ID: 916204351

View in Genome Browser
Species Human (GRCh38)
Location 1:162300822-162300844
Sequence GGAAGCAACAGGTCTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916204351_916204356 20 Left 916204351 1:162300822-162300844 CCCTCCTGAGACCTGTTGCTTCC 0: 1
1: 0
2: 1
3: 26
4: 233
Right 916204356 1:162300865-162300887 GTAAATCTGCCTTATCATTCTGG 0: 1
1: 0
2: 0
3: 9
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916204351 Original CRISPR GGAAGCAACAGGTCTCAGGA GGG (reversed) Intronic
900493735 1:2966680-2966702 GGAAGCCACAGGGCTCAAGATGG - Intergenic
902484082 1:16730809-16730831 GGAAGCAACAGGTGTTGGGGAGG - Intergenic
902648808 1:17823182-17823204 GGTAGCTAAAGGTGTCAGGATGG - Exonic
905155924 1:35981692-35981714 GGAAGTGACAGATCTCAGAAAGG - Intronic
905307219 1:37028087-37028109 AGAAGGAACAGGACTAAGGAAGG + Intronic
910252696 1:85214620-85214642 GGATGCAACATGTGTGAGGAAGG + Intergenic
910457438 1:87412497-87412519 GGAAGGAACCGGTCTCAGCTAGG - Intergenic
912386057 1:109271727-109271749 GGGAGCCAGGGGTCTCAGGAGGG + Intronic
915086886 1:153395078-153395100 GGCAGGGACAGGTCTCAGGTGGG + Intergenic
915400133 1:155616067-155616089 TGAGGAAACAGGACTCAGGAAGG + Intergenic
915417339 1:155752262-155752284 TGAGGAAACAGGACTCAGGAAGG + Exonic
915483299 1:156202270-156202292 GGAAGGAAGAGAACTCAGGAGGG - Intronic
916204351 1:162300822-162300844 GGAAGCAACAGGTCTCAGGAGGG - Intronic
919799508 1:201344933-201344955 GGAAGCAGCAGGAGGCAGGAGGG - Intergenic
922716720 1:227879493-227879515 GGAAGAAGGAGTTCTCAGGAGGG + Intergenic
923854054 1:237827230-237827252 GAAGCCAGCAGGTCTCAGGAGGG + Intronic
924132886 1:240930603-240930625 GGAAACCACAGTTCTCAGGATGG - Intronic
1063017711 10:2095126-2095148 GGAAGCCACTGGGCTCAGGAAGG - Intergenic
1063385739 10:5615466-5615488 GGAAGAAGCAGCTCTCAGGGAGG + Intergenic
1064204932 10:13314749-13314771 GAAAGCAACAGGACTTAGAAAGG + Intergenic
1064345436 10:14528529-14528551 TGAAGAAACAGATCTCAAGAGGG + Intronic
1065312402 10:24429200-24429222 GGAAGGATCAGGTATCAGAAAGG - Intronic
1066506513 10:36050264-36050286 GGATCCAACAATTCTCAGGAGGG - Intergenic
1067295245 10:44971897-44971919 TGAAACAACAGGTATCAGGCAGG - Intronic
1069416480 10:68205217-68205239 GGAAGCCACAGGCATCAAGAAGG - Intronic
1069898746 10:71695146-71695168 GGAAGCCCCAGGTCACAGCAAGG + Intronic
1071954367 10:90741830-90741852 CTCAGGAACAGGTCTCAGGATGG - Exonic
1073473025 10:103735603-103735625 GGAAACACCAGGCCTCAGGACGG + Intronic
1074695927 10:116050163-116050185 GGGAGCAGCAGATCCCAGGAGGG - Intergenic
1075508807 10:123052022-123052044 GGAAGCACCAGGGACCAGGAGGG - Intronic
1077516389 11:3004448-3004470 GGATGCCACAGCTCTCAGGAAGG - Intronic
