ID: 916204700

View in Genome Browser
Species Human (GRCh38)
Location 1:162304696-162304718
Sequence TCCCTGTGTTTTCGGTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916204700 Original CRISPR TCCCTGTGTTTTCGGTGTCC TGG Intronic
900290614 1:1922106-1922128 TCCCTGGGCTTGCGGGGTCCAGG + Exonic
900667193 1:3823432-3823454 TCCTTGTGTTTTATGTGTCTGGG + Exonic
901204563 1:7486668-7486690 TCCCTGTCTGTCCTGTGTCCGGG + Intronic
901816658 1:11797725-11797747 CCCCTGTGTTTTCAGACTCCAGG - Intronic
902099683 1:13975952-13975974 CCTCTGTGTTTTTGGTGTCTAGG + Intergenic
903384077 1:22915445-22915467 TCCATGTGTTTTCTCTGCCCTGG - Intergenic
905866753 1:41381105-41381127 GCCCTGGGTTTTCGGGCTCCTGG + Intronic
909230014 1:73076062-73076084 TCCTTGTATTTTCAGTGTACTGG - Intergenic
911191625 1:94954496-94954518 TCACTGTGTTGTCTGTGTTCTGG + Intergenic
913518748 1:119626043-119626065 TCCCTTTGTCTTCTGAGTCCTGG + Exonic
914510899 1:148330910-148330932 TCCCTGTGTCTTCAGACTCCAGG - Intergenic
914935725 1:151978124-151978146 CTCCTGAGTTTTCTGTGTCCTGG + Intergenic
916204700 1:162304696-162304718 TCCCTGTGTTTTCGGTGTCCTGG + Intronic
916576859 1:166075019-166075041 TCCCAGTGTTCTCTGTTTCCTGG - Intronic
917313640 1:173702975-173702997 TCCCAGTGCTTTGGGAGTCCAGG - Intergenic
918323293 1:183384938-183384960 TCCCAGTGTTTTGGGAGTCCAGG + Intronic
920077612 1:203348635-203348657 TCCCTGTGTTTGTGGTGTGGTGG + Intronic
922753465 1:228081898-228081920 TCCCTCTGTGTTCCGTGTGCTGG - Intergenic
923292988 1:232564840-232564862 TCCATGTGTTCTCGTTGTTCAGG - Intergenic
1064441724 10:15359852-15359874 TCCCTGTTGTTTTGTTGTCCTGG - Intronic
1066184634 10:32997505-32997527 TCCCAGTATTTTGGGAGTCCAGG + Intronic
1069760831 10:70809843-70809865 TCACTGTGTTTTCTGGGTCTGGG + Intergenic
1070300196 10:75198053-75198075 TCCCTCTGTATTGAGTGTCCAGG + Intergenic
1074174059 10:110978101-110978123 TCCCTGCTTTTTCTGTGACCTGG + Intronic
1074396902 10:113105455-113105477 TCCCTGTGTTATGGCTTTCCTGG - Intronic
1075927593 10:126265631-126265653 GCCCTGTGTTTTCTGTTTACTGG - Intronic
1077700181 11:4434086-4434108 TCCCTGTGTCTTCTGAGTACAGG - Intergenic
1079029639 11:16976959-16976981 TAGCTGTGTGTTCTGTGTCCTGG - Intronic
1080242181 11:30139222-30139244 TCCCAGTGTTTTCAGTTTGCAGG - Intergenic
1084675773 11:70633356-70633378 TCCCTGTGTCTTCTCTGCCCTGG - Intronic
1086065988 11:82745373-82745395 CCCCTGTGTCTTCTGTGACCTGG - Intergenic
1087453514 11:98353835-98353857 TCCCTGTGATATTGGGGTCCAGG - Intergenic
1089222240 11:116883191-116883213 TCCCTGTATTTTAGATGTTCTGG + Intronic
1090796258 11:130138082-130138104 TACCTGAGTTGTCGGTGTCACGG + Intronic
