ID: 916206346

View in Genome Browser
Species Human (GRCh38)
Location 1:162319492-162319514
Sequence CAGAAGGACTGGTGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 343}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916206346_916206352 3 Left 916206346 1:162319492-162319514 CCCATCTCCCACCAGTCCTTCTG 0: 1
1: 0
2: 1
3: 21
4: 343
Right 916206352 1:162319518-162319540 GCCCTGCAATCCCTGTACCCAGG 0: 1
1: 0
2: 1
3: 21
4: 354

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916206346 Original CRISPR CAGAAGGACTGGTGGGAGAT GGG (reversed) Intronic
901773999 1:11546671-11546693 CAGAGGGGCTGGTGGGCCATGGG + Intergenic
902288147 1:15419737-15419759 GAGAAGGGCTGGTGGGTGAGAGG + Intronic
903361232 1:22778684-22778706 CAGAAGGACTGGAAGTAAATGGG - Intronic
904036686 1:27562646-27562668 CAGAGGGACAAGTGGGAGCTGGG - Intronic
904486074 1:30825156-30825178 CAGGAGGACTGCTGGGAGAAAGG + Intergenic
904808949 1:33150999-33151021 CAGAAGGACTGGTGCGGGGCGGG + Intronic
905341299 1:37279702-37279724 AAGAGGCACTGGTGGGAGACTGG - Intergenic
906862475 1:49376378-49376400 GAAAAGCACTGGTGGGAGATTGG + Intronic
907131671 1:52102880-52102902 CAGGACTAATGGTGGGAGATGGG - Intergenic
907189364 1:52635395-52635417 CTCAAGGAATGGTGGCAGATGGG + Intronic
909592230 1:77363548-77363570 CAGAAGGCCTCCTGGGACATGGG - Intronic
911126111 1:94342521-94342543 CAGAAAGCCTGGCAGGAGATTGG + Intergenic
912763626 1:112389689-112389711 CAGAATTACTGGAGGGAGACAGG + Intergenic
912985248 1:114421513-114421535 CAGATGGGCTGGTGGGACCTCGG + Exonic
913963299 1:143355120-143355142 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
914057655 1:144180706-144180728 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
914121491 1:144785660-144785682 CAGAGGGGCAGGTGGGAGAGTGG + Intergenic
914245779 1:145885121-145885143 CAGCAGTGCTGGTGAGAGATGGG + Intronic
914859176 1:151372410-151372432 CAGAGGCACTGCTGGGAGATGGG - Intronic
915431814 1:155872583-155872605 CAGAAGGACAAGGGGGAGAAAGG - Intronic
915461827 1:156075137-156075159 AAGCAGGACTGGGGGGAGGTGGG - Exonic
915708987 1:157875319-157875341 AAAGAGGCCTGGTGGGAGATGGG + Intronic
916088527 1:161289052-161289074 CTGAAGGCCTGGTGGGGGTTGGG + Intergenic
916206346 1:162319492-162319514 CAGAAGGACTGGTGGGAGATGGG - Intronic
916247167 1:162700146-162700168 AAGAAGAAATGGTGAGAGATAGG - Intronic
916515942 1:165516771-165516793 AAGAAAGACAGGTGGGAGACAGG + Intergenic
917016982 1:170543236-170543258 CAGCAAGAGTGGTGGGGGATGGG - Intronic
917027397 1:170659292-170659314 CAGAAGGAATGGTTGGAAAGTGG + Intergenic
917469979 1:175318180-175318202 CAGAAGCTCTGGTGGGAGGCTGG + Exonic
917772453 1:178294533-178294555 CAGAATGACTGGTGCAAGATGGG + Intronic
919619016 1:199843817-199843839 CAGAAGGATTGGTGGAAGGAAGG - Intergenic
920396279 1:205648499-205648521 CAGAAGGACTGTTTAGAGCTGGG - Intergenic
920849268 1:209617709-209617731 CAGAAGGAGGGGTGAGAGGTGGG - Intronic
922696185 1:227732157-227732179 CAGCAGGCCTGCTGGGAGCTCGG - Exonic
922696237 1:227732354-227732376 TAGAAGGACGGGTGGAAGAGAGG - Exonic
922936507 1:229426898-229426920 TAGAAGGACTGCAGGGAAATGGG - Intergenic
922938595 1:229440504-229440526 CAGCAGCACGGGAGGGAGATGGG + Intergenic
923076469 1:230613368-230613390 CAGAAGGACTGGTGTGTGCAAGG - Intergenic
