ID: 916207114

View in Genome Browser
Species Human (GRCh38)
Location 1:162325758-162325780
Sequence GGTACCAAGTCACCTGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916207114_916207115 -6 Left 916207114 1:162325758-162325780 CCATCTTCAGGTGACTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 916207115 1:162325775-162325797 GGTACCTTATCTTTATCAGCTGG 0: 1
1: 0
2: 1
3: 3
4: 57
916207114_916207117 29 Left 916207114 1:162325758-162325780 CCATCTTCAGGTGACTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 916207117 1:162325810-162325832 CTGTGCTGCAGCATGTCTTTTGG 0: 1
1: 0
2: 0
3: 18
4: 182
916207114_916207118 30 Left 916207114 1:162325758-162325780 CCATCTTCAGGTGACTTGGTACC 0: 1
1: 0
2: 0
3: 2
4: 90
Right 916207118 1:162325811-162325833 TGTGCTGCAGCATGTCTTTTGGG 0: 1
1: 0
2: 2
3: 27
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916207114 Original CRISPR GGTACCAAGTCACCTGAAGA TGG (reversed) Intronic
901017304 1:6239244-6239266 GGAACAAAGTCACATGCAGAGGG + Intergenic
901137521 1:7007604-7007626 AGCACCAGGTCACCTGAGGATGG - Intronic
902099170 1:13971509-13971531 GTAACCAAGGCACGTGAAGATGG - Intergenic
903979596 1:27176366-27176388 AGTGCCAATTCTCCTGAAGATGG + Intergenic
904259983 1:29282928-29282950 GGCAGCAAGCCACCTGAAGGGGG + Exonic
915721057 1:157985950-157985972 GGTACCAAGTCACCTCTTGCAGG - Intergenic
916207114 1:162325758-162325780 GGTACCAAGTCACCTGAAGATGG - Intronic
917119646 1:171634268-171634290 GGTACAATGGCAACTGAAGAGGG + Intergenic
1070532666 10:77350750-77350772 GGTAGGAAGGCAGCTGAAGAGGG - Intronic
1071465414 10:85935304-85935326 GGTGAGAGGTCACCTGAAGAAGG + Intronic
1085826530 11:79853512-79853534 GGAAGCATTTCACCTGAAGACGG - Intergenic
1086045294 11:82524983-82525005 TGTACCAAGGCCCCTGAAGGAGG - Intergenic
1090553072 11:127843962-127843984 TGTAACAAGTCACCTGCAGGTGG + Intergenic
1092258843 12:6941738-6941760 CTTCCCTAGTCACCTGAAGAAGG + Exonic
1104293733 12:127492974-127492996 GGTACCATGTTACCCTAAGAGGG - Intergenic
1109486940 13:63037434-63037456 ATTACCAAGTCATCTGCAGAAGG + Intergenic
1113770453 13:112904801-112904823 GGCCCCAGGTCACCTGGAGACGG - Intronic
1114483717 14:23050675-23050697 GGTAGGGAGTCACCTGATGAAGG - Intronic
1116264849 14:42674842-42674864 GGAACCAAGTAACAGGAAGAGGG - Intergenic
1121071081 14:91022139-91022161 GGTTACAAGTCAACTGAATAAGG - Intronic
1128488414 15:68120553-68120575 GGTAAAATGTCACCTGAAGTAGG - Intronic
1135295608 16:21277302-21277324 GGTATCCAGTCACTTGCAGAGGG + Intronic
1142246848 16:88974129-88974151 GGAACCAGGTCACCCGAGGAGGG - Intronic
1145355870 17:22149503-22149525 ATTACCAAGTCATCTGCAGAAGG - Intergenic
1145901069 17:28490872-28490894 GGAACCAAGTCCCCAGAAGGAGG + Exonic
1146837785 17:36126122-36126144 GGGACCAGGGCACCTGGAGATGG - Intergenic
1149426066 17:56556170-56556192 GGGACAAAGTCTCCTGGAGATGG - Intergenic
1149496154 17:57118972-57118994 TGTAACTTGTCACCTGAAGAAGG - Exonic
1150880209 17:69015919-69015941 GACACCAAGTCATCTGAATAAGG + Intronic
1152433724 17:80262915-80262937 GGTTCCAAGCCAGCAGAAGAAGG + Intronic
1158257716 18:55572057-55572079 GCTACCAATTCACCTGCAGTGGG + Intronic
1160402031 18:78618366-78618388 GGTACCCAGGCACTGGAAGAAGG - Intergenic
1160861694 19:1239938-1239960 GGAACCCAAGCACCTGAAGAAGG - Intergenic
1161008742 19:1949768-1949790 GAAACCAAGTCACCGGAAGAGGG - Intronic
1162361334 19:10222362-10222384 GGTACCAGGTCTCCTGAGCAAGG - Intronic
1163919583 19:20276188-20276210 GGTGCAGAGTCACCTGGAGAGGG + Intergenic
1164864154 19:31590067-31590089 GGTTCACAGTCATCTGAAGAGGG + Intergenic
926044483 2:9699636-9699658 CGGACCAAGGCATCTGAAGAAGG + Intergenic
926897478 2:17710109-17710131 GGTGCCAAGTAACCAGAAGCAGG + Intronic
928131987 2:28658583-28658605 GGTATCAAGTTACTTGCAGAGGG + Intergenic