1091356794 11:134943749-134943771 TCCCTGTCTTTGTGGTGTCTGGG + Intergenic
1091780179 12:3208596-3208618 GCCCTGTGTGCTCTGTGTCCTGG - Intronic
1091831815 12:3555474-3555496 TCCCTGTGCTTTCCATGCCCTGG - Intronic
1093493096 12:19726493-19726515 TCCCTGTGCTTTTGGGGCCCAGG - Intergenic
1093711941 12:22337142-22337164 AGTCTGTGTTTTAGGTGTCCTGG - Intronic
1105280684 13:18960948-18960970 TCCCTGGGTTTTCTCAGTCCTGG + Intergenic
1105283252 13:18982235-18982257 CCCCTGTCTTTTCTGGGTCCAGG + Intergenic
1109248000 13:59981037-59981059 TTCCTGTGTTTTCTGTTTTCTGG - Intronic
1109686569 13:65829452-65829474 TCCCTGTGCTCTCGGGGGCCTGG + Intergenic
1116151349 14:41145705-41145727 TCCCTGTGTTCTCAGGGGCCTGG - Intergenic
1116366771 14:44076717-44076739 TCCCAATGTTTTGTGTGTCCTGG - Intergenic
1118433418 14:65746261-65746283 TCACTGTGTATTCGGTGAGCAGG + Intergenic
1120519005 14:85504212-85504234 TCCCAGTACTTTGGGTGTCCGGG + Intergenic
1122389741 14:101372111-101372133 TCACTGTGTCTTCAGTGACCAGG - Intergenic
1202882351 14_KI270722v1_random:72531-72553 TCCCATTGTTTTGGGTTTCCAGG + Intergenic
1125474634 15:40038823-40038845 TCCCTGGGTTCCCGGTGTCTGGG - Intronic
1133480636 16:6167074-6167096 TGCCTGTGTTTTGGGAGTCAAGG + Intronic
1137470259 16:48748269-48748291 TCACTCTGTTTTCTGTGTCTTGG + Intergenic
1141357720 16:83364276-83364298 TAGCTGTGTTTTGGGTTTCCAGG + Intronic
1141612278 16:85188437-85188459 TCCCTGTGTTTTTGAGGTCTAGG - Intergenic
1141641046 16:85341749-85341771 TCCCAGTGTTTTGGGGGGCCAGG - Intergenic
1143039828 17:4025774-4025796 TTCATGTTTTTTCAGTGTCCTGG - Intronic
1145758330 17:27409038-27409060 TGCCTGTGTTTCCTGTTTCCTGG - Intergenic
1149361468 17:55899855-55899877 TCCCTTTGTATTCTATGTCCTGG - Intergenic
1149461069 17:56830877-56830899 TCCCTATGTCTTCGTTGCCCAGG - Intronic
1149610980 17:57957482-57957504 TCCTTGAGTTTTAGGTGTCTGGG - Intergenic
1150443046 17:65207158-65207180 GCCCTGTGTTTTGGGTGTAAAGG - Intronic
1151522778 17:74642349-74642371 TCCCTGTGTTAGAGGTGTCGTGG - Intergenic
1152943325 17:83184218-83184240 TCCCTGTGTGTTGTGTTTCCCGG + Intergenic
1153334662 18:3910674-3910696 TGCCTGCCTTTGCGGTGTCCGGG + Intronic
1153757079 18:8294983-8295005 TCCATGTCTTTTCTGTGGCCTGG - Intronic
1154497872 18:14975554-14975576 TCCCTGTCTTTGTGGTGTCTGGG - Intergenic
1155166766 18:23238027-23238049 TCCCTGCGTTTTGCATGTCCTGG + Intronic
1155671787 18:28380250-28380272 TCCCTGTGCTTTGGGAGACCAGG + Intergenic
1156244566 18:35284913-35284935 TCCCTGTGTTCTTGGAGACCAGG - Intronic
1157295626 18:46440195-46440217 TACCTGTGGTTTCGCTTTCCAGG + Intronic
1157296384 18:46448060-46448082 ACCCTGACTTTTCGGTGCCCTGG + Intronic