923183258 1:231543955-231543977 CAGAAGTACTGGTGGGAAGAAGG + Intronic
924395236 1:243611807-243611829 CAGAATCACTGGTGGATGATAGG - Intronic
1062896381 10:1106335-1106357 GAGCAGCACTGGTGGGAGGTAGG - Intronic
1064368266 10:14727724-14727746 TAGAAGCCCTGGTGGGAGAGTGG - Intronic
1067838498 10:49656746-49656768 AAGAAGGACTGGTTGGAATTGGG + Intronic
1069667642 10:70174163-70174185 CAGAAGGAGTGGTAGGAAATGGG + Intergenic
1070724469 10:78778784-78778806 CAGGAGGACAGATGGGAGCTGGG + Intergenic
1071880393 10:89890663-89890685 GGGAGGCACTGGTGGGAGATGGG + Intergenic
1072530764 10:96316609-96316631 CAGAAGGACAGGGAGGAGAATGG - Intronic
1073326871 10:102648236-102648258 TTGAAGGACTGGTGGGAGCTGGG + Intronic
1074357699 10:112800456-112800478 CAGAAGTAATGTGGGGAGATGGG + Intronic
1074497550 10:113993016-113993038 CAGAAGGACTGTCGGGTGATTGG - Intergenic
1074769921 10:116726575-116726597 CAGAAGGAACTGTGGGAAATTGG - Intronic
1074899565 10:117804449-117804471 CAGAAGGAGTGCTGGCAGCTTGG + Intergenic
1075641174 10:124065591-124065613 CAGCAGGACTGGCGGGGGAGGGG - Intronic
1076818274 10:132925300-132925322 CAGCAGGGCTTGTGGGAGGTGGG - Intronic
1077334871 11:1998757-1998779 CAGAGGGCCTGCTGGGTGATTGG - Intergenic
1077882994 11:6365844-6365866 CAGATGAACTGGTAGGAGACTGG + Intergenic
1078492465 11:11782125-11782147 AAGAGGGATTGATGGGAGATGGG - Intergenic
1079389633 11:20010264-20010286 AAGAAGGACTGGGGGGAAAATGG + Intronic
1079410589 11:20183849-20183871 AAGAATGACTGGTGGAAGAATGG + Intergenic
1083725075 11:64623663-64623685 CAGAAGGCCTGGTTGTAGGTGGG - Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1083789034 11:64972071-64972093 CAGAAGGCCTGGTGGGTGCGCGG - Intronic
1083904162 11:65659424-65659446 CAGAGAGTCTGATGGGAGATGGG - Intronic
1083958693 11:66002087-66002109 CAGTTGGACTGGTGGGAACTGGG - Exonic
1085401172 11:76236355-76236377 CAGAAGGATTAGTGGGAGCGAGG + Intergenic
1085781305 11:79411612-79411634 AAGAAAGACTGGAGGGAGAAGGG - Intronic
1087398666 11:97635534-97635556 CAGAAGGAATGGTGGAAGGAAGG + Intergenic
1087810624 11:102606049-102606071 CAGATGGACAGATAGGAGATTGG - Intronic
1088363575 11:109016452-109016474 TAGAGGGAGAGGTGGGAGATAGG + Intergenic
1089405515 11:118194215-118194237 CAGGAGGACAGCTGGGAGAGCGG + Exonic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091086187 11:132724165-132724187 AAGAAGGGGTGGTGGGAGGTGGG - Intronic
1202817854 11_KI270721v1_random:53939-53961 CAGAGGGCCTGCTGGGTGATTGG - Intergenic
1092172545 12:6383189-6383211 CTCAAGGACAGGTGGGAGTTAGG + Intronic
1092702908 12:11252909-11252931 CAGAAAGTCAGGAGGGAGATTGG - Intergenic
1096079532 12:48824363-48824385 CAGAAGGCCAGGTGAGAGTTGGG + Exonic
1097161389 12:57048775-57048797 AAGAAGCACTGGGGGTAGATGGG - Intronic
1097911530 12:64975188-64975210 CAGAAGTAATGTTGGGACATTGG + Intergenic
1098912694 12:76225811-76225833 AATAAGGAGAGGTGGGAGATAGG + Intergenic
1102575766 12:113855243-113855265 CAAACGGACTGGTGGATGATGGG + Intronic
1103244657 12:119446336-119446358 CACAAGGATTGGGTGGAGATGGG + Intronic
1104845293 12:131843923-131843945 CAGAAGGGCTGGTGGGATGTGGG + Intronic
1104887636 12:132119998-132120020 CATAGGGCCTGGTGGGGGATGGG - Intronic
1104939492 12:132388224-132388246 CAGAGAGACGGGAGGGAGATGGG + Intergenic
1105860701 13:24409463-24409485 GAGGAGGAAGGGTGGGAGATAGG + Intergenic
