ID: 916208490

View in Genome Browser
Species Human (GRCh38)
Location 1:162338594-162338616
Sequence TTAACGACTTTGTAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916208490_916208492 4 Left 916208490 1:162338594-162338616 CCAACCAACTACAAAGTCGTTAA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG 0: 1
1: 0
2: 8
3: 126
4: 1492
916208490_916208493 11 Left 916208490 1:162338594-162338616 CCAACCAACTACAAAGTCGTTAA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 916208493 1:162338628-162338650 GAAAATAAAATCATGGTCTATGG 0: 1
1: 0
2: 2
3: 38
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916208490 Original CRISPR TTAACGACTTTGTAGTTGGT TGG (reversed) Intronic
909559511 1:76994030-76994052 ATAATGACATTGTAGTTGTTTGG - Intronic
911330786 1:96523469-96523491 TTAAGAATTTTGTAGTTGGCAGG - Intergenic
916208490 1:162338594-162338616 TTAACGACTTTGTAGTTGGTTGG - Intronic
916519586 1:165551839-165551861 TGGATGACTTTGTACTTGGTAGG - Intronic
916553894 1:165876116-165876138 TTTAGGACATTGTAGTAGGTGGG + Intronic
923354644 1:233142370-233142392 TAAATGAATTTGTAGTTGGAGGG - Intronic
924703197 1:246475018-246475040 TTAAAAAGTTTGTACTTGGTCGG + Intronic
924773170 1:247094463-247094485 TTAAAGAAGTGGTAGTTGGTTGG - Intergenic
1069879219 10:71581270-71581292 TTAAGGGCTTTGTAGGGGGTGGG + Intronic
1073784275 10:106871497-106871519 TTATCCAGTCTGTAGTTGGTGGG - Intronic
1083115286 11:60453411-60453433 TTAAGAACTTTATAGTTGATAGG - Intronic
1086538279 11:87876578-87876600 TCTAGGACTTTGGAGTTGGTGGG + Intergenic
1087564071 11:99831326-99831348 TTAACGAAGTGGTAGTTGGTTGG + Intronic
1088667464 11:112107868-112107890 TTAAGGACTTTGGAGTTTGTAGG - Intronic
1090107929 11:123871396-123871418 TGATGGACTTTGTAGTTGGAAGG + Intergenic
1092841428 12:12545881-12545903 TTACCGGCTTTGAATTTGGTGGG - Intronic
1093999998 12:25684644-25684666 TTGAAGAATTGGTAGTTGGTTGG + Intergenic
1094463116 12:30719620-30719642 TTAAAGACTTATTAGTTAGTAGG + Intronic
1095066842 12:37788115-37788137 TTAACTTCTTTGCCGTTGGTTGG - Intergenic
1098071824 12:66684143-66684165 TTAGCCACTTTGTATTTGGTAGG + Intronic
1106375218 13:29180037-29180059 TTAACTACTTTGTCTTTGGCTGG + Intronic
1109859243 13:68175658-68175680 TTCACGAATCTGTAGTTGGATGG + Intergenic
1110348512 13:74477841-74477863 TTAGCTACTTGGTAGTTGTTGGG + Intergenic
1114845730 14:26319255-26319277 TTCACGTCTTTGTAATTTGTAGG - Intergenic
1115852554 14:37599307-37599329 TTCACAACTCTGTAGTAGGTAGG + Intronic
1117872949 14:60219785-60219807 TTAACCACTATTTAGTTTGTGGG + Intergenic
1129750836 15:78062333-78062355 TTAGTGACTTTGAAGTTGTTTGG - Intronic
1137758873 16:50924655-50924677 TTAAGGATTTTGTAGTGGGCCGG - Intergenic
1138275001 16:55727978-55728000 CTCACGACATTGTAGTGGGTAGG - Intergenic
1138280187 16:55767226-55767248 CTCACGACATTGTAGTGGGTAGG - Intergenic
1138288301 16:55826412-55826434 CTCACGACATTGTAGTGGGTAGG + Intronic
1141382471 16:83588675-83588697 TTTACCACTTTGTAGATGGCAGG + Intronic
1144406046 17:14953622-14953644 TCAAGGACTTTGTATTTGGCTGG + Intergenic
1156129814 18:33957674-33957696 TTAAAGACTTTCTAAATGGTTGG + Intronic