1159015265 18:63097264-63097286 TCCCTCTGTTTTCAGTCTCTGGG - Intergenic
1160308898 18:77769801-77769823 TCCCTGTGATGTCAATGTCCTGG + Intergenic
1162033148 19:7925903-7925925 TCCCTTTGTTCTCGGCGGCCTGG + Intronic
1162586035 19:11559104-11559126 TCCGTGCGTTTACGGGGTCCTGG - Intronic
1163014651 19:14446947-14446969 TGTCTGTGTTATTGGTGTCCAGG - Intronic
1164553959 19:29235418-29235440 TTCCTGGGTTTACAGTGTCCTGG + Intergenic
1167538112 19:50068354-50068376 TCCCTCTGTCTTAGGTGCCCAGG + Intergenic
1202657964 1_KI270708v1_random:41627-41649 TCCCATTGTTTTGGGTTTCCAGG + Intergenic
925090997 2:1155997-1156019 TTCCTTTGTCTGCGGTGTCCTGG - Intronic
929140940 2:38666157-38666179 TCCCTATGGCTTCGGTGACCAGG + Exonic
929486249 2:42357561-42357583 TCCCAGTGTTTCCGGAGGCCAGG - Intronic
929556644 2:42929727-42929749 ACCCTGTGTTTTAGGTGTGCTGG - Intergenic
933358804 2:81250560-81250582 TCCATTTGTTTTCCGTGTCAGGG + Intergenic
933975766 2:87508163-87508185 TCCCTGGGACTTCGGTGTACTGG + Intergenic
935225096 2:101046332-101046354 GCCCTGTGTTGTCAGGGTCCTGG - Intronic
935677836 2:105610919-105610941 TTCCTGTGCTTTCCGTCTCCAGG - Intergenic
936318059 2:111442650-111442672 TCCCTGGGACTTCGGTGTACTGG - Intergenic
938063729 2:128270188-128270210 GCCCAGTGTTTTCTGTGGCCTGG + Intronic
938251684 2:129820777-129820799 TCCCTGTGTTGAGGGAGTCCTGG + Intergenic
938728288 2:134125910-134125932 TCTCTGTGTTTTAGGGCTCCTGG + Intronic
943827414 2:192413970-192413992 TCCCTGTGTTCTCTGGGGCCCGG + Intergenic
947950899 2:234146437-234146459 TCAATGTGTTTTCCATGTCCTGG + Intergenic
948467207 2:238158320-238158342 TCCCTGCGTCTTCTGGGTCCCGG + Intergenic
948629711 2:239294262-239294284 TCCCTGAGTGTTCTGTGCCCAGG - Intronic
1170607653 20:17885851-17885873 TCCCTGTCTGCTCTGTGTCCTGG - Intergenic
1170921602 20:20684583-20684605 TCACTGTGTTTTGGGTTCCCTGG - Intronic
1172862151 20:38062949-38062971 TCCCAGTGTTTTGGGAGGCCAGG - Intronic
1173042174 20:39474912-39474934 TCCCTGTGCTTGCCTTGTCCTGG + Intergenic
1176643718 21:9330152-9330174 TCCCATTGTTTTGGGTTTCCAGG + Intergenic
1176643784 21:9330578-9330600 TCCCATTGTTTTGGGTTTCCAGG + Intergenic
1177262433 21:18748557-18748579 TCCCTGTGCTCTTGGGGTCCAGG - Intergenic
1180369197 22:11968963-11968985 TCCCATTGTTTTGGGTTTCCAGG - Intergenic
1180980941 22:19877691-19877713 GCTGTGTGTTTTCGGGGTCCCGG - Intronic
1182780845 22:32866247-32866269 TTACTCTGTTTTCAGTGTCCAGG - Intronic
1184961527 22:47932853-47932875 TCCCTGTGTTTTCTTTTTGCAGG + Intergenic
950430913 3:12950553-12950575 TCCCGGTGCTTTCGGAGGCCAGG + Intronic
957665429 3:83218934-83218956 TCCCTGTGCTCTCAGGGTCCTGG - Intergenic