1107239021 13:38210171-38210193 TAGAAGGACAGGTGGAAGGTAGG - Intergenic
1108622829 13:52200795-52200817 CAGGAGGACTTATGGGAGATGGG + Intergenic
1108663895 13:52610248-52610270 CAGGAGGACTTACGGGAGATGGG - Intergenic
1112025989 13:95411672-95411694 CAGAAGGGCGGGTGGGAGCCAGG - Intergenic
1113439759 13:110319095-110319117 CAGCAGGACTGGTGGGTGCGGGG + Intronic
1115445080 14:33480586-33480608 CACAGGGACAGGTGGGAGAAAGG - Intronic
1116987209 14:51233361-51233383 CAGAAGGAAAGGAGGGAGAAAGG + Intergenic
1118695323 14:68379389-68379411 CAGAGGGACTGCTGGGAGAAGGG + Intronic
1118889729 14:69898891-69898913 CAAAAGGACTTGTGGTAAATAGG + Intronic
1119787405 14:77323814-77323836 CCGGAGGACTGCTGGGAGGTGGG + Intronic
1119790024 14:77341752-77341774 CTGAAGGACTGCTGGGACAGGGG - Exonic
1119998702 14:79279562-79279584 AAGAAGGACTGGAGGGAAAGAGG - Intronic
1121042750 14:90762290-90762312 CAGAGGCACTGGTAGGAAATTGG - Intronic
1121395136 14:93614931-93614953 CAGAAGAACTGCTGGGTGGTAGG + Intronic
1121779149 14:96610727-96610749 CAGGAGGACTGGTGGAAAGTTGG - Intergenic
1123091968 14:105745938-105745960 CAGCATGGCTGGTGGGAGGTGGG - Intergenic
1125056538 15:35364864-35364886 CAGAAAGACTAGAGGGAGAATGG - Intronic
1125548762 15:40528622-40528644 CAGAAGGCCTGAGGAGAGATTGG + Intergenic
1126968101 15:54078516-54078538 CATTATGACTGGTGTGAGATGGG + Intronic
1127444094 15:59042534-59042556 TACAAGGACTGGGGGGAAATGGG - Intronic
1127672238 15:61206242-61206264 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
1127932084 15:63603662-63603684 CAGAAGGGCTGGTGTGGGACAGG - Intergenic
1131816843 15:96230697-96230719 CAGAAGAATTGGTGGAAGTTTGG + Intergenic
1132367297 15:101266841-101266863 CAGAAAGACTGGTGGGTGGGAGG + Intergenic
1133148374 16:3807807-3807829 CAGAGGGGCTGGTGGGAAAGTGG - Intronic
1133202594 16:4213248-4213270 GAGAAAGACTGCAGGGAGATTGG + Intronic
1134099148 16:11439407-11439429 CAGCTGGCCTGCTGGGAGATGGG - Intronic
1134388394 16:13795425-13795447 CATAAGGAATGATGGGAAATTGG + Intergenic
1134690322 16:16187022-16187044 CATCAGTACTGGGGGGAGATGGG - Intronic
1134834281 16:17348029-17348051 TAGAGGAACTGGTAGGAGATAGG - Intronic
1135504885 16:23027694-23027716 CAGAAGTCCAGGAGGGAGATGGG - Intergenic
1135956366 16:26959725-26959747 GAGAAGGAGAGGAGGGAGATAGG - Intergenic
1136270173 16:29143896-29143918 CGGAAGCCCTGGTGGGAGCTCGG + Intergenic
1137627595 16:49919473-49919495 CAGAGGAGCTGGTGGGAGTTGGG + Intergenic
1138305966 16:55974679-55974701 CAGAAGGACTGCTTGAAGCTGGG - Intergenic
1138453047 16:57105237-57105259 CAGCAGCACTGGTGGCATATAGG + Intronic
1138588717 16:57987667-57987689 CTGGAGGACTGGTGGGGGGTTGG + Intronic
1139747566 16:69087036-69087058 CAGAAGGGGCGGTGGGAGGTGGG - Intergenic
1139958414 16:70704299-70704321 CAGAAGGGGCGGTGGGAGAAAGG + Intronic
1140427923 16:74876059-74876081 GGGAAGGAGAGGTGGGAGATTGG - Intronic
1140587855 16:76315365-76315387 CAAAGGGACTGGTGGAACATAGG + Intronic
1141289325 16:82703297-82703319 CAGAAGGAATGGTGGGGGGACGG - Intronic
1141544548 16:84756099-84756121 CTGAAGGGGTGTTGGGAGATGGG - Intronic
1141561091 16:84868142-84868164 CAGAAAGACTGGTGGGGGCAGGG - Intronic
1141680115 16:85538860-85538882 GAGAGGGACTGGTGGGAGATGGG - Intergenic
1142073765 16:88105730-88105752 CAGAAGCCCTGGTGGGAGCTCGG + Intronic