1160269241 18:77369082-77369104 TTAAGGACTTTGTGGTGGGAAGG - Intergenic
1165011804 19:32853938-32853960 TTAACAACTTTTTTGTTTGTTGG - Intronic
932144860 2:69307815-69307837 TGAACTACTTGGTAATTGGTTGG - Intergenic
944752009 2:202718576-202718598 TTAAAAATTTTGTTGTTGGTTGG + Intronic
945821122 2:214666871-214666893 TTAAAGAAGTGGTAGTTGGTTGG - Intergenic
1173262583 20:41450148-41450170 TTAATGATTTTGTAGTTGTTGGG - Intronic
1178617778 21:34148371-34148393 TAAAGAACTTGGTAGTTGGTAGG + Intergenic
949463254 3:4317052-4317074 TTAAAGACGTGGTAGTTGGTTGG - Exonic
949860982 3:8504504-8504526 TTTATGACTTTCCAGTTGGTGGG - Intronic
952457980 3:33492200-33492222 TGAACGACTTTGGGGTTGGCTGG - Intergenic
953528846 3:43719920-43719942 TTAGGGAATTTGTAGTTGTTAGG + Intronic
953620912 3:44532004-44532026 TTAACCAATTTGAAGTTGCTTGG - Intergenic
960572169 3:119196047-119196069 ATGATGAATTTGTAGTTGGTAGG - Intronic
961151667 3:124643470-124643492 TTAAGGATTTTGTTGTTGTTCGG + Intronic
962963080 3:140329423-140329445 TTTACGACTTTGTGTTTGATGGG + Intronic
965024075 3:163275911-163275933 TTAACAACATAGGAGTTGGTAGG - Intergenic
969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG + Intronic
969572936 4:8020635-8020657 TTGGCGAATTTGCAGTTGGTTGG - Intronic
974144281 4:57927036-57927058 TTAACGGCTTTGTGTTTTGTTGG + Intergenic
974670536 4:65024462-65024484 TTAATGCCTTTGCTGTTGGTGGG - Intergenic
975931240 4:79525691-79525713 TTAACTATTTTGTTGTGGGTAGG + Intergenic
978255721 4:106690662-106690684 TTGACGAGGTTGTAGTTGCTAGG + Intergenic
981442806 4:144802168-144802190 TTAACCACTTATTAGTTGTTGGG + Intergenic
990968425 5:61475773-61475795 TTAATGACTTAATAGGTGGTGGG + Intronic
991534848 5:67658063-67658085 TTAATGACTTTATGGTTGGTGGG - Intergenic
992804132 5:80320246-80320268 TTAACGGTTTTGGAGATGGTGGG - Exonic
993941465 5:94063387-94063409 TTCACGATTTTGTTGATGGTAGG - Intronic
1003223471 6:4182914-4182936 TTAAAGAGTTTGTATTTGATTGG + Intergenic
1006873991 6:37279554-37279576 TTTATGACCTTGTAGTTGGCAGG - Exonic
1020564165 7:9774951-9774973 TTAGCGACTGTGTGGTGGGTGGG + Intergenic
1027212354 7:76160763-76160785 TTAACGATTTATTGGTTGGTTGG - Intergenic
1030696997 7:112596365-112596387 TTAACCACTTTTTAGTTGACAGG + Intergenic
1031235183 7:119166846-119166868 TTAATTATTTTGTAGTTGTTTGG + Intergenic
1032681330 7:134186932-134186954 TGAATGAGTTTGTAGTTGGGAGG - Intronic
1035579245 8:729659-729681 TTAAGGACATTGTGGTTGGAAGG - Intronic
1038413077 8:27373411-27373433 TTAGCTACTTTCTAGTTGGAGGG - Intronic
1040690082 8:49926906-49926928 TTACCGATTTTTTAATTGGTTGG - Intronic
1044455653 8:92389975-92389997 TTAAACATTTTTTAGTTGGTGGG + Intergenic
1044923702 8:97191196-97191218 TAAATGACTTTGAGGTTGGTGGG + Intergenic
1048152528 8:131907998-131908020 TTAATGATTATGTAGGTGGTAGG + Intronic
1055634480 9:78261859-78261881 TTAAAGAATTTGTAGTTATTAGG + Intronic
1188052760 X:25507973-25507995 TTAACGATTTTGTTGCTGATGGG + Intergenic
1193449526 X:81648440-81648462 TTAACGATTTTGTTGTTCATTGG - Intergenic
1198041321 X:132855662-132855684 TTTACAAATTTCTAGTTGGTGGG - Intronic
1201913876 Y:19161507-19161529 TTATGAACTTTTTAGTTGGTAGG - Intergenic