1079147307 11:17864884-17864906 CGTAGCAACAGGACCCAGGAAGG + Intronic
1079147403 11:17866260-17866282 GGTAGCAACAGGACCCAGGAAGG + Intronic
1079238056 11:18703452-18703474 GGAAGCAGCAGGTCTCAAGTGGG - Exonic
1079382815 11:19953483-19953505 GAAAGCAGCATGTCCCAGGAGGG - Intronic
1083437429 11:62652459-62652481 GGAAGAAACAGATGTTAGGAGGG - Intronic
1083543672 11:63533242-63533264 GGAAGAAACAGGCTACAGGATGG - Intergenic
1083865960 11:65453114-65453136 AGAAGCAACAGGTCAAAGAAAGG + Intergenic
1085701972 11:78753618-78753640 AGAAGAAACAGCTATCAGGAAGG - Intronic
1087044806 11:93836068-93836090 GGAAGGAGAAGGTGTCAGGATGG - Intronic
1088179108 11:107088962-107088984 GGAAGGAACAGGGCTTAAGAAGG + Intergenic
1089620229 11:119717863-119717885 GGAAGCAACAGGAGGAAGGAGGG - Intronic
1091176881 11:133566850-133566872 GGAAGGAACAAGCCTTAGGAAGG + Intergenic
1091567554 12:1660254-1660276 GGAAGGCACAGTTCTCAGGAGGG + Intergenic
1092895165 12:13003465-13003487 CTCAGGAACAGGTCTCAGGATGG + Intergenic
1094426442 12:30321465-30321487 CCAAACAACAGGTCTCAGCAGGG + Intergenic
1096584222 12:52609092-52609114 GGAGGCCGCAGGTCTCAGCAAGG + Intronic
1099301647 12:80902558-80902580 GGAAGCAAAAGATCTCAACAAGG - Intronic
1101806452 12:108068388-108068410 CTAAGCAACAGGACTCAGGAAGG - Intergenic
1102788250 12:115621645-115621667 GGCAGCAACAGCTCTCTAGAGGG + Intergenic
1103714440 12:122935783-122935805 GGAAGCAAGAGGCCACAGCAGGG + Intronic
1106223740 13:27769722-27769744 GGAAACAACAGGTATCATTAAGG - Intergenic
1106481731 13:30142059-30142081 GGAAAGAACAGCTCTCACGAGGG + Intergenic
1106541484 13:30694612-30694634 GGAAGCCCCAGATATCAGGAAGG - Intergenic
1108379708 13:49844224-49844246 GGAAGCACCAGGTTTCTGGGAGG + Intergenic
1109029475 13:57174706-57174728 GGATGCAACAAGTGTCAGTAAGG + Intergenic
1109153336 13:58872371-58872393 GGTAGAAACAGGTATCAGAATGG + Intergenic
1111264911 13:85796343-85796365 TGAAGCAAAAGGTATCAAGATGG - Exonic
1112724862 13:102291765-102291787 GGATTCAACAGGTCCCAGGAAGG + Intronic
1113492104 13:110700255-110700277 GGAGACAACAGGACTCTGGAAGG + Intronic
1113886771 13:113665162-113665184 GGAAGCAAAGGGTCGCAGAAAGG - Intergenic
1113904432 13:113812747-113812769 GGAAGCAGCAGGTCCCGGGTGGG + Exonic
1114262862 14:21051425-21051447 GTAAGTCAGAGGTCTCAGGAGGG + Intronic
1114560890 14:23589645-23589667 GGAAGCAAATGGGCTAAGGAGGG - Intergenic
1114887237 14:26868997-26869019 GAAAACAACAAGCCTCAGGAAGG - Intergenic
1116471769 14:45293784-45293806 GGAGGCAAAAGGTCTCCAGAAGG + Intergenic
1117361278 14:54976680-54976702 GGAAGCAACACTTCTCAGTATGG - Intronic
1118718703 14:68578676-68578698 GGAAGGAATAGATCACAGGAAGG + Intronic
1119402384 14:74372043-74372065 GGAAGGAAGAGGTCCCAGAAGGG - Intergenic
