergenic
1201165449 Y:11204664-11204686 GTGGCTCAGCAGTGGCAGAAAGG + Intergenic
1201583988 Y:15540534-15540556 GTGGATCAGGAGAGAGAGAGAGG + Intergenic
1201696570 Y:16833194-16833216 GAAGATCAGCAGAGGTAAAAGGG - Intergenic
1201736616 Y:17270346-17270368 GAGGATCACCTGAGGCCGGGAGG - Intergenic
1201922123 Y:19245213-19245235 GAGGGTGAGCAGAAGCAGGGTGG + Intergenic