ID: 916208492

View in Genome Browser
Species Human (GRCh38)
Location 1:162338621-162338643
Sequence GAGAATAGAAAATAAAATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1627
Summary {0: 1, 1: 0, 2: 8, 3: 126, 4: 1492}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916208491_916208492 0 Left 916208491 1:162338598-162338620 CCAACTACAAAGTCGTTAAGAAA 0: 1
1: 0
2: 1
3: 9
4: 134
Right 916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG 0: 1
1: 0
2: 8
3: 126
4: 1492
916208490_916208492 4 Left 916208490 1:162338594-162338616 CCAACCAACTACAAAGTCGTTAA 0: 1
1: 0
2: 0
3: 6
4: 72
Right 916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG 0: 1
1: 0
2: 8
3: 126
4: 1492
916208488_916208492 20 Left 916208488 1:162338578-162338600 CCCAAATTTTATAGGACCAACCA 0: 1
1: 0
2: 1
3: 9
4: 114
Right 916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG 0: 1
1: 0
2: 8
3: 126
4: 1492
916208489_916208492 19 Left 916208489 1:162338579-162338601 CCAAATTTTATAGGACCAACCAA 0: 1
1: 0
2: 0
3: 11
4: 138
Right 916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG 0: 1
1: 0
2: 8
3: 126
4: 1492

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916208492 Original CRISPR GAGAATAGAAAATAAAATCA TGG Intronic
900269629 1:1780510-1780532 GAGATGAGAAAACAAAACCAGGG + Intergenic
900904270 1:5540394-5540416 GAAAAAAAATAATAAAATCATGG - Intergenic
901303122 1:8214093-8214115 AAGAAAAGAAAATAAAATAAAGG - Intergenic
901553391 1:10013069-10013091 GAAAAAAAAAAAAAAAATCATGG - Intronic
902065141 1:13679401-13679423 CAGACAAGAAAATAGAATCAAGG + Intergenic
902901514 1:19519659-19519681 GAGCATTGAAAATAAAAACGAGG - Intergenic
903022748 1:20405387-20405409 GGGAAAAGAAAATACAATCCAGG + Intergenic
903404166 1:23082425-23082447 GAAAAAAAAAAAAAAAATCAGGG - Intronic
904182751 1:28678277-28678299 AACACTAGAAAAGAAAATCAAGG - Intronic
904332687 1:29772793-29772815 GAGATGAGAAAAACAAATCAAGG - Intergenic
904373000 1:30062499-30062521 GAGAAAAGAAGAGAAAATCATGG - Intergenic
904779542 1:32935129-32935151 TAAAATAAAAAATAAAATAATGG - Intergenic
904878772 1:33678350-33678372 GAGAAAATAAAAAAAATTCATGG + Intronic
904970217 1:34413654-34413676 AAGAAAAGAAAAGAAAACCAAGG - Intergenic
905417008 1:37810758-37810780 GAGAATTGAAGATAAAATGGGGG + Exonic
905715604 1:40146832-40146854 GAGAAAAGAATATAAAACCCAGG + Intergenic
905870481 1:41401272-41401294 AAAAATAAAAAATAAAATGATGG - Intergenic
906716859 1:47976625-47976647 GAGAAAGGAAAGTAAATTCAAGG + Intronic
906834036 1:49063680-49063702 GGGAATAGAAAGTAAAAGAAGGG + Intronic
906851369 1:49253708-49253730 GACAAAAAAAAAAAAAATCAAGG + Intronic
907324002 1:53624949-53624971 GAGAAATTAAAATAAAACCAGGG + Intronic
907679085 1:56546967-56546989 AAGAATAAAAAATAAAAGCAAGG + Intronic
907794108 1:57697344-57697366 CAGAATCGAAAATAAAAACTGGG + Intronic
908094804 1:60726366-60726388 GAGAATCCAAAGTAGAATCATGG + Intergenic
908290292 1:62658958-62658980 GAGAAAAAAAAAAAAAATGAAGG + Intronic
908386316 1:63645375-63645397 GAAAAAAGAAAAAAAAATTAAGG + Intronic
908458737 1:64329099-64329121 CAAAAAAGAAAAAAAAATCAAGG - Intergenic
908468557 1:64419267-64419289 TAAAATGGAAAAGAAAATCAAGG - Intergenic
908481861 1:64548443-64548465 GAGAATAGAGAATATATTCTGGG + Intronic
908553779 1:65236427-65236449 GAGTACAGAAAAGAAAATGAAGG + Intergenic
908957871 1:69656960-69656982 GAGAATAGAAAAAAAAGGAAAGG + Intronic
909312334 1:74168442-74168464 GCAAATTGAAAATAAAATGATGG - Intronic
909337429 1:74491979-74492001 GTGAATAGAAATTAAAATATGGG + Intronic
909362485 1:74779590-74779612 AGAAATAGAAAATAGAATCATGG - Intergenic
909723220 1:78801771-78801793 TAGAATTGAAAAAAAAAGCAGGG + Intergenic
909926758 1:81446622-81446644 GAGAAAAGAAAATAACACCCAGG + Intronic
910058905 1:83065282-83065304 TAAAAGAGAAAATAAAATTAAGG + Intergenic
910241909 1:85095876-85095898 GAGAAAAGAGATTAAGATCATGG - Intronic
910524323 1:88160400-88160422 GAAAATTGAAAATAGAATAATGG + Intergenic
910671530 1:89778038-89778060 CAGAGTAGGAAATTAAATCAAGG - Intronic
910674330 1:89801499-89801521 GAGAATAAAAATTAAAATGTGGG - Intronic
910890349 1:92012298-92012320 GAAAAAAAAAAAAAAAATCATGG + Intronic
911239584 1:95450292-95450314 GAGGATAGACAGAAAAATCAGGG - Intergenic
911391432 1:97249388-97249410 GAGAAAAGAAAAGAAAAGAAAGG + Intronic
911898952 1:103475918-103475940 GGGAATAGAAAATAAACAAATGG + Intergenic
912020360 1:105101598-105101620 GAGAAAGGAAAATAAAAACGAGG - Intergenic
912031057 1:105244442-105244464 GTAAATATGAAATAAAATCACGG - Intergenic
912120745 1:106468629-106468651 TAAAATAAAAAATACAATCAAGG + Intergenic
912133919 1:106636327-106636349 GAGAATATAAAATAAGAAGAAGG - Intergenic
912713874 1:111968361-111968383 GAAAAAAGAAAAAAAAATCTAGG + Intronic
912765181 1:112402448-112402470 GAGAACAGAAAGTAGAAGCAGGG + Intronic
912840685 1:113036587-113036609 GAGATGGGAAAAGAAAATCAGGG + Intergenic
912871915 1:113314714-113314736 GAAAACAGAAAACAAAATCGCGG + Intergenic