1143272037 17:5683049-5683071 CAGAGGGACAGGAGGGAGAGGGG - Intergenic
1143711486 17:8738978-8739000 CAAAAGAACTGGGGGCAGATGGG + Intronic
1144326433 17:14186425-14186447 CCGATGGATGGGTGGGAGATGGG - Intronic
1144475311 17:15583300-15583322 CCGATGGATGGGTGGGAGATGGG - Intronic
1145352606 17:22098843-22098865 CAGAAGGGCTGGAGGGAATTAGG + Intergenic
1146594571 17:34157387-34157409 GAGAAGGGCTGGTGGGGGCTGGG + Intronic
1146975704 17:37109767-37109789 CAGAAGGACTGGATGGTGAGGGG - Intronic
1147042102 17:37727140-37727162 GAGAAGGACTGGTTGGAGCCTGG - Intronic
1147636541 17:41967551-41967573 CAGAAGGGCTGGTGGGGGGCAGG - Intronic
1148390240 17:47266957-47266979 CAGAAGGAGTCGTGGGAGCGTGG - Intronic
1148664987 17:49367792-49367814 AAGTAGGGCTGGTGGGAGGTGGG - Intergenic
1148741020 17:49892657-49892679 CAGAAGGCTTGGTGGGATGTGGG + Intergenic
1151293140 17:73164885-73164907 CAGAAGGACAGGGGTGAGACCGG - Intergenic
1151556224 17:74848032-74848054 CAGAAGCACTGGGTGGAGACAGG + Intronic
1153170328 18:2308922-2308944 CAGAAGGACAGCTCTGAGATGGG - Intergenic
1153956572 18:10101512-10101534 CAGAAGGAATGAAGGGAGAGGGG - Intergenic
1154473407 18:14726261-14726283 CAAAAGGATTGGTGGGGGACAGG + Intergenic
1155042604 18:22077498-22077520 CAGAAGGGCTGGTGGCCTATTGG - Intergenic
1156260934 18:35444540-35444562 CAGAAGGAGAGGTGGGCCATCGG + Intronic
1156316935 18:35978261-35978283 CAGACAGACTGGTGCCAGATAGG - Intronic
1156341607 18:36214721-36214743 CAGAAGGAGAGGGAGGAGATAGG + Intronic
1158217696 18:55117001-55117023 CAGATGGACTGGTGTGTGGTGGG - Intergenic
1158314126 18:56191740-56191762 AAGAAAGTCTGGTGGGAGCTGGG - Intergenic
1158825049 18:61209124-61209146 CAGAAGGTCTGGTGGGAAGATGG - Intergenic
1159034885 18:63267271-63267293 CAGGAGGACAGGTTGGAGAGAGG + Intronic
1159066048 18:63568694-63568716 CTGAACGACTGGTGGCAGCTGGG - Intergenic
1159540201 18:69765005-69765027 CAGAAGGACAGGATGGAAATAGG + Intronic
1160060785 18:75527101-75527123 CAGAAAGACAGGAGGGAGAGAGG - Intergenic
1160138667 18:76298107-76298129 CAGCAGGACTGGTTGCAGTTGGG + Intergenic
1160482286 18:79252833-79252855 CAGAGAGACTGCTGGTAGATCGG + Intronic
1161258324 19:3321957-3321979 CAGAGGGACAGATGGGAGAGAGG + Intergenic
1161362030 19:3855835-3855857 CGGAAGGAATGAGGGGAGATGGG + Intronic
1161390336 19:4017262-4017284 GAGAAGGACTAGCGGGACATGGG - Intronic
1161431201 19:4233369-4233391 CTGGAGGACAGGTGGGAGGTGGG - Intronic
1161510517 19:4668360-4668382 CAGAAGGAGGGAGGGGAGATGGG - Intronic
1161794403 19:6378176-6378198 AAGAAGGCCTGGTGGGAGAAGGG + Intronic
1162728992 19:12706360-12706382 CAAAAGCACTGGTGGGAGGGAGG + Exonic
1163816119 19:19465566-19465588 GCGAAGGGCTGGTGGGCGATGGG + Exonic
1164320148 19:24137288-24137310 CAGAGGGACTGGTGGTGGGTGGG + Intergenic
1164635203 19:29786491-29786513 AAGAAGGAGCAGTGGGAGATGGG + Intergenic
1165408530 19:35644491-35644513 CAGGAGTACAGGCGGGAGATTGG - Intronic
1165430028 19:35767228-35767250 CAGAAGAACCCGTGGGAGCTGGG - Intronic
1166546496 19:43637230-43637252 CAGCAGGAATCGGGGGAGATGGG - Intronic
1167439884 19:49501842-49501864 CAGCAGGTCTGGTGGGTGCTGGG - Intergenic
1168259611 19:55186068-55186090 CAGATGGGCTGGGGGGAGAGTGG + Intronic
1202697138 1_KI270712v1_random:133379-133401 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