1121906580 14:97751673-97751695 GGAAGCAACACGAGTAAGGAAGG + Exonic
1122981508 14:105194267-105194289 GGAGGCAAGTGGTCCCAGGAAGG - Intergenic
1123403123 15:20005323-20005345 GAAAGGAGCAGGACTCAGGACGG + Intergenic
1123512462 15:21011977-21011999 GAAAGGAGCAGGACTCAGGACGG + Intergenic
1123818363 15:24001755-24001777 GGAGGCTGTAGGTCTCAGGAGGG + Intergenic
1125898026 15:43318928-43318950 GGAAGCAGCAGGGCTGAGAATGG + Intergenic
1126414810 15:48406470-48406492 GGAAGCAGCAGGCCTCAGGGAGG + Intergenic
1127378231 15:58404819-58404841 CGAGGCAACAAGTCTAAGGATGG - Intronic
1129102430 15:73278624-73278646 GAAGGCACCAGCTCTCAGGATGG - Intronic
1131126793 15:89865637-89865659 GGAAGAAACAGGCCTCTAGAAGG - Intronic
1131602267 15:93861664-93861686 GGATGCATCACGTCTCAGGCAGG - Intergenic
1131681129 15:94725059-94725081 GTAAGCAACAAGCCTCAGCAGGG + Intergenic
1131685288 15:94760684-94760706 GGAAGGAAGATGTCCCAGGAAGG - Intergenic
1132064696 15:98721188-98721210 GGAAGCAAGAGTCCTCAGTAAGG - Intronic
1132518928 16:378583-378605 GGACCCAGCAGGTGTCAGGAAGG + Intronic
1135195803 16:20393563-20393585 GGAGGCACCAGGACTCAGGGGGG + Intronic
1135490955 16:22908991-22909013 GGAAGAGCCAGGTCTCAGAAAGG + Intronic
1136092272 16:27929044-27929066 AGATGCAATAGGTCTCAGGTAGG - Intronic
1137569778 16:49557817-49557839 GGAACCAAGGGGGCTCAGGATGG - Intronic
1139541541 16:67621323-67621345 AGAATCTACAGGTCTTAGGAAGG - Intronic
1140225505 16:73073286-73073308 TGAAGGAACAGGTCTCTAGAAGG - Intergenic
1141287110 16:82682831-82682853 GGAAGCACCAGTCCTCAGGGTGG - Intronic
1142305934 16:89285662-89285684 GGAAGCGAGAGGTCACAGGCAGG + Intronic
1142794573 17:2297707-2297729 GGAAGCAACTGGTGTAGGGAAGG + Intronic
1143017199 17:3897253-3897275 GGAAGAAACAGGGCTCAAGCAGG + Exonic
1146453772 17:32994343-32994365 GGAAGAAACAAGCCTCAGGGAGG + Intronic
1147456702 17:40542471-40542493 GGAAGGAAAAGGTCTCAGTCTGG - Intergenic
1147632342 17:41940206-41940228 GGAAGCAGCAGGACTCAGGTCGG - Intronic
1148217303 17:45840167-45840189 CCAGGCAGCAGGTCTCAGGAAGG - Intergenic
1148560759 17:48604583-48604605 GGAAGCAACGGCTCTCACGTTGG - Exonic
1148742184 17:49899075-49899097 TGCAGCAACAGGTCTCTGGGAGG - Intergenic
1148994545 17:51698110-51698132 GGAAGCAGCAGGACCCAGCAGGG - Intronic
1150302794 17:64060186-64060208 GGGAGCAAGAGGGCACAGGAGGG - Intronic
1151196523 17:72435585-72435607 GCAAGCAACAGGAATTAGGATGG - Intergenic
1152000813 17:77644402-77644424 CTAAGCAACAGCTCACAGGACGG + Intergenic
1152038284 17:77886914-77886936 GGAAGCTGCAGGTCACAGGAGGG - Intergenic
1152041585 17:77907070-77907092 GGAAGAAACAGGTTTCTGGAGGG - Intergenic
1152635984 17:81430718-81430740 GGAAGCAGCAGGTCCCTGGCAGG - Intronic