912933420 1:113983335-113983357 GAGAAAAGAAAAGAAGATAAAGG - Intergenic
913196944 1:116465070-116465092 TAGAATAGGAAATAAAATGGTGG + Intergenic
913279131 1:117169048-117169070 GAATATAGAAAATAAAGTTACGG + Intronic
913311742 1:117504170-117504192 TAGACTAGAAAATAAAGTGACGG + Intronic
913366025 1:118039797-118039819 CAGCATAGAATATAAAACCAGGG + Intronic
913379863 1:118198031-118198053 GAATATAGAAAATAAAAGTAAGG - Intergenic
913387212 1:118271363-118271385 TAGAAAAGAGAAAAAAATCATGG + Intergenic
913595975 1:120377478-120377500 TAGAATAGAAAATAGAAGAAAGG + Intergenic
913599389 1:120408346-120408368 GAGGATAGGAAAGAAAATGATGG + Intergenic
914091304 1:144501498-144501520 TAGAATAGAAAATAGAAGAAAGG - Intergenic
914307299 1:146432701-146432723 TAGAATAGAAAATAGAAGAAAGG + Intergenic
914314554 1:146497817-146497839 GAGGATAGGAAAGAAAATGATGG - Intergenic
914349586 1:146829014-146829036 AATAACAGAAGATAAAATCATGG + Intergenic
914499798 1:148235571-148235593 GAGGATAGGAAAGAAAATGATGG + Intergenic
914591485 1:149110210-149110232 GAGGATAGGAAAGAAAATGATGG - Intergenic
914594807 1:149140430-149140452 TAGAATAGAAAATAGAAGAAAGG - Intergenic
914772936 1:150707036-150707058 CAGATGAGAAAATCAAATCAGGG - Intronic
914945805 1:152064894-152064916 GAGGATAGAAAATGAAAACATGG - Intergenic
914959575 1:152194586-152194608 GAGAAGAGAAAAGAAAAGAATGG - Intergenic
916058388 1:161083291-161083313 GAGAAGAGAAAATAGAATTTGGG + Intronic
916155730 1:161845121-161845143 GAGAATGGAAAATATATTAAGGG + Intronic
916208492 1:162338621-162338643 GAGAATAGAAAATAAAATCATGG + Intronic
916418373 1:164613406-164613428 GAGAAGAGAGAATGAATTCAAGG - Intronic
917176454 1:172241087-172241109 TAGAACAGAAAAAAAAATCCTGG - Intronic
917216674 1:172686089-172686111 GAAATTAGAAAATAAAATATTGG - Intergenic
917265591 1:173217346-173217368 GAGTGTCAAAAATAAAATCAAGG - Intergenic
917446709 1:175111773-175111795 TAGCATAAAAAAAAAAATCAAGG - Intronic
917592238 1:176488176-176488198 AAAAATAAAAAATAAAAACAAGG - Intronic
917679784 1:177354197-177354219 GAGAAATAAAAATAAAAGCAGGG + Intergenic
918028755 1:180781615-180781637 GTGAAGGGAAAATAAAACCAGGG - Intronic
918414435 1:184291951-184291973 GAGAAAAGAGACTAAAAACAGGG - Intergenic
918490026 1:185071539-185071561 GTGAAAAGAAAATAGAATCTCGG - Intronic
918543575 1:185657702-185657724 GAAAAAAGAAAAGAAAAGCAAGG - Intergenic
918605089 1:186415083-186415105 GAGAATAGAAAAAAAAAGGGGGG + Intronic
918724708 1:187905363-187905385 GGAAATAGAAAATAAAAGAAAGG + Intergenic
918737304 1:188081167-188081189 AATAATAGAATAAAAAATCAAGG - Intergenic
918959892 1:191260771-191260793 GAGAGTAGAAAATGAGATCTGGG - Intergenic
918979054 1:191531182-191531204 AAGAATTGAAAATAAGATCTGGG + Intergenic
918988784 1:191669530-191669552 GAGAATACAAAAACAAATCTGGG - Intergenic
919170909 1:193952873-193952895 GAGAATGAAAAATAAAATATAGG - Intergenic
919252198 1:195070243-195070265 AATAATAGAAAATAATATAATGG - Intergenic
919265627 1:195261029-195261051 GAAAATAGAAAATAATCTAAAGG - Intergenic
919360042 1:196580797-196580819 GACTATAGAGAATAAAAGCAGGG + Intronic
919516708 1:198534043-198534065 GAACAAAGAAAATAAAATAAGGG + Intronic
919722273 1:200850972-200850994 AACAATACAAAATAAAATTATGG - Intronic
919949293 1:202347836-202347858 AAGAAAAGAAATAAAAATCATGG + Intergenic
920109821 1:203579848-203579870 AAGTACAGAAAATAAAATAACGG + Intergenic
920642043 1:207762435-207762457 GAGAAAAGAAAAAAAAATAGAGG + Intronic
920711653 1:208301220-208301242 GAAGATAGAAAACAAAAACAAGG + Intergenic
920734979 1:208525475-208525497 GAGAATAAGAAGTCAAATCAGGG + Intergenic
920892441 1:210002527-210002549 CAGTACAGAAAAAAAAATCATGG - Intronic
921028659 1:211316348-211316370 TAAAATAGAATATAAAATAAAGG + Intronic
921110084 1:212027444-212027466 AAGAATACAAAATAAAATGTAGG - Intronic
921246026 1:213241633-213241655 GATAATAGAAAATAAACTCTTGG + Exonic
921377771 1:214491860-214491882 GAGGATAGAAAAGAAAAGAATGG - Intronic
921635680 1:217489495-217489517 AATAAAAGAAAATAAAATAATGG - Intronic
921805083 1:219445063-219445085 GTGAATAAAAAAAAAAAACAAGG + Intergenic
921971392 1:221153153-221153175 AAGAAAAGAAAAGAAAATCTTGG - Intergenic
921983975 1:221289115-221289137 GAGAGTAGATAATAAATTTATGG + Intergenic
921987158 1:221324544-221324566 GGAAATAGAAAATATAATGAAGG + Intergenic
922147119 1:222957594-222957616 AAAAATAAAAAATAAAATAAAGG + Intronic
922231742 1:223693223-223693245 GTGAATAACAAATCAAATCAAGG + Intergenic
922402967 1:225279488-225279510 GAGAATAAATAATAAAATAATGG + Intronic
922865726 1:228860122-228860144 GTGAAAGGAAAATAAAATCTCGG - Intergenic
923327931 1:232897341-232897363 GTGAAAAGAAAATAAAATTCCGG + Intergenic
923414637 1:233744200-233744222 TAGAATAGAAAAAAAACTAAGGG - Intergenic
923647170 1:235835253-235835275 GAAAAAATAAAATAAAATTATGG + Intronic
923775662 1:236976426-236976448 GAGAATAGACAAATAAATTATGG + Intergenic
923950606 1:238947943-238947965 AAGAATGAAAAATGAAATCAAGG + Intergenic
923991191 1:239438888-239438910 AAAAATAGAAAACTAAATCAAGG + Intronic