958737226 3:98023420-98023442 TCCCTGGGTTTTCGGCCACCAGG - Intronic
960572651 3:119200302-119200324 TCCCAGTGTTTTGGGAGGCCAGG - Intronic
966708513 3:182946010-182946032 CCCCTGTGATCTCGGTGTCCTGG - Intronic
968135897 3:196219297-196219319 TCTCAATGTTTTTGGTGTCCGGG - Intronic
1202743102 3_GL000221v1_random:74488-74510 TCCCATTGTTTTGGGTTTCCAGG - Intergenic
968531644 4:1095034-1095056 ACCATGTGTTTTCTGTGTTCTGG - Intronic
969182880 4:5455602-5455624 TCCCTGGGTTTGGGGTTTCCAGG - Intronic
971127842 4:23773894-23773916 TCCCTGTCCTTTAGGGGTCCAGG - Intronic
973361202 4:49166535-49166557 TCCCATTGTTTTCGGTTTCTGGG + Intergenic
974061761 4:57041990-57042012 TCCCAGCGTTCTCAGTGTCCAGG + Intronic
974623375 4:64389589-64389611 GCCCTCTGTTTTTGGTGTCAGGG + Intronic
975040976 4:69743971-69743993 TCCCTGTGCTTTTGGGGGCCAGG - Intronic
975555194 4:75656241-75656263 TCCCAGTGTTTTGGGAGGCCAGG - Intronic
979066923 4:116149327-116149349 TCCCAGTGTTTTGGGAGGCCAGG - Intergenic
981685191 4:147446576-147446598 TCTTTGTGTTTTAGGTGTTCTGG - Intergenic
983062130 4:163172549-163172571 TCCCAGTGTCTTCGGGGTGCTGG + Intergenic
985875452 5:2590969-2590991 TCTCTGTGGTTCCCGTGTCCTGG + Intergenic
986847206 5:11769203-11769225 TCACTGTGGTTTCTGTGTCTGGG - Intronic
988207944 5:28164357-28164379 TCCTTGTGTTGTCTTTGTCCCGG - Intergenic
991686395 5:69186113-69186135 TCCCAGTGTTTTGGGAGGCCAGG + Intergenic
991943927 5:71881752-71881774 TCCCTGTGATTTCCCTGTACTGG - Intergenic
995735473 5:115296221-115296243 TCCATGTGGTTTCGGAGTCGAGG - Intronic
996084602 5:119291741-119291763 TCCTTGTATTTTCGTTGCCCGGG + Intronic
1002676669 5:180920548-180920570 TGCCTGTGCTTTTGGTGTCAGGG - Intronic
1005775715 6:29129475-29129497 TCCCTGTGCTCTTGGGGTCCGGG + Intergenic
1007355719 6:41314483-41314505 TCTTTTTGTTCTCGGTGTCCTGG - Intergenic
1007707523 6:43799799-43799821 TCACTGTGTTTCAGGTGACCGGG - Intergenic
1010534266 6:77007639-77007661 TGCCTCTGTTTTTGGTGTCATGG - Intergenic
1014747852 6:125220938-125220960 TCCCTCTGCATTCTGTGTCCTGG + Intronic
1014862213 6:126483843-126483865 TCCCTCTGTTTTCTGTTTTCTGG + Intergenic
1014971669 6:127824068-127824090 TCCCTGTGTTTTTAGCCTCCTGG - Intronic
1017522468 6:155214062-155214084 TCCCTGTGTTCTTGGGGGCCAGG - Intronic
1019713138 7:2526432-2526454 TTCCTGTGCTCTCGGAGTCCTGG - Intronic
1020564803 7:9781649-9781671 TCTCTGTGTTTTCTCTGTCTTGG - Intergenic
1022047783 7:26636597-26636619 ACCTTGTGTTTTCCATGTCCTGG - Intergenic
1022069405 7:26897614-26897636 TTCCTGTATTTCCAGTGTCCAGG + Intronic
1022530224 7:31062364-31062386 TCACCGTGTTTTCCGTGTCATGG + Intronic
1022779555 7:33565538-33565560 TCCCTGTCTTTTTGTTTTCCAGG + Intronic