1153275673 18:3365136-3365158 GAAAGGAACAGGTCTTAGAATGG + Intergenic
1156079364 18:33315456-33315478 GGTAGCTAAAGGGCTCAGGAAGG - Intronic
1156881241 18:42083057-42083079 GGAAGGAGCATCTCTCAGGAGGG + Exonic
1157472144 18:47997817-47997839 TAAAGCAAAAGGTCTCTGGAGGG + Intergenic
1159987237 18:74857956-74857978 GGAAGCAAAGGGAGTCAGGAAGG - Intronic
1160135023 18:76264523-76264545 GGAAGTAACAGGCATCAGGGCGG + Intergenic
1161989531 19:7676885-7676907 GGAGCCAAGAGGTCTCAGGAAGG - Exonic
1162371836 19:10284430-10284452 CGAAGCCAGAGGTCTCAGAAGGG + Exonic
1164412171 19:28015098-28015120 GGAACCAACAAGTCTCCTGAGGG + Intergenic
1164676366 19:30104260-30104282 GGAATCTACAGGACTGAGGAAGG - Intergenic
1164870585 19:31640165-31640187 GGAAGAAAGAGGGCTCTGGAGGG + Intergenic
1165695567 19:37898259-37898281 TTAAGCAACAGTCCTCAGGAGGG - Exonic
1167707447 19:51090074-51090096 GGAAGAAACAAGCCACAGGACGG - Intergenic
1168148314 19:54431468-54431490 GGAAGGAAAAGGTGGCAGGAAGG - Intronic
1168288184 19:55344762-55344784 GGAAGCAGAAGGAATCAGGAGGG + Intronic
1168479820 19:56710268-56710290 GGAGGACACAGGACTCAGGAAGG - Intergenic
1202708096 1_KI270713v1_random:39018-39040 GGAAGCAACAGGTGTTGGGGAGG + Intergenic
925111344 2:1341064-1341086 GGCAGCCAAAGGTCTCAGAAAGG - Intronic
926147987 2:10408427-10408449 TGATGCAACAGCTTTCAGGAAGG + Intronic
926634450 2:15165093-15165115 TGAAGAAAAAGGTCTCAGGAGGG + Intergenic
929834306 2:45380594-45380616 GAAAGAAACAGGAGTCAGGAGGG + Intergenic
933718818 2:85383517-85383539 AGAAGCTACTGGTCTCAGGCTGG + Intronic
936987106 2:118321944-118321966 GGAAGCCAGAGGTCACAGCAGGG - Intergenic
937055277 2:118929394-118929416 GGCAGGAACAGGTTTGAGGATGG + Intergenic
937287496 2:120762515-120762537 GGAAGGGGCAGGTCCCAGGAAGG + Intronic
937328055 2:121004111-121004133 GTAAGCAACAAGACTCAGCAAGG + Intergenic
937916563 2:127102100-127102122 TGAAGAAACAGGGCTCAGGAAGG + Intronic
940441187 2:153718638-153718660 GGAGGCAGCAGGTGTCAGGACGG + Intergenic
941269177 2:163403724-163403746 GGAAAGAACAAGTCTCATGAGGG - Intergenic
943703578 2:191012569-191012591 GGAAGGAGCAGGTCTTGGGATGG - Intronic
943740301 2:191400073-191400095 GGATGAAACAGTTCTCAGAAAGG - Intronic
944613269 2:201433227-201433249 GTAAGCAGCAGACCTCAGGAAGG + Intronic
945568528 2:211434399-211434421 AGAAGCAACAGATCTCTCGAAGG - Intronic
948062484 2:235052017-235052039 GGAGGCCACAGGTCTCAGTCAGG + Intronic
948095721 2:235332614-235332636 GGAAGCTGTTGGTCTCAGGAAGG - Intergenic
948312374 2:236998049-236998071 TGAAGCATCAGGTCTCAAGAAGG + Intergenic
948320923 2:237068535-237068557 GAAAGCAACAGGACTGAGAAGGG - Intergenic
948366786 2:237460644-237460666 CGAAGAACCAGGACTCAGGAAGG + Intergenic
1168938401 20:1687559-1687581 GGAAGCAACTGATCTCAGAGTGG - Intergenic