924043169 1:240003547-240003569 GAGAGTAGAATATGAAATAAAGG - Intergenic
924151757 1:241136695-241136717 AAGAACTGAAAATGAAATCAAGG - Intronic
924583221 1:245339863-245339885 ATGTATATAAAATAAAATCAAGG - Intronic
924632883 1:245759128-245759150 GAGAAAAGATAAGAAAATAATGG - Intronic
924668915 1:246103268-246103290 GAGTATAAGAAATAAAATTAAGG - Intronic
924846845 1:247782998-247783020 GAAAAAAGGAAATAAAATGAAGG + Intergenic
1062950401 10:1495972-1495994 GACAATAGAAATGATAATCATGG - Intronic
1063083794 10:2794393-2794415 GAGAATATTCAATAAAATAATGG + Intergenic
1063102942 10:2966343-2966365 GAGAAGAGAAAAGAAAAGAAAGG + Intergenic
1063168912 10:3488238-3488260 AAAAACAGAAAAAAAAATCAAGG + Intergenic
1063307647 10:4920321-4920343 GAGAAAAAATAATGAAATCAGGG + Intergenic
1063453319 10:6165789-6165811 GAAAAAAGAAAATAAAATACTGG - Intronic
1063723103 10:8604695-8604717 GGGAAGAGAAAAAAACATCAGGG - Intergenic
1063874260 10:10455925-10455947 GACAATAGAAAATATAATTTTGG - Intergenic
1063880904 10:10531007-10531029 GATATTAGCACATAAAATCATGG + Intergenic
1063898152 10:10703687-10703709 GAGAAGAGAATATAAAATGATGG + Intergenic
1063964392 10:11335462-11335484 CAGACTAGAAAATACAATCTCGG - Exonic
1064321226 10:14306828-14306850 GAATATATAAAGTAAAATCATGG - Intronic
1064616987 10:17168940-17168962 GAAAAAAGAACATAAAAACATGG + Intronic
1064651051 10:17509850-17509872 TAGAAGGGAAAATAAAATTAAGG - Intergenic
1064657426 10:17569869-17569891 GAGCATACAAGATAAAAACAAGG - Intergenic
1064910666 10:20398185-20398207 GAAAAAAGAAAAAAAAAACAAGG + Intergenic
1064914622 10:20442356-20442378 AAGAATAAAAATTAAAAGCAGGG - Intergenic
1064986364 10:21214874-21214896 AAGAATAGGAAATAAATTAAAGG + Intergenic
1065366302 10:24940476-24940498 GAAAATACAAATTAAAACCACGG + Intronic
1065804722 10:29383989-29384011 GTGAAAGGAAAATAAAATCCCGG - Intergenic
1065847549 10:29758650-29758672 GAGGCTAGAATATAAAGTCAAGG + Intergenic
1066167419 10:32802183-32802205 GATAAAAGAAAATGAAGTCAGGG - Intronic
1066478338 10:35770421-35770443 GAGAAAAGAAAATATTATTAAGG + Intergenic
1067270422 10:44787021-44787043 CATAATAAAAAATAATATCATGG - Intergenic
1067353198 10:45495868-45495890 GAGAAAAGAAAAGAAAAGAAAGG + Intronic
1067485485 10:46646011-46646033 GATAATAGGAAAGAAAACCAAGG + Intergenic
1067609273 10:47695641-47695663 GATAATAGGAAAGAAAACCAAGG - Intergenic
1067806495 10:49396563-49396585 GAGAAGCGAACATAAATTCAGGG - Intergenic
1067935200 10:50605224-50605246 AAAAATACAAATTAAAATCAAGG + Intronic
1068187011 10:53598304-53598326 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1068446307 10:57128240-57128262 CAGAATAGAGATTAAAAGCATGG + Intergenic
1068667781 10:59695780-59695802 GAGAAAAAAACATAAATTCAGGG + Intronic
1068731690 10:60365123-60365145 AAGAATAGAAAATGAGATGAGGG + Intronic
1068826865 10:61450448-61450470 GAGAATAAAAAATCAGAACATGG - Intronic
1068864992 10:61885474-61885496 GTGAAAACAAAATAAAATAATGG - Intergenic
1068909553 10:62364352-62364374 AAGAAAAGAAAAGAAAATCCTGG - Intergenic
1068910127 10:62371491-62371513 GGTAATAAAGAATAAAATCAGGG - Intergenic
1069031606 10:63601952-63601974 AATAATAAAAAATAAAAGCAGGG + Intronic
1069299774 10:66891601-66891623 AAGAAAATAAAATGAAATCATGG - Intronic
1069311972 10:67048970-67048992 GTTAAAAGAAAATAAAATTAAGG - Intronic
1069974286 10:72199706-72199728 AAGAAGAGAAAATAAAAACTAGG - Intronic
1070226389 10:74511536-74511558 TAGAAAAGAAAATAAAATCTTGG - Intronic
1070588768 10:77786762-77786784 GAGAAGAGAAGAGAAAATGAGGG + Intergenic
1070698979 10:78585010-78585032 TAGATTATAAAATAAAACCAGGG + Intergenic
1070897859 10:80000413-80000435 GAAAAAAGGAAATAAAATAAGGG - Intergenic
1071434874 10:85639183-85639205 GAGAATAAATAAACAAATCAAGG + Intronic
1071624864 10:87157287-87157309 GATAATAGGAAAGAAAACCAAGG - Intronic
1071755049 10:88528078-88528100 CAGAAAAGAAAAGAAAATGAAGG + Intronic
1071969855 10:90893150-90893172 GAAAATCTAAAATAAAATCTGGG + Intronic
1072069677 10:91904157-91904179 GAAAATAGAATATAAAATGTCGG - Intergenic
1072250199 10:93575869-93575891 GAGAACAGAAAACATAATCATGG + Intronic
1072275800 10:93821666-93821688 GGGAATAAAAATTAGAATCAGGG + Intergenic
1072634177 10:97166623-97166645 GAGAAAAGAAAAGAAAAGAAAGG + Intronic
1072929765 10:99651983-99652005 GAAAATAGAGAAGAAAATCTTGG - Intergenic
1072971009 10:100017366-100017388 GAAAAAATAAAATAAAATAAGGG + Intergenic
1073256391 10:102154446-102154468 TAGAAAAGAAAATAATCTCAGGG + Intronic
1073442043 10:103557858-103557880 AAGAAAAGATAATACAATCAAGG - Intronic
1073756782 10:106589289-106589311 GAGAATAGAAAGTAAAAAGAGGG - Intronic
1073893581 10:108127684-108127706 GATAATAGAAAATAAGTTTAAGG - Intergenic
1074111364 10:110424961-110424983 AAGCATGGAAAATAAAATCCTGG + Intergenic
1074334895 10:112562071-112562093 GAAAAAATAAAATAAAATAATGG + Intronic
1074339640 10:112614899-112614921 GAAAAAAGAAAAAAAAATAACGG - Intronic
1074629654 10:115238085-115238107 AAGAATAGACAAATAAATCAAGG - Intronic