925527689 2:4821813-4821835 CAGAAGGTCTGATGGGAGAAGGG - Intergenic
925636558 2:5946728-5946750 CAGCAGCACGGGTGGGGGATGGG + Intergenic
926104558 2:10142159-10142181 CAGAGTGAGGGGTGGGAGATGGG + Intronic
926164469 2:10511429-10511451 GCCTAGGACTGGTGGGAGATGGG - Intergenic
926329232 2:11811067-11811089 CAGAAGGACAGGTGGGACCCAGG - Intronic
927445926 2:23161555-23161577 TCAAAGGAGTGGTGGGAGATGGG - Intergenic
928266373 2:29815497-29815519 GAGAGGGACTGGTGGAAGAAGGG - Intronic
928424876 2:31169536-31169558 CAGAGTGAGTGGTGGGAGGTGGG - Intergenic
930967396 2:57346444-57346466 TAAAAGGAATGGTGTGAGATCGG - Intergenic
931980933 2:67693618-67693640 TAGAAGGACTGCTGGGGGAAGGG + Intergenic
932423584 2:71615287-71615309 CAGCAGCACTGGTGGGAGCTGGG + Intronic
932829950 2:74979698-74979720 CAGAAGAACTAGGAGGAGATTGG + Intergenic
933804513 2:85988493-85988515 CTGGAGCACAGGTGGGAGATGGG - Intergenic
934278304 2:91590395-91590417 CAGAGGGGCAGGTGGGAGAGTGG - Intergenic
935473892 2:103494310-103494332 CAGAACTACTGGTGGGAGCTGGG + Intergenic
935947639 2:108300733-108300755 CAGAAAGACAGGTGGGTGATGGG + Intronic
937019070 2:118633804-118633826 GGGAGGGACTGGAGGGAGATTGG - Intergenic
937934586 2:127232568-127232590 CAGGAGTCCTGGTGGGAGGTGGG + Intergenic
942383673 2:175419662-175419684 CAGCAGGTCAGGTGGGACATGGG - Intergenic
943441363 2:187931898-187931920 CAGCAGGACTGATGGGTCATGGG - Intergenic
946568809 2:220998352-220998374 CAGTGGGCCAGGTGGGAGATGGG + Intergenic
947670026 2:231930040-231930062 CAGGATGCCTGGTGGGAGAAAGG + Intergenic
947824773 2:233098266-233098288 CAACAGGAGTGCTGGGAGATGGG + Intronic
948645058 2:239399584-239399606 CAGCAGGACTGGGGGGATACTGG - Intronic
1173042370 20:39476452-39476474 AAGAAGTACAGGTGGGAGGTAGG - Intergenic
1173441986 20:43085916-43085938 CAGAAGGGCTTGTAGGAGTTTGG + Intronic
1174041220 20:47700967-47700989 AAGAAGGATTGCTGGGACATAGG - Intronic
1174425025 20:50426071-50426093 AAGAAGGGGAGGTGGGAGATGGG + Intergenic
1174550548 20:51358333-51358355 CAGGTGGACTGGTGGGTGAGTGG + Intergenic
1175297248 20:57917228-57917250 CAGAAAGACTGCTTGGAGAAGGG - Intergenic
1175781282 20:61683903-61683925 CAGAGGGATGGGTGGGAGTTGGG + Intronic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1176062958 20:63180158-63180180 CAAAGGGACTGGTGGGAGTGGGG + Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176801078 21:13431605-13431627 CAAAAGGATTGGTGGGGGACAGG - Intergenic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1180515692 22:16140940-16140962 CAGAAGGACTGGGAGGGGGTGGG + Intergenic
1180656863 22:17429097-17429119 AAGAAGGATTGGTGGGATAGGGG + Intronic
1181086569 22:20442251-20442273 GAGAAGGACTGCTGGGAGGAAGG - Exonic
1182111005 22:27723647-27723669 GAGAAGGACAGGTGTGAGACAGG + Intergenic
1183043750 22:35203295-35203317 CAGAAGGACTGCTGGGCAGTTGG - Intergenic
1183342030 22:37286799-37286821 CAGCAGGACTGGTGAGATTTGGG + Intronic
1183354548 22:37351170-37351192 GAGAAGGACTGGGAGGAGAGAGG - Intergenic
1183390081 22:37540747-37540769 CAAGAAGCCTGGTGGGAGATGGG - Intergenic
1183465228 22:37976905-37976927 CAGAATGGCTGGTGGGATTTGGG + Intronic
953045937 3:39294278-39294300 CAGGAGGCCAGGTGGGTGATGGG + Intergenic
953117183 3:40004626-40004648 CAGAAGGAAAGGTGGGAGTTGGG - Intronic
953363456 3:42321743-42321765 CAGAAGGAATGTTGGCAGAAGGG - Intergenic