1168967837 20:1910012-1910034 GGGAGAAGCAGGTCACAGGAAGG + Intronic
1170525840 20:17236895-17236917 GGAAGGAAGAGGTGTTAGGATGG + Intronic
1171200928 20:23241713-23241735 GGAAGCAGAAGGTCTGAGGGAGG + Intergenic
1171212791 20:23329557-23329579 AAAACCAAGAGGTCTCAGGAGGG - Intergenic
1173664330 20:44754163-44754185 GGAAGGAGCAGGGCTCTGGAGGG - Intronic
1173803193 20:45907813-45907835 GGCAGCGACAGGTCGCAGGGTGG - Intronic
1174418442 20:50383493-50383515 GGATAAAACAAGTCTCAGGATGG - Intergenic
1176302638 21:5105837-5105859 GGGAGCAACAGGGCCCTGGAAGG + Intergenic
1178937623 21:36876741-36876763 GGAAGTATTAGGTATCAGGAAGG + Intronic
1179408203 21:41142602-41142624 GGAACCAAAAGGCCCCAGGAGGG - Intergenic
1179422405 21:41247310-41247332 CGAAGCAGCAGGTCTCAAGGCGG + Intronic
1179854387 21:44156086-44156108 GGGAGCAACAGGGCCCTGGAAGG - Intergenic
1180869733 22:19139310-19139332 GGTAGCAGCAGGTGTCAGAAGGG + Intronic
1182107551 22:27700023-27700045 GGATAGAACAGGACTCAGGAAGG - Intergenic
1182976530 22:34627504-34627526 GAAAGCAAGATGTCTGAGGAAGG + Intergenic
1183547135 22:38460309-38460331 GGCAGCCACAGGTCTGTGGAAGG + Intergenic
1183703201 22:39461411-39461433 GGGTGCAAAGGGTCTCAGGACGG - Intronic
1184037532 22:41925842-41925864 GGAAGAGACAGGTTGCAGGAAGG - Intronic
1184514499 22:44953652-44953674 GGAAGCTGCAGGTCTCAGGAAGG - Intronic
949984899 3:9532916-9532938 GGAAGAAACAGGCCTCAGTGGGG + Intronic
951159764 3:19404269-19404291 GAAAGCAACAGCTCTTTGGAGGG - Intronic
951501343 3:23390514-23390536 GGAAGGATCAGGTCACATGAAGG - Intronic
952838141 3:37621734-37621756 GCAAGCATCAGTGCTCAGGAGGG - Intronic
953993813 3:47504283-47504305 GGAAGCAACACGTGGCAGGTGGG - Intronic
954139202 3:48596197-48596219 GGAAGCTACAGGTACCATGAGGG - Intergenic
954615379 3:51966686-51966708 GGGTGCCACAGGTCTCAAGATGG + Intronic
955216174 3:56986533-56986555 GGAAGCAACAGCCCTGGGGACGG + Intronic
955514690 3:59715125-59715147 GGAGGCAAAAGGACTCAGGCAGG - Intergenic
960314759 3:116162961-116162983 GTAAGCAACAGGTCCAGGGATGG - Intronic
961096052 3:124157889-124157911 TGGAGCAACAGGACTCAGGAAGG - Intronic
961559510 3:127718989-127719011 AGCAGCAACAGATCTCAGGGAGG + Intronic
962317678 3:134368896-134368918 GGAATCACAAGGTCCCAGGAAGG - Intronic
962464847 3:135648758-135648780 AGAAGCAACACAGCTCAGGAGGG + Intergenic
963650834 3:147977875-147977897 GGAAGTCACAGGTCACTGGAAGG + Intergenic
963919617 3:150893048-150893070 TTAAGCAGCAGGTCTCAGGTGGG - Intronic
966656982 3:182370083-182370105 GGAAGAAACAGTTGTCTGGAGGG + Intergenic
967563389 3:190944466-190944488 GAGAGAAACAAGTCTCAGGAAGG + Intergenic
968280936 3:197476256-197476278 GGAAGGAAAAGGACTGAGGATGG - Intergenic