1074675558 10:115845854-115845876 CAGAACATAAAATAAACTCAAGG - Intronic
1074770832 10:116732602-116732624 GAGACTAGAAAAGAAAAGCTGGG + Intronic
1074782568 10:116812475-116812497 AATAAAATAAAATAAAATCAGGG + Intergenic
1075000447 10:118793244-118793266 AAAAATAAAAAATAAAATTAAGG - Intergenic
1075058044 10:119234625-119234647 AAGAATAGAAAAGAAAAGGAGGG - Intronic
1075361763 10:121843834-121843856 GATAATATAAAAGAAAATCTAGG + Intronic
1075524695 10:123173930-123173952 GAGAAGAAAAAATAAGATTAGGG + Intergenic
1075555472 10:123427978-123428000 GAAAATTGAAAATAAAATTATGG + Intergenic
1075607836 10:123827862-123827884 CAGAACAGAAAAATAAATCAGGG + Intronic
1075739684 10:124687073-124687095 GAGAAAAGTAAAAACAATCAAGG + Intronic
1075806696 10:125194183-125194205 TAAAATATAAAATAAAAACAGGG + Intergenic
1075899132 10:126024846-126024868 GAGAACAAAAAAAAAAAGCAGGG + Intronic
1076388180 10:130074389-130074411 GAGAGAAGAAAACACAATCATGG - Intergenic
1076410996 10:130250629-130250651 GAGAAACCAACATAAAATCAAGG - Intergenic
1076712964 10:132348934-132348956 GTGAAAGGAAAATAAAATCTCGG - Intronic
1077274683 11:1698819-1698841 AAAAATAAAAAATAAAATGAAGG - Intergenic
1077636690 11:3846624-3846646 AAAAATAAAAAATAAAATAAAGG - Intergenic
1077752452 11:4987778-4987800 GAGAAAAAAGAATAAAATCAAGG - Intronic
1078075992 11:8161319-8161341 GTGAAAAGAAAATAAAAACTTGG - Intronic
1078220804 11:9350116-9350138 AAGAAAAGAAAAGAAAATCTCGG - Intergenic
1078224227 11:9377880-9377902 CAGAATGGAAAATAAAATTAGGG + Intergenic
1078612071 11:12829530-12829552 AAGAATAAAAAACAAATTCAAGG - Intronic
1078965954 11:16342915-16342937 GATACTAGAAAATAAAATGGGGG + Intronic
1078970041 11:16398655-16398677 GAGAAAGGAAAAAAAAATCTAGG - Intronic
1079167728 11:18061887-18061909 GAAAATAAAAAATATATTCATGG - Intergenic
1079533944 11:21488124-21488146 GAAAATTGACAATGAAATCATGG + Intronic
1079720591 11:23807197-23807219 AAGAAAACAAAATAAAATCTCGG - Intergenic
1079727931 11:23899358-23899380 TAGAATAGAAAAAAAAAACCTGG + Intergenic
1079891894 11:26066532-26066554 GTGAAAGGAAAATAAAATCTTGG + Intergenic
1080079859 11:28203825-28203847 GTGATTAGCAAATAAAAACATGG + Intronic
1080203434 11:29701364-29701386 AAGAATAATAAATAGAATCAAGG + Intergenic
1080327745 11:31097607-31097629 GAGAGTAGAAAATATCAGCAAGG + Intronic
1080421421 11:32114343-32114365 GAGAATAGAAAAGAAAGGTAAGG - Intergenic
1080687297 11:34525862-34525884 CAGAATAAAAAATAGAGTCAGGG - Intergenic
1080732636 11:34975218-34975240 TACAATAGAAAAAAAAATCTAGG - Intronic
1080752929 11:35167338-35167360 CACAGGAGAAAATAAAATCAAGG - Intronic
1080877384 11:36289141-36289163 GATAAAAAAAAATAAAATAATGG - Intronic
1081124391 11:39304832-39304854 GTGAATAGGAAATGAAATAAGGG + Intergenic
1081337817 11:41888969-41888991 GAGAATACACAATAAAATATGGG - Intergenic
1081407912 11:42719312-42719334 GGAAATAGAGAATAAAATGATGG + Intergenic
1081411680 11:42766036-42766058 GGGAATAGGAAATGAAATGAGGG + Intergenic
1081446447 11:43135696-43135718 GAGAAAAGGAAAAAAAATAACGG + Intergenic
1081520065 11:43873047-43873069 GTGAAAGGAAAATAAAATCTCGG - Intergenic
1081817495 11:45957770-45957792 GAAAAAAGAAAATAAAGTCTAGG + Intronic
1081957736 11:47108181-47108203 GAGGCCAGAAAATGAAATCAGGG + Intronic
1081961781 11:47143202-47143224 GAGAATAGTTTACAAAATCAGGG - Intronic
1082034118 11:47630396-47630418 GAAAAAAGAAAAAAAAATAAGGG + Intronic
1082694216 11:56339878-56339900 AAAAATAGAAATTAATATCAAGG + Intergenic
1082773542 11:57228201-57228223 TTGAATAGAAAATAAGATCTTGG - Intergenic
1083060151 11:59861420-59861442 GAGGGTAGAAAATAAAATCCAGG + Intronic
1083083942 11:60123245-60123267 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1083088604 11:60176394-60176416 CAGAGTGGGAAATAAAATCAAGG - Intronic
1084015087 11:66373898-66373920 AAGAAAAGAAAAGAAAATCCTGG - Intergenic
1084137392 11:67195856-67195878 TAAAATAGAAAATAAAATACTGG - Intronic
1084600160 11:70140660-70140682 GAGGATAACAAAGAAAATCATGG + Intronic
1084751502 11:71207102-71207124 AAGAAAAGAAAAAAAAATCATGG + Intronic
1085559721 11:77460152-77460174 TAGAATAGAAAAAAAAAAAAAGG + Intronic
1085590505 11:77755337-77755359 GTGAATGGAAAGAAAAATCAAGG + Intronic
1085624604 11:78062291-78062313 AAGAAAAGAAAAGAAAATGAAGG - Intronic
1085743699 11:79097287-79097309 AAGAATAGAAAACATAACCAAGG - Intronic
1085797853 11:79559946-79559968 GGGAAAAGAAAATGGAATCAAGG + Intergenic
1085833199 11:79925070-79925092 GAGAATAGGAAATGCCATCAGGG + Intergenic
1085847480 11:80083004-80083026 AAGAATAGAAAATGAAGTAAAGG - Intergenic
1085911377 11:80830833-80830855 AAGAAAAGAAAATTAATTCATGG - Intergenic
1086348162 11:85919002-85919024 GTGAAAGGAAAATAAAAACATGG - Intronic
1086357669 11:86021326-86021348 GAAAATAAAAAATAAAAACAGGG + Intronic
1086920128 11:92577088-92577110 AAAAATAAAAAATAAAAACAAGG - Intronic
1087088706 11:94245982-94246004 GACAAAAGAAAATGAAACCAGGG + Intergenic
1087108221 11:94433386-94433408 GAGAATAGAAAAGAGACACAGGG - Intronic