953367055 3:42354016-42354038 CCCAAGGGCTGCTGGGAGATGGG - Intergenic
954146909 3:48639013-48639035 GAGAGGGACTGGTGGGAGTGGGG - Intronic
954404864 3:50340021-50340043 CAGAAGGACTGCTGGGTGTGTGG + Intronic
954880592 3:53833454-53833476 CAGACTGACTGGTGTGAGGTAGG + Intronic
955540186 3:59967626-59967648 CAGAAGGGTTGGTGGAAGCTTGG + Intronic
956299549 3:67755482-67755504 CAGAAGGACTATTAGGAGACAGG - Intergenic
956756532 3:72393406-72393428 CAGAAGGAAGGGAGGGAGAGAGG + Intronic
957383440 3:79464879-79464901 CAGAAGAGCTGCTGGAAGATTGG - Intronic
957611422 3:82472164-82472186 GAGAAGGACAGGAGGGAGACAGG + Intergenic
958807992 3:98834930-98834952 CAGAAGGGCTGGTGGCCTATTGG - Intronic
960052771 3:113253704-113253726 CATAAGTACTGGTGGGGGCTGGG - Intronic
960342929 3:116497298-116497320 CAGAGGGAGTGGTGGCAGAGAGG - Intronic
960750636 3:120948550-120948572 CAGGAGGAAGGGTGGGAGTTGGG - Intronic
961406030 3:126680078-126680100 GAGAGGCACTGGAGGGAGATGGG + Intergenic
961597523 3:128030363-128030385 CAGTAGGACTGGTAGGTCATAGG + Intergenic
962134368 3:132718701-132718723 CAGATGTGCTGGTGGGAGCTGGG + Intronic
963765841 3:149335168-149335190 CAACAGGATTGGTGGCAGATTGG + Intergenic
963827175 3:149969261-149969283 CAGAAAAAATGGAGGGAGATTGG + Intronic
964090310 3:152868540-152868562 CAGAAGGGCTGGAGGGATGTGGG - Intergenic
964811136 3:160666012-160666034 CAAATGGGCTGGTGGGAGAGAGG - Intergenic
965683818 3:171280152-171280174 CAGATTGACTGGTGTGATATGGG - Intronic
965791474 3:172392897-172392919 CAGAAGAACTGCTTGGACATGGG - Intronic
965951130 3:174309424-174309446 CAGATGCACTGGTGGGATAAGGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
966677238 3:182602686-182602708 CAGTTGGAGTGGTTGGAGATGGG - Intergenic
968435120 4:581106-581128 CAGAAGCTCTGGTGGGAGGGAGG - Intergenic
968684834 4:1950962-1950984 GAGAAAGACTGGTGGGTGGTGGG + Intronic
968867726 4:3224577-3224599 CGGAAGGCTTGGTGGGAGAGTGG - Intronic
969097421 4:4744121-4744143 GAGGAGCACTGGTGGGAGAATGG + Intergenic
970460761 4:16272559-16272581 CAGAAGGAGTCCTGGGAGAGAGG - Intergenic
971040732 4:22749226-22749248 CAGAAGGAGTGGTGGCTGTTGGG + Intergenic
974264067 4:59560935-59560957 CAGTGGGACTGGTTGGAGAGTGG - Intergenic
976627884 4:87206590-87206612 CTGTAGAAATGGTGGGAGATGGG + Intronic
977956322 4:103031119-103031141 CAGAAGGAGTAGCGGGAGATGGG + Intronic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
980063495 4:128156255-128156277 CAGCTGGACTGGTGGGGGAAGGG - Intronic
981538501 4:145824645-145824667 CAGAGGCACTGGTGAGAGGTAGG - Intronic
983676765 4:170303589-170303611 CAGAAGTACTGATGGGAGGAAGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985174600 4:187187864-187187886 CAGAAGCAGAGGTGAGAGATGGG + Intergenic
985196214 4:187432486-187432508 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
985196228 4:187432555-187432577 CAGAAGAAGAGGTGGGAGGTGGG - Intergenic
986871306 5:12049860-12049882 GAGAAGGACTGGTGGGGGGTTGG + Intergenic
987242771 5:16017626-16017648 CAGAGGGTCTGGTGGGGGCTGGG + Intergenic
987948296 5:24643960-24643982 CAGAAGTATTGGGGGGAGAGAGG - Intronic
988306953 5:29505129-29505151 CAGACGTACTGGTGGTACATAGG + Intergenic
988463346 5:31462760-31462782 CTGATTGACTAGTGGGAGATGGG - Intronic