969131913 4:4996293-4996315 GGTAGCAACTGTCCTCAGGAGGG - Intergenic
970319551 4:14862035-14862057 GGAACCACCAGGTCCTAGGAGGG - Intergenic
971179925 4:24320197-24320219 GGAAACAAAATGTCTCAGGAAGG - Intergenic
972047049 4:34679352-34679374 GGAAGTAACAAGTCACAGCATGG + Intergenic
972308849 4:37860211-37860233 GAAAATAACAGTTCTCAGGAAGG - Intronic
974959325 4:68678147-68678169 GGAAACAACAGGTGCCAGGGAGG - Intergenic
975591085 4:76000561-76000583 AGAGGCAACAGGACTCTGGAAGG - Intergenic
975780589 4:77835248-77835270 GGAAGCACCATGTCCTAGGAAGG - Intergenic
976695078 4:87910401-87910423 GGAAGCAGGAGGTCAGAGGAAGG - Intergenic
979140274 4:117163300-117163322 GCAAACAAGATGTCTCAGGATGG - Intergenic
981244699 4:142521607-142521629 GGAAACAAAAGGGGTCAGGATGG - Intronic
986739742 5:10695662-10695684 GGAAGCAGTAGTTCTGAGGAAGG - Intronic
991569748 5:68041584-68041606 GGGAGCAAAAAGGCTCAGGAGGG - Intergenic
992216287 5:74527957-74527979 GGAGGCAACAGGTGTGGGGAGGG + Intergenic
996780693 5:127183522-127183544 CTAAGCTACAGGTGTCAGGAGGG - Intergenic
997618028 5:135266048-135266070 GGAAGCCACAAGTCTCAGATTGG + Intronic
998851257 5:146352965-146352987 AGCAGCATCAGCTCTCAGGATGG - Intergenic
999209080 5:149871951-149871973 GGAAGAGAGAGGTGTCAGGATGG + Intronic
999759592 5:154690287-154690309 GGAAGCAGCAGGTTTCATGTAGG + Intergenic
1000209292 5:159096059-159096081 CAAAGGAACAGGCCTCAGGAAGG + Intronic
1001092193 5:168749725-168749747 GGAAGGAGGAGGTCTCAGGAAGG + Intronic
1004162679 6:13228930-13228952 GCAGGCAACAAGTCTGAGGATGG - Intronic
1005917398 6:30365357-30365379 GAAAGGAAGGGGTCTCAGGACGG - Intergenic
1006359067 6:33577455-33577477 GGAAGGAGCAGGACTCAGGCAGG - Intronic
1009340572 6:62549229-62549251 GTTAGCACCATGTCTCAGGATGG + Intergenic
1010141468 6:72619911-72619933 GCAGGCAAGAAGTCTCAGGAAGG - Intergenic
1016277302 6:142369816-142369838 GGAAATAACTGGTTTCAGGAAGG - Intronic
1016527722 6:145021383-145021405 GGAAGCAGCTGGTGTCTGGAAGG - Intergenic
1018368963 6:163149833-163149855 GGGAGCAACAGGACCCAGGTAGG - Intronic
1018424743 6:163670317-163670339 GAAAGCTATAGGACTCAGGAAGG - Intergenic
1019631552 7:2052386-2052408 GCAAGCAACAGCACCCAGGAGGG + Intronic
1019684226 7:2371621-2371643 GAAAGCCACAGCCCTCAGGATGG - Intronic
1020098347 7:5380744-5380766 GGCAGTGACAGGTCTCAGGCAGG + Intronic
1022101132 7:27169743-27169765 GGAAGCCACAGGCCCCAGTAAGG + Intronic
1022507814 7:30917462-30917484 GAAAGCAGCAGGTCTCAACAAGG - Intronic
1023648544 7:42344546-42344568 AGAAGCAGAAGGCCTCAGGAAGG + Intergenic
1024082351 7:45865807-45865829 GGCAGCAGCAGGTGTCAGAAAGG + Intergenic
1024655540 7:51448476-51448498 GCAAGGCACAGGACTCAGGAAGG + Intergenic
1028923668 7:96334367-96334389 GGCAAGAACAGGTCTCAGGCTGG - Intergenic