1087121524 11:94580119-94580141 GAAAATAGACCATAAAAACATGG + Intronic
1087288432 11:96292826-96292848 GAGAGTAGGATATAAAAACAAGG + Intronic
1087505396 11:99013994-99014016 CAAAATAAAAAATAAAATAAGGG - Intergenic
1087654969 11:100911541-100911563 GAGAAAAGAAAAAAGGATCATGG + Intronic
1087792746 11:102424383-102424405 CAGATTTGAAAATAAACTCAGGG + Intronic
1087901535 11:103646872-103646894 GAGTTTAGAAAATAAACTCAGGG + Intergenic
1088141231 11:106618996-106619018 GAGATTAGAAAAAAAAAAAAAGG - Intergenic
1088226003 11:107620880-107620902 GAGAAAAGAAAAAGAAAACATGG + Intronic
1088374216 11:109122122-109122144 GAGAAAACAAAATAAAATAATGG + Intergenic
1088396285 11:109373582-109373604 GAGGCTGGAAAATAAAATCCAGG + Intergenic
1088419323 11:109625123-109625145 GGGAATAGAAAATCTAATGAAGG + Intergenic
1088551032 11:111012462-111012484 AATAAAATAAAATAAAATCACGG + Intergenic
1088971968 11:114781581-114781603 GAGGATAGAAAATATGACCAGGG + Intergenic
1090006195 11:123004497-123004519 AAGAAAAGAAAAAAAAATCATGG + Intergenic
1090112497 11:123928834-123928856 AAGGTTAGAAAATAAAGTCAAGG - Intergenic
1090689837 11:129169110-129169132 AAGAATAGTAAATTAATTCAAGG + Intronic
1090695217 11:129233957-129233979 AAGAAAGGAAAATAATATCAGGG + Intronic
1091697003 12:2634453-2634475 GGGGAGAGAAAATAAAATGAAGG - Intronic
1091946922 12:4554512-4554534 GAAAATACAAAATATATTCATGG - Intronic
1092021933 12:5209923-5209945 GAGCATAGAGAATAGAAGCAGGG - Intergenic
1092054559 12:5498085-5498107 GAGACTAGATAATAAGCTCAAGG - Intronic
1093005976 12:14051272-14051294 CAGAATAGAAAATACAAGCAAGG + Intergenic
1093028123 12:14263207-14263229 AAAAAAAGAAAAGAAAATCAGGG - Intergenic
1093067170 12:14670330-14670352 GAGATTAGAAAATTAAGTAATGG - Intronic
1093263864 12:16975893-16975915 AAGCAAAGAAAATAAAAACAAGG - Intergenic
1093561216 12:20542966-20542988 GGAAATAAAAAATAAAATAAAGG - Intronic
1093718327 12:22409492-22409514 GAAAATAGAACAGAAAATAAAGG - Intronic
1093814968 12:23534684-23534706 AAGAAAAGAAAAGAAAAACAAGG - Intronic
1093859290 12:24143474-24143496 GAAAATATTAAATAAAAGCATGG + Intergenic
1093859935 12:24152795-24152817 GAGCACAGAAAACAAAATGAGGG + Intergenic
1094216645 12:27949490-27949512 GAAAAAAAAAAGTAAAATCATGG + Intergenic
1094243139 12:28252495-28252517 CCGGATAGAAAATAAAATTAAGG - Intronic
1094394196 12:29987869-29987891 GACTATAGAAAGTAAAATGATGG + Intergenic
1094398561 12:30035859-30035881 GAGAACAGAATATAGAATCCAGG + Intergenic
1094631063 12:32174640-32174662 GGGAATAGAACAGAAAATCTGGG - Intronic
1095428701 12:42108995-42109017 TAAAAAAGAAAAAAAAATCAAGG + Intronic
1095531238 12:43189422-43189444 GAAAATAGATAATACAAGCATGG + Intergenic
1096357290 12:50951931-50951953 AAAAAAAGAAAAAAAAATCAAGG + Intergenic
1096781999 12:53996963-53996985 CAGAAAATAAAATAAAATAAAGG + Intronic
1097327921 12:58300343-58300365 CACAATAGAAAGTAAAATCGAGG - Intergenic
1097476421 12:60062153-60062175 GATAATAGAAGATTAAGTCAGGG - Intergenic
1097533062 12:60830011-60830033 TGGAACAGAAAATAAAAGCAAGG + Intergenic
1097750347 12:63345739-63345761 GAGAATGGATAAAGAAATCATGG - Intergenic
1098118498 12:67207849-67207871 GAATACAGAAAAAAAAATCAAGG + Intergenic
1098300221 12:69046718-69046740 GAGAAAAGAAAAAAAAGGCAAGG - Intergenic
1098357021 12:69621580-69621602 TAAAAAATAAAATAAAATCATGG + Intergenic
1098460123 12:70723253-70723275 GAGACTTGGAAATTAAATCAAGG + Intronic
1098511806 12:71324105-71324127 TAGACTAGAAAAGAAAATTAGGG + Intronic
1098586425 12:72160041-72160063 AAGAAGAAAAAATAAAAGCATGG - Intronic
1098670757 12:73227567-73227589 GAACATAGAAAATAAAACAAAGG - Intergenic
1098754700 12:74346154-74346176 AAGAAAACAAAAAAAAATCAAGG + Intergenic
1098959566 12:76725475-76725497 GAGAATAGAACAAAAATTCAGGG - Intergenic
1099224170 12:79949349-79949371 GAGTAGAGAAAATTAAAGCAGGG - Intergenic
1099233712 12:80057047-80057069 GAGATTAGAAAAAAAAATACTGG - Intergenic
1099372697 12:81856940-81856962 TAGAGAAGAAAATAGAATCAAGG + Intergenic
1099383905 12:81990445-81990467 GTGAAAGGAAAATAAAAACATGG - Intergenic
1099719561 12:86342737-86342759 GACAATATAAAAAAAAACCATGG - Intronic
1099970189 12:89492337-89492359 GAGAATAGAAAAACAAAAGATGG + Intronic
1100351620 12:93789072-93789094 GAGATTAAAAAATAAAAAAAAGG - Intronic
1100454659 12:94740749-94740771 GAGAAAAGAAAAGAAAAGGAAGG + Intergenic
1100660413 12:96692082-96692104 GAGAATAGAAAAAAATATGTGGG - Intronic
1101024980 12:100592994-100593016 GAAAATAGGTAATAAAATGAAGG + Intronic
1101063441 12:100995278-100995300 GGGAACAGAAAACAAAACCAAGG + Intronic
1101295769 12:103422411-103422433 GAGTTGAGAAAATAAAATGATGG + Intronic
1101776660 12:107800938-107800960 AAAAAAAGAAAAAAAAATCATGG + Intergenic
1102661238 12:114530694-114530716 CATGATAGAAAATAAAATCGTGG - Intergenic
1102682552 12:114700398-114700420 GGAAAAAGAAAATAAAAACACGG - Intergenic
1102684489 12:114714060-114714082 AAGAAAAGAAAAGAAAACCAGGG - Intergenic
1103104648 12:118213011-118213033 CACAAAAGAAAATAAACTCAGGG + Intronic