990670067 5:58118334-58118356 CAACAGGACTGGTGGGATACGGG - Intergenic
992678245 5:79127199-79127221 CTGAAGGCCTGTTGGGAGCTGGG + Intronic
992699510 5:79327980-79328002 ATGAAAGACTGGTGAGAGATTGG + Intergenic
992749102 5:79845961-79845983 CAGAAAGAAGGGTGGGCGATGGG - Intergenic
993033219 5:82728338-82728360 AACAAGGACTGGTGAGAGACTGG - Intergenic
994111143 5:96006194-96006216 ATGAAGGACTAGTTGGAGATGGG + Intergenic
995947696 5:117669662-117669684 AAGAAGGACTGAAGGGAGAATGG - Intergenic
997063649 5:130537610-130537632 TAGAAGAACTGGTAGGAGAAGGG + Intergenic
997380898 5:133437097-133437119 TAGAAGCACTGGTTGGAGAATGG + Intronic
997610075 5:135209710-135209732 CAGGGTCACTGGTGGGAGATAGG - Intronic
997673428 5:135695000-135695022 CAGGAGGAGAGGTGGGTGATGGG - Intergenic
998658917 5:144214179-144214201 CAACAGGACTTGTTGGAGATTGG - Intronic
999104770 5:149061733-149061755 CAGGACCACTGGTCGGAGATCGG - Intronic
999892382 5:155993151-155993173 CAGAAGGACTGAAGGGAAAATGG - Intronic
1000003984 5:157166243-157166265 CAGAAGTCCTGTAGGGAGATGGG - Exonic
1001125384 5:169014401-169014423 CTGAAGTACTGGTGGGGGAGAGG + Intronic
1002473473 5:179451229-179451251 CAGAAGCAGTGATGGGAGAGTGG + Intergenic
1003475340 6:6476848-6476870 CAGAAGGACTGAGGGGATAAGGG + Intergenic
1003806705 6:9733447-9733469 CTGAAGGACTGGTAGGATTTGGG + Intronic
1004442094 6:15663158-15663180 GAGAAGGCCTGGTGCGGGATAGG - Intergenic
1005024707 6:21451435-21451457 GAGAAGGACTGGTGGTAAAGAGG - Intergenic
1005610887 6:27524067-27524089 CAGAAGTGGTGGTGGTAGATAGG + Intergenic
1006091930 6:31633421-31633443 CAGCAGAACTGCTGGGAGGTGGG - Exonic
1006599935 6:35218654-35218676 CAGAAGGACTGCTGGGCCTTGGG + Intronic
1007394607 6:41570399-41570421 GAGAAGGACAGGTGGGAGGTGGG + Intronic
1007713243 6:43838202-43838224 CTGTAGGACAGGTGGGGGATGGG + Intergenic
1007755231 6:44095157-44095179 GAGTAGAACTGGCGGGAGATGGG + Intergenic
1008326304 6:50185977-50185999 CAGAGGGAGTGGTGGAAGAGAGG + Intergenic
1011164474 6:84430756-84430778 CAGAAGCTGGGGTGGGAGATGGG + Intergenic
1012213279 6:96550791-96550813 CAGAAGGATTGGTGTGGGATTGG + Intronic
1012601075 6:101097661-101097683 CAGAAGGACTGGAGTGATAGTGG + Intergenic
1016276785 6:142362431-142362453 CAGAAGTTCTGGTAGGGGATTGG + Intronic
1016813789 6:148285226-148285248 CAGAAAGACTGGTTTGAGGTAGG + Intronic
1017574551 6:155787584-155787606 CAGATGGACAGGAGGGAGACAGG + Intergenic
1019157313 6:170047962-170047984 CAGAAGGACTGGAGGTTGAAGGG + Intergenic
1019644324 7:2120998-2121020 CAGGTGGACTCGAGGGAGATGGG + Intronic
1019765267 7:2844845-2844867 CAGAAACACTGGAGGGGGATGGG + Intergenic
1019871151 7:3763476-3763498 AAGATGGACTGGTGGAAGAATGG - Intronic
1020598172 7:10238266-10238288 AAGAATCACTGGTGGGAGAATGG + Intergenic
1020832601 7:13110304-13110326 GAGAAGCACTGGAGGGAGGTTGG - Intergenic
1025170999 7:56756638-56756660 CAGATGGACTGATGGGAGTAGGG - Intergenic
1025245289 7:57312496-57312518 CTGAAGGACGAGTGGGAGGTGGG + Intergenic
1025700878 7:63819060-63819082 CAGATGGACTGATGGGAGTAGGG + Intergenic
1028270061 7:88777352-88777374 GGAAAGGACTGGTGGGAGAGTGG - Intronic
1029440195 7:100583099-100583121 AAGAAGACCTGGTTGGAGATGGG + Intronic
1031485338 7:122317054-122317076 CAGAAGGACGGGTCCGAGCTCGG + Intergenic
1033158010 7:138972661-138972683 CGGAGGGACTGGTGGAAGGTTGG - Intronic