1029193962 7:98791374-98791396 GGAAGGAACAGAGCTCAGGCAGG + Intergenic
1030544282 7:110872908-110872930 GGAAGCAACAGGTATCTGGTAGG + Intronic
1030698588 7:112614373-112614395 GGAAGCAAGATGTGTGAGGAAGG - Intergenic
1034140145 7:148807995-148808017 TGAAGCAAGTGGTCCCAGGAAGG + Intronic
1034487149 7:151373128-151373150 GGCAGGATCAGGTCTCTGGAAGG + Intronic
1034545590 7:151786627-151786649 TGAAGGATAAGGTCTCAGGAAGG - Intronic
1035529549 8:340005-340027 GGAGCCAACAGGACTCAGGCTGG + Intergenic
1036595160 8:10205314-10205336 GGATGCTACAGGTGTCTGGAGGG + Intronic
1037135102 8:15450992-15451014 GGAAGCTGCAGTTCTCAGGCAGG - Intronic
1037564350 8:20104979-20105001 GGAAGCAACATGTATCAGTCAGG - Intergenic
1038054930 8:23849245-23849267 GAAAGCAGGATGTCTCAGGAAGG + Intronic
1038407085 8:27330066-27330088 GGAAGAAACAGGCCTTTGGAGGG + Intronic
1040840565 8:51780239-51780261 GGAATCAGCAGGTCCTAGGAGGG - Intronic
1043560101 8:81483205-81483227 GGAAGCTGCAGTTTTCAGGAGGG + Exonic
1043683370 8:83059700-83059722 GGAAGCTAGAGTTCACAGGACGG - Intergenic
1045056983 8:98377708-98377730 GCAAGAAGCAGCTCTCAGGATGG - Intergenic
1047030014 8:120866420-120866442 GAAAGCAATTGGTCCCAGGAGGG + Intergenic
1049363792 8:142226766-142226788 GGAAGCAGCAGGGGTCAAGAAGG + Intronic
1049410461 8:142471733-142471755 GGCACCAGCAGATCTCAGGATGG - Intronic
1050609497 9:7336860-7336882 GGAAGTCACAGGTCTCTGTAGGG + Intergenic
1052685994 9:31756686-31756708 GGAAGGAACAGGTGACAAGAAGG + Intergenic
1054771565 9:69088688-69088710 GGAAGAAGCAGGACTCAGGCCGG - Intronic
1057211318 9:93202539-93202561 GGGAGCCACAGCTCTCAGGGAGG + Intronic
1058596489 9:106621260-106621282 GGAAGGAAAAGGTTTCAGGAAGG + Intergenic
1060112922 9:120919411-120919433 GGAGGCCCCAGGTCTCAGAATGG - Intronic
1060733087 9:126050166-126050188 GGAGGAAACAGGTCCCTGGACGG - Intergenic
1060950552 9:127599437-127599459 GGGAGGAACAGGCCTCAGGGAGG - Intergenic
1062328359 9:136023472-136023494 GGAAGCCTCAGCTCTAAGGAGGG - Intronic
1186716117 X:12253704-12253726 GGGAGGTACAGGTTTCAGGAAGG + Intronic
1186877462 X:13830365-13830387 GGAAGTAACAGGAGTAAGGAAGG - Intronic
1187726836 X:22212105-22212127 GGAAGTAACAGGTATAAGAAAGG + Intronic
1188515657 X:30982780-30982802 GGTAGCTACAGGTCCCAGAAGGG + Intergenic
1189990529 X:46589724-46589746 GGGAGCTACAGGTCTCATGAAGG + Intronic
1190370207 X:49733091-49733113 GAAACAAACAGATCTCAGGAAGG + Intergenic
1190733796 X:53241921-53241943 TGAAGAAACAGGTGTCAGCAAGG + Intronic
1195922974 X:110001778-110001800 GGAAGCAACTGCTCTGGGGAGGG + Intergenic
1197757334 X:130004994-130005016 GGAATCCATAGGTTTCAGGATGG - Intronic
1200664638 Y:6005507-6005529 GGATGCAACAGGCCTGAAGAGGG + Intergenic