1103374260 12:120443036-120443058 GAGAAAAGACAATAGAATTAGGG + Intronic
1103501799 12:121408857-121408879 GCAAAGAGCAAATAAAATCAAGG + Intronic
1103537112 12:121640734-121640756 AAGAAAAGAAAAGAAAATCGAGG + Intronic
1103786307 12:123435985-123436007 GAGAAGAGAAAAGAAAAGGAAGG + Intronic
1104132242 12:125905411-125905433 GTAAATATCAAATAAAATCATGG + Intergenic
1104190038 12:126472252-126472274 AAGAATAAAAAATAAAAAGAAGG + Intergenic
1104336927 12:127906977-127906999 GAAAATAGAAAAAAAAAAGAGGG + Intergenic
1105403549 13:20115783-20115805 GACCATAGAAAATAAAATAAAGG + Intergenic
1105522223 13:21141080-21141102 GAGAAATGAAATTGAAATCAGGG - Intronic
1105724287 13:23146331-23146353 GAAGACAGAAAATAAAAGCAAGG + Intergenic
1105832315 13:24174564-24174586 GATAATAAAAAATAAAATAAAGG - Intronic
1105933303 13:25072795-25072817 GAAAATACAAACAAAAATCAAGG + Intergenic
1106077992 13:26477113-26477135 GAAAATAGAAAAAAAAATTCAGG - Intergenic
1106083289 13:26518326-26518348 GGAAATAAAAAACAAAATCAAGG - Intergenic
1106155932 13:27156219-27156241 GAAAAAAAAAAAAAAAATCAAGG + Intronic
1106395495 13:29376515-29376537 GAGAATAGAAAATAATAAAATGG + Intronic
1106626196 13:31423409-31423431 TAAAATAAAAAATAAAAGCAAGG - Intergenic
1106847789 13:33755345-33755367 GATAATGGGAAATAAAATCCAGG - Intergenic
1107006977 13:35622952-35622974 GAAAATAGAAATTAGAATGAGGG + Intronic
1107186021 13:37521682-37521704 TAGAATAGAAAATATTACCAGGG - Intergenic
1107248602 13:38328411-38328433 GTGAATAGAAAAGAAAATTCAGG + Intergenic
1107275344 13:38671925-38671947 GAAAGTAGAAAAGAACATCAGGG - Intergenic
1107651670 13:42551557-42551579 AAGAAAAGAAAAGAAAAACATGG - Intergenic
1107725726 13:43297204-43297226 GAGAGTATAAAAAAGAATCACGG - Intronic
1107788543 13:43977975-43977997 GAGAAGAGAAAAAAAAAGGAAGG - Intergenic
1107803691 13:44134220-44134242 AAAAAAAGAAAAAAAAATCATGG - Intergenic
1108045696 13:46382433-46382455 GAAAAGAAAAAAAAAAATCAAGG + Intronic
1108132268 13:47315298-47315320 GAGAATAAAAAGTCAAATCATGG + Intergenic
1108190090 13:47929456-47929478 AAGAATAGAAAAGAAAGGCAGGG + Intergenic
1108232238 13:48358335-48358357 GAAAACAGAACATCAAATCAGGG - Intronic
1108494683 13:51013272-51013294 CACAATAGAGAAAAAAATCAGGG - Intergenic
1108917006 13:55626846-55626868 GAGAAAAGACAATGAAATTATGG + Intergenic
1108951634 13:56101074-56101096 CTGAATAGAAAATAAATACACGG - Intergenic
1108966562 13:56312686-56312708 GAGACGAGAAAATCAAGTCAGGG + Intergenic
1109040680 13:57331992-57332014 GAGAGTAGATAATAGAGTCATGG - Intergenic
1109339387 13:61035942-61035964 GAAAATTAAAAGTAAAATCATGG - Intergenic
1109387046 13:61644087-61644109 GAGAATAAAAAATAAAAATTTGG - Intergenic
1109553706 13:63941493-63941515 AAAAATTAAAAATAAAATCATGG - Intergenic
1109940246 13:69352512-69352534 GAGAATAAATAAGAAAATTATGG + Intergenic
1110115425 13:71809189-71809211 GTGAAAAGAAAATAAAGACAGGG + Intronic
1110274446 13:73628075-73628097 AAGAAAAGAAAATAAGCTCAGGG - Intergenic
1110493914 13:76142776-76142798 AATAATAGAAAATAATACCAGGG + Intergenic
1110691864 13:78440248-78440270 AAAAATATAAAATAAAATAAAGG + Intergenic
1110823388 13:79942741-79942763 GATAAAAGAAAATAAAATAATGG - Intergenic
1110831346 13:80035160-80035182 GAAAATAGATAATAAATTCTGGG - Intergenic
1110933900 13:81258843-81258865 AAGAATAGAAAATGAGATAATGG + Intergenic
1111046588 13:82821544-82821566 AAGAAAAGAAAAGAAAACCATGG + Intergenic
1111105509 13:83640950-83640972 GTGAAAGGAAAATAAAATCTTGG + Intergenic
1111188084 13:84769945-84769967 GAGAAGAAAGAATAAATTCAAGG + Intergenic
1111213542 13:85112245-85112267 GAGAATATAAAATATATTTAAGG + Intergenic
1111244221 13:85514435-85514457 CAGAAAAGAAAAAAAAATGATGG + Intergenic
1111341114 13:86887464-86887486 AAGACGAGAAAATACAATCATGG + Intergenic
1111393436 13:87630420-87630442 AAAAATACAAAATAAAATGAAGG + Intergenic
1111504587 13:89170697-89170719 CCCAATATAAAATAAAATCAGGG + Intergenic
1111704488 13:91731514-91731536 AATAAAAGAAAATAAAATAAAGG - Intronic
1111719736 13:91926911-91926933 GATCATAAAAAATATAATCATGG - Intronic
1111833650 13:93360505-93360527 GAGCCTATAAAATAATATCATGG + Intronic
1112043494 13:95572104-95572126 GAGGATACCAATTAAAATCAGGG - Intronic
1112048579 13:95622530-95622552 GGAAACAGAGAATAAAATCAGGG + Intronic
1112190035 13:97167776-97167798 GAAAATAGAAAATGAGGTCAGGG + Intergenic
1112529110 13:100183295-100183317 CAGAAGACAGAATAAAATCATGG + Intronic
1112597303 13:100819283-100819305 GAGAATGTAAAATAAAATTTAGG + Intergenic
1112614802 13:100992927-100992949 GAAAAGAAAAACTAAAATCAGGG + Intergenic
1112756745 13:102643522-102643544 AAAAATAGAAAATCTAATCAGGG + Intronic
1112893702 13:104270734-104270756 GAGAAAAGAAAAAAACATCAAGG - Intergenic
1112990825 13:105512341-105512363 GAGATTAAAAAAAAAAATCAGGG + Intergenic
1113114457 13:106860331-106860353 AAGAATAGAAAATGTAATAAAGG - Intergenic
1113787179 13:113008424-113008446 GAGAATTAAATATAAAAACATGG - Intronic
1113892974 13:113746116-113746138 GTGAAAGGAAAATAAAATCTGGG + Intergenic