1037816529 8:22115494-22115516 GAGAAGGACAGGTGTGAGCTTGG + Exonic
1037906778 8:22720077-22720099 CACAGGGACAGGTGGGAGAAGGG + Intronic
1038425928 8:27463757-27463779 CTGAAGGACTACTGGGAGAGCGG - Exonic
1038735711 8:30167150-30167172 CAGAAGGAAGGGAGGGAGGTAGG + Intronic
1039489493 8:37936936-37936958 AGGAAGGTCGGGTGGGAGATTGG + Intronic
1039555550 8:38472439-38472461 CAGAAGGAATGTGGGGAGAGGGG - Intergenic
1039667905 8:39556138-39556160 CAGAAGATCAGGTGGAAGATGGG + Intergenic
1039890525 8:41682643-41682665 CTCAAGGCCTGGTGGGAGCTAGG + Intronic
1041466008 8:58158207-58158229 CAGCAGGACTGGTAAGGGATGGG + Intronic
1042064023 8:64853970-64853992 CACAAGGGCAGGTGGGAGGTAGG + Intergenic
1042631998 8:70828437-70828459 AAGAAAGACTGGTGGGGGCTGGG + Intergenic
1043761140 8:84069800-84069822 TAAAAGGACTGGAGAGAGATAGG - Intergenic
1043954548 8:86344988-86345010 CAGAAGGATTAGTGGGATAGAGG + Intronic
1044003839 8:86917555-86917577 CAGTAGGACTGATGGGTGGTAGG + Intronic
1044896726 8:96900275-96900297 CAGAAGGAATGGGTTGAGATGGG + Intronic
1047123245 8:121930153-121930175 CAGAAGGACCTCTTGGAGATTGG - Intergenic
1047307629 8:123665904-123665926 CAGAAGGACTTTCTGGAGATAGG + Intergenic
1047347242 8:124040156-124040178 CAGAAGGACTGGTGTGGGGAAGG + Intronic
1047927633 8:129696981-129697003 AAGAAGGATTGGAGGGAGGTGGG + Intergenic
1048519701 8:135142122-135142144 TAGAAGGAAGGGTGGGAGAAAGG + Intergenic
1050033675 9:1412872-1412894 CGGGAGGGATGGTGGGAGATCGG + Intergenic
1050170376 9:2809706-2809728 GTGAAGGTCTGGTTGGAGATAGG + Intronic
1050855158 9:10345101-10345123 CAGATGCAATGGTGGGTGATTGG - Intronic
1051027529 9:12630953-12630975 GAGCAGGCCTGGTGTGAGATAGG - Intergenic
1054710097 9:68502606-68502628 CCCAAGGACTGGGGTGAGATCGG - Intronic
1054778227 9:69141522-69141544 AAGAAGGACAGATGGGAGAGAGG + Intronic
1055532098 9:77194510-77194532 CAGAAGGCCTGGTGTGGGAATGG - Intronic
1059257626 9:112945586-112945608 CAAAAGGGCTGTAGGGAGATTGG - Intergenic
1059311342 9:113390767-113390789 CAGCAGGGCTGGTGGGAGGGAGG + Intronic
1060114288 9:120928628-120928650 CCAAAGGACGAGTGGGAGATGGG - Exonic
1060474599 9:123977209-123977231 CAGAGGGACTGGAGGGAGTGAGG + Intergenic
1060476763 9:123992914-123992936 CAGAGGGACTGGAGGGAGTGAGG - Intergenic
1060942282 9:127549883-127549905 CAGAAGGGGAGGTGGGAGAACGG + Intronic
1062306357 9:135908909-135908931 TGGAAGGACTGGTAGGAAATGGG + Intergenic
1062366466 9:136211776-136211798 CTGGAAGACTGGTGGGAGGTGGG - Intronic
1186053609 X:5626511-5626533 AAGAAGGAATGTTGGGAGGTAGG + Intergenic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1190913641 X:54794052-54794074 CAGGAGCACTGGGGGAAGATAGG + Intronic
1191151792 X:57227675-57227697 GAGAGGGACTGGTGGTGGATAGG + Intergenic
1192250163 X:69406288-69406310 TAGAGTGACTGGTGGGAGGTAGG + Intergenic
1193678519 X:84486932-84486954 CAGGAGGACAGGAGAGAGATTGG - Intronic
1195598102 X:106715989-106716011 GAGGAGGAGTAGTGGGAGATTGG - Intronic
1197286075 X:124596690-124596712 CAGAATGAATGGTATGAGATGGG + Intronic
1198302435 X:135344962-135344984 CGGAAGGAGTGGTGGGCGGTGGG + Intronic
1199595780 X:149504907-149504929 AAGAAGGAATGGTAGGAGAGAGG + Intronic
1199940192 X:152618574-152618596 ATGAAGGACTTGTGGGAGACTGG + Intergenic
1201305924 Y:12550473-12550495 CAGATGGACTGGTGGCTGAATGG + Intergenic