929126748 2:38529406-38529428 GGTGCCAAGTGACCTCACGATGG + Intergenic
930237890 2:48905073-48905095 GGAAACAAGTCACCTGCTGAAGG - Intergenic
935808148 2:106769213-106769235 GGTGCAAAGTCAACTGCAGAGGG - Intergenic
938849684 2:135247990-135248012 GGTCCAAAGGCACCTGAAGGAGG - Intronic
940233355 2:151482935-151482957 GGTAGAAAGTCATATGAAGATGG - Intronic
1170387150 20:15831867-15831889 GGGAATAGGTCACCTGAAGATGG - Intronic
1172559229 20:35871113-35871135 AGTACCAAGGAATCTGAAGAAGG + Exonic
1178133599 21:29601133-29601155 GGTACCCACTCACGTGGAGAGGG - Intronic
1178222214 21:30672601-30672623 TGTAACAAGTCACCTCAAAATGG - Intergenic
1178235149 21:30833436-30833458 GGTTCCAACTCACCTCAAGCTGG + Intergenic
1179240044 21:39581865-39581887 GTTACAAAGTTACCTAAAGATGG - Intronic
1184494700 22:44831729-44831751 GGTACCAAGACAACTGAATGGGG - Intronic
950964901 3:17139300-17139322 GCAGCCAAGTGACCTGAAGAGGG + Intergenic
951120915 3:18927599-18927621 GCTTCCAAGTCACAAGAAGAGGG - Intergenic
952102283 3:30028242-30028264 GGAACAAAGTCACCTGACAAGGG + Intergenic
954047880 3:47948576-47948598 CATACCAAGTCATCAGAAGAGGG + Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
961775251 3:129279367-129279389 GGCACCAAGTCACCCGGAGGAGG + Intronic
964155513 3:153580795-153580817 GGTATCAAGAAACCTGAAGCTGG + Intergenic
967916528 3:194582604-194582626 GGTGCCAAGACACCTGTAGGAGG + Intergenic
970473774 4:16401819-16401841 TGTACCAAGTCCCCAGAATATGG - Intergenic
983492680 4:168407148-168407170 GGTACCAAGCCACGTAAAAAGGG + Intronic
984397647 4:179221884-179221906 GAGAAGAAGTCACCTGAAGATGG - Intergenic
985364978 4:189219984-189220006 GGCACCAAGTGACTTGATGATGG - Intergenic
985424335 4:189813482-189813504 GATACCAAGCCACCTGAAAGAGG + Intergenic
987227782 5:15861759-15861781 TGCACCAGGTGACCTGAAGAGGG - Intronic
991977681 5:72199140-72199162 ACTACCAAGACCCCTGAAGATGG + Exonic
993639609 5:90386446-90386468 GGTACAAATTCACCTGCAGAAGG - Intergenic
996919503 5:128751029-128751051 GAGAACAAGTCACTTGAAGATGG - Intronic
997172876 5:131741929-131741951 TGTCCCAAGTAGCCTGAAGAGGG + Intronic
999838336 5:155398645-155398667 GAAACCAAATCACCCGAAGAAGG + Intergenic
1001407552 5:171486579-171486601 CGTAACAAGTCACCTCAAAAGGG - Intergenic
1005233026 6:23726676-23726698 GTTTCCAAGACTCCTGAAGATGG - Intergenic
1008404090 6:51099752-51099774 AATACCATGTGACCTGAAGATGG + Intergenic
1011161036 6:84390617-84390639 CTTACCAAGCCACCTTAAGAAGG - Intergenic
1011445673 6:87436554-87436576 GGGACTAAGTCATCTGAGGAGGG + Intronic
1011710208 6:90045310-90045332 GTTACCAAGACGCCTGAAGTAGG - Intronic
1015853559 6:137599657-137599679 GGTACCAAGTATCCTAAGGAAGG - Intergenic
1018677675 6:166236805-166236827 GTTGCCAGGTCACCTGAGGAGGG + Intergenic
1018725013 6:166605141-166605163 GCAACCAAGTCACCTGCACAGGG + Intronic
1019195783 6:170282010-170282032 CTTACCAAGTCACCTCATGATGG + Intergenic
1023262354 7:38370682-38370704 GATAGCAAGTCAACTGGAGAAGG - Intergenic
1024944002 7:54790853-54790875 GGCACTAAGTCCCCAGAAGAGGG - Intergenic
1030578338 7:111318687-111318709 CTTACCAAGCCACTTGAAGACGG + Intronic
1030813805 7:114008851-114008873 ATGACCAAGTCACGTGAAGAGGG + Intronic
1033580067 7:142724815-142724837 GGGACCCATTCAGCTGAAGATGG - Intergenic
1035114102 7:156508151-156508173 GGTACCAGAGCACCTGGAGATGG + Intergenic
1041333145 8:56750377-56750399 GGTACAAAGACACCTGAAAGAGG - Intergenic
1042778221 8:72459788-72459810 GGTAGTAAGGCACCTGAGGAGGG + Intergenic
1048329495 8:133462376-133462398 TGCACCAAGCCACCTGATGATGG + Intronic
1058825422 9:108771967-108771989 TGAATCAATTCACCTGAAGAAGG + Intergenic
1189256131 X:39641068-39641090 GGAACCAAAACAACTGAAGAAGG - Intergenic
1199742389 X:150747787-150747809 GGTACCCAGTGACCAGAATAAGG + Intronic