1113924416 13:113932796-113932818 AAGAAGATAAGATAAAATCATGG - Intergenic
1114739533 14:25081055-25081077 GAGAAAAGAAAAGAAAAAGAAGG - Intergenic
1114778815 14:25515708-25515730 GTGAATGGACAATAAAGTCAAGG - Intergenic
1114849129 14:26361283-26361305 GGGAATAGACATTAAAATCTTGG + Intergenic
1115040959 14:28926597-28926619 GAGAATAAAAACACAAATCATGG - Intergenic
1115232491 14:31176629-31176651 AAGAAAAGAAAAAAGAATCAGGG + Intronic
1115688532 14:35821628-35821650 GAAAATACAAAATAAAGTCATGG - Intergenic
1115726320 14:36220631-36220653 GAAAATTGAAAAATAAATCAAGG + Intergenic
1115758792 14:36557137-36557159 GAGAAAAGAAAAAGAAATAAAGG - Intergenic
1115975148 14:38989122-38989144 AAGAAAAGAAAATAAAAGAAAGG + Intergenic
1116057415 14:39880919-39880941 GAAAATAGAAAGTAAAATTTAGG - Intergenic
1116080437 14:40163941-40163963 CAGACAAGAAAATAAAATAAAGG + Intergenic
1116634657 14:47379540-47379562 GAAAACAGAAAATAAAAACAGGG + Intronic
1116832905 14:49740119-49740141 GGGAAAAGAAAATGAAATAATGG + Exonic
1116846496 14:49869203-49869225 GAGAATAGAAAGTCAAAGAAAGG - Intergenic
1117106916 14:52407387-52407409 AAGAAAAGTAAATAAAAACATGG + Intergenic
1117381464 14:55167982-55168004 GAGAACAGAAAAAAAAATTGGGG - Intronic
1117549016 14:56815871-56815893 AAGAAAAGAAAATGAAAGCAAGG + Intergenic
1117826410 14:59708775-59708797 GAGAATTAAAAATAGAACCATGG + Intronic
1118274712 14:64375402-64375424 GAGAGTAGAAAAAAAAATTGAGG + Intergenic
1118581419 14:67303447-67303469 GAATATAGATCATAAAATCATGG + Intronic
1118588508 14:67380321-67380343 TTGAATAGAAAAAAAAAACATGG - Intronic
1118795250 14:69137724-69137746 GAAACTAGAAAGTGAAATCATGG - Intronic
1119135607 14:72215949-72215971 GAGTATAGAAAATAAAGTAGGGG - Intronic
1119201851 14:72759273-72759295 CAGAAAAGAAAAAAAAATAATGG + Intronic
1119789435 14:77336653-77336675 GGGAAAACAAAATAAAATTAGGG - Exonic
1119829212 14:77685984-77686006 CAGAAGAGAATATAAAATGAGGG - Intronic
1120070740 14:80099533-80099555 GGGAATAGACATTGAAATCAAGG - Intergenic
1120210024 14:81624740-81624762 AAGAAAATAATATAAAATCAGGG - Intergenic
1120300804 14:82704170-82704192 GAAAACAGAAAAAAAAAACAGGG - Intergenic
1120454480 14:84715069-84715091 AAAAATAGAAAATATAAACATGG + Intergenic
1120582896 14:86276059-86276081 TAGAATAGAAAAAAAAATCAAGG + Intergenic
1120628808 14:86863429-86863451 AAAAATAGAAAGTAAAGTCATGG + Intergenic
1120639269 14:86990436-86990458 GAGTATACAGAATTAAATCAGGG + Intergenic
1120811821 14:88811767-88811789 GAGAAAAGAAAAGAAAAGAAAGG - Intergenic
1121062515 14:90927179-90927201 TAGATAAGTAAATAAAATCAGGG + Intronic
1121145536 14:91578911-91578933 GAGATAAGGAAATAAAAGCAGGG + Intergenic
1121496539 14:94395666-94395688 GGGAAGAGAAAAAAAAAGCAAGG - Intergenic
1121609567 14:95267976-95267998 GAAAATAGAAAATGAATTTATGG + Intronic
1121920666 14:97877903-97877925 GAGAATAGAAAAATAATTCATGG + Intergenic
1122330308 14:100907553-100907575 GAGAATAGAAATTGCTATCATGG - Intergenic
1122572139 14:102712170-102712192 AATAAAAAAAAATAAAATCAAGG - Intronic
1123031557 14:105454189-105454211 GAGAATAGAAGAAGAAATCCTGG - Exonic
1123141339 14:106082162-106082184 GAGAAAATGAAGTAAAATCATGG + Intergenic
1123194162 14:106600641-106600663 GAGAAAATGAAGTAAAATCATGG + Intergenic
1123199765 14:106651497-106651519 GAGAAAATGAAGTAAAATCAGGG + Intergenic
1123222103 14:106866919-106866941 GAGAAAATGAAGTAAAATCATGG + Intergenic
1123489738 15:20771350-20771372 GGAAATAGAAAAAAAAATAAGGG - Intergenic
1123546237 15:21340437-21340459 GGAAATAGAAAAAAAAATAAGGG - Intergenic
1124411667 15:29442436-29442458 AAGAATAAAAATTAGAATCAGGG - Intronic
1124414558 15:29464457-29464479 ATGAAGAGAAAATCAAATCATGG + Intronic
1124588162 15:31029446-31029468 GAGGAAAGAAAATAAGATGATGG + Intronic
1125109636 15:36015683-36015705 GACAATAGAAAATAACTGCATGG + Intergenic
1125112045 15:36045811-36045833 GATAAAAAAAAAAAAAATCAAGG + Intergenic
1125367741 15:38937014-38937036 TAGAATGAAAAGTAAAATCAAGG - Intergenic
1125861891 15:43007151-43007173 GAAAATAGAAAATAATGCCATGG - Exonic
1126029269 15:44480231-44480253 GAGAACAGCAAATGAAATAAGGG - Intronic
1126043079 15:44611738-44611760 GAGAACAGAAAATTAAATAATGG + Intronic
1126427447 15:48544477-48544499 GAATAAAGAAAATAAAATCAGGG - Intronic
1126724442 15:51617233-51617255 AAGAACAGAAACTAAAATAAAGG + Intronic
1126828772 15:52577964-52577986 GAGACTGGAAAATCAACTCAGGG + Intergenic
1127050080 15:55073090-55073112 GAGAAAAGTCAATGAAATCAAGG + Intergenic
1127191760 15:56538564-56538586 AAAAATAGAAAAGAAAAACATGG + Intergenic
1127223897 15:56910394-56910416 AAGATTAGAAAAGAAAATTAAGG + Intronic
1127695125 15:61438432-61438454 GGGAATTGAAAATATGATCAAGG + Intergenic
1127712443 15:61613236-61613258 AAGAATAGAAAATAATTTGAAGG + Intergenic
1127729956 15:61790679-61790701 GAGAAGAGAAAATAAAAGAGGGG - Intergenic
1127796310 15:62441481-62441503 GAGAGTAGGAAATAATATCTTGG - Intronic
1127923692 15:63517032-63517054 TATAATAAAAAAAAAAATCAAGG - Intronic
1127940155 15:63687041-63687063 GAGAAGAAGAAATCAAATCATGG + Intronic