1023017751 7:35983871-35983893 TCCCTGTGCTTTCTTTGGCCTGG + Intergenic
1029235988 7:99119457-99119479 TCCCAGTGTTTTCTTTCTCCTGG - Intronic
1029493168 7:100883308-100883330 TCCCTTTGTTTTCGGTTTCTGGG + Intronic
1030075789 7:105735319-105735341 TCCCCGTGATTTCAGGGTCCAGG + Intronic
1030243708 7:107359146-107359168 TCCCTGTGTTCTTGGTGACCTGG + Intronic
1031248556 7:119350290-119350312 TCCCTGTGTTCTTGGGGTACTGG + Intergenic
1031942118 7:127800048-127800070 TCCCTGTGTGTTCTGTCTCCTGG + Intronic
1034558608 7:151865425-151865447 TCCCTATGTTTTTGGTGTTTTGG + Intronic
1036500826 8:9312311-9312333 TCCCTGTGTAAGTGGTGTCCTGG + Intergenic
1037992638 8:23331598-23331620 TCTCTGTGATTTCTGTGTTCAGG - Intronic
1043195412 8:77286980-77287002 TCCCTGTGCTTTTGGGGGCCAGG + Intergenic
1043735131 8:83731432-83731454 TCCCTGTGTTCTTGGGGGCCTGG - Intergenic
1044168316 8:89017246-89017268 TCCCTGTGTTTTTGGTCACTTGG - Intergenic
1044712595 8:95072179-95072201 GCCCTGTGTCTTAGGTGGCCAGG - Intronic
1049371863 8:142271720-142271742 TCACTGGGTTTTGGGTGTGCAGG - Intronic
1049751738 8:144287911-144287933 TCCCAGTAGTTTCGGTGTTCTGG - Intronic
1052836792 9:33256142-33256164 TCCCTGTGTTCTCAATGTCTGGG + Intronic
1056820115 9:89835320-89835342 TCCCTGTGTGTGTGGTGCCCAGG + Intergenic
1057921337 9:99100541-99100563 TCCCTGTGTTCTCATTGTTCAGG - Intergenic
1061738085 9:132676725-132676747 TCCAAGTGCTTTCTGTGTCCTGG + Intronic
1061912932 9:133734562-133734584 TCCCTGTCTTTTCTGTGGGCTGG - Intronic
1203690223 Un_GL000214v1:35522-35544 TCCCATTGTTTTGGGTTTCCAGG + Intergenic
1203711735 Un_KI270742v1:104414-104436 TCCCATTGTTTTGGGTTTCCAGG - Intergenic
1203711801 Un_KI270742v1:104840-104862 TCCCATTGTTTTGGGTTTCCAGG - Intergenic
1203555374 Un_KI270743v1:202933-202955 TCCCATTGTTTTCGGTTTCTGGG - Intergenic
1203646052 Un_KI270751v1:68531-68553 TCCCATTGTTTTGGGTTTCCAGG - Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191904399 X:66073712-66073734 TCCCAATGTTTTGTGTGTCCTGG - Intergenic
1195765011 X:108286821-108286843 TCCCAGTGTTTTGGGAGACCTGG - Intronic
1196839550 X:119846645-119846667 TGCCTGTGCTTTTGGTGTCCTGG - Intronic
1197526795 X:127574829-127574851 TCCCTGTGCTCTCGGGGGCCTGG + Intergenic
1198114644 X:133533457-133533479 ACCCTGTGTTTCTGCTGTCCTGG - Intergenic
1198225786 X:134644643-134644665 TCCATGTGTTTTCATTGTTCAGG + Intronic
1199690207 X:150303942-150303964 TCCCTGTGCCTTCCTTGTCCCGG + Intergenic
1200175758 X:154115206-154115228 TGCCTTTGTTATCGGTGTCAAGG + Intergenic
1200972096 Y:9163718-9163740 TCCCTGTGCTTTCTGGGGCCTGG + Intergenic
1201704592 Y:16922205-16922227 TCTCTGTGTTCTCATTGTCCAGG + Intergenic