1128719122 15:69933086-69933108 GAGAATAGAAAAAAAAATGAGGG - Intergenic
1128727178 15:69996883-69996905 GAGAAAAGAAAAAAAAAAAAAGG - Intergenic
1129064946 15:72894356-72894378 GAAAATAGAAAATAAAATTAGGG - Intergenic
1129306083 15:74664155-74664177 GAGAACATAAAATAAATGCAAGG + Intronic
1129469826 15:75745930-75745952 GAAAATAAAAAATAGAAACAGGG + Intergenic
1129948369 15:79562017-79562039 GAAAAAAGCAAATAAAACCAGGG + Intergenic
1130550966 15:84889623-84889645 AAGAAAAGAAAAGAAAAACATGG - Intronic
1130895172 15:88164428-88164450 GAGAATAAGGAGTAAAATCAGGG - Intronic
1131581564 15:93648346-93648368 AAGAATAGAAAATAACAGTAAGG + Intergenic
1131671820 15:94627801-94627823 GAGAAAAGAAAAGATAGTCAAGG - Intergenic
1131823533 15:96296895-96296917 AACAATAGAAAAAAAAAGCATGG + Intergenic
1132162871 15:99559044-99559066 ATGAAAAGAAAATAAACTCAAGG + Intergenic
1132172375 15:99673641-99673663 GAAAATAGAAAATAGAAAAAAGG + Intronic
1132348421 15:101122297-101122319 GAGAAAAGAAATAAAAAGCAGGG + Intergenic
1132395750 15:101472831-101472853 GAAAATAGAAAATACATCCAGGG + Intronic
1202954564 15_KI270727v1_random:67653-67675 GGAAATAGAAAAAAAAATAAGGG - Intergenic
1132832573 16:1936049-1936071 AAGAAAAGAAAAAAAAAGCAGGG - Intergenic
1133182317 16:4066330-4066352 GAGAAAAGTAAATATACTCAAGG - Intronic
1133634021 16:7649214-7649236 GATAAAAAAAAATAAGATCATGG + Intronic
1133712478 16:8414657-8414679 GAAAAAATAAAATAAAATAAAGG - Intergenic
1133864306 16:9627383-9627405 GAAAAAAGAAAATAAAAGCAAGG + Intergenic
1134076899 16:11298206-11298228 TAGAATAAAAAATAAAAGCCAGG + Intronic
1134894843 16:17875861-17875883 GAGATTATAAACCAAAATCAAGG - Intergenic
1135476408 16:22779949-22779971 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476411 16:22779979-22780001 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476414 16:22780009-22780031 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476423 16:22780075-22780097 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476433 16:22780141-22780163 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476436 16:22780171-22780193 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476439 16:22780201-22780223 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476448 16:22780267-22780289 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476451 16:22780297-22780319 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135476460 16:22780363-22780385 GAGAAAAGAGAAAAAGATCAAGG + Intergenic
1135536838 16:23301605-23301627 GAGAAGAGAAAAGAAAAGGAAGG + Intronic
1135728351 16:24874487-24874509 GAGAATATAAAATGTAACCAAGG - Intronic
1136053994 16:27674367-27674389 AATAATAAAAAATAAAATCAAGG + Intronic
1137356365 16:47769235-47769257 GAGAAAAAAAAAAAAAAGCAGGG + Intergenic
1137377080 16:47961389-47961411 GTGAAGGGAAAATAAAACCAGGG + Intergenic
1137411446 16:48231698-48231720 GAGAAAAGAAAAAAAATTCAAGG + Intronic
1137420769 16:48331862-48331884 GAGAATTAAAAATAAAATCCTGG - Intronic
1137448540 16:48549119-48549141 GATAATAAAAAATAAATTAAGGG + Intronic
1137908142 16:52347059-52347081 ATGAATTGAAAATAAAATTAGGG + Intergenic
1138111716 16:54329553-54329575 AAGAATAGAAAAGGAAAGCAGGG - Intergenic
1138164411 16:54787447-54787469 GGGAAAAGAAAAAAAAAACAAGG + Intergenic
1138303052 16:55948674-55948696 GTGAAAGGAAAATAAAATCTTGG - Intronic
1138358438 16:56405365-56405387 AAGCAGAGAAAATAAAATAATGG - Intronic
1138734689 16:59236834-59236856 CAGAAGTGAAATTAAAATCAAGG + Intergenic
1138874488 16:60932890-60932912 GAGAAGAGAAAAGAAAAGGAGGG - Intergenic
1138882702 16:61034462-61034484 GAGAATAAAAATGATAATCAGGG - Intergenic
1139100007 16:63754154-63754176 TAGAAAAAAAAATAAAATCTTGG + Intergenic
1139290127 16:65850228-65850250 CAGAAAAGAAAAGAAAATTAAGG - Intergenic
1139496614 16:67325039-67325061 GAGAACAGAAAGCAGAATCAAGG - Intronic
1139693072 16:68653662-68653684 AAGAAAAGAAAAGAAATTCAGGG - Intronic
1139783570 16:69371847-69371869 AAGAAGAAAAAATAAAAGCAGGG + Intronic
1139984450 16:70886533-70886555 AATAACAGAAGATAAAATCATGG - Intronic
1140442949 16:75000515-75000537 GTGAAAATGAAATAAAATCAGGG + Intronic
1140871183 16:79108060-79108082 GATAATAGATAAGACAATCAAGG - Intronic
1142454980 16:90215221-90215243 GAGAACAGAAAATAAATCCTGGG - Intergenic
1142553441 17:754989-755011 GTGAAAGGAAAATAAAATCTTGG + Intergenic
1142656960 17:1400596-1400618 GAAAAAAGAAAAGAAAACCAGGG - Intergenic
1142920966 17:3185418-3185440 GACAATGGAAAATAAAAATAAGG + Intergenic
1143196719 17:5081481-5081503 AAGGATACAAAATAAAGTCAAGG - Intronic
1143334537 17:6162430-6162452 GAAAATAGAAAGAAAAATAAAGG - Intergenic
1143838552 17:9712407-9712429 GAGAATGGCAAAGAGAATCAGGG + Intronic
1144039330 17:11394978-11395000 AAGAAAAGAAAAAAAAATAAAGG - Intronic
1144159606 17:12544624-12544646 GAGAATAGTAACTGAGATCAGGG + Intergenic
1144172136 17:12668194-12668216 GAGAAATCAAAATAAAGTCAAGG - Intronic
1144275219 17:13660012-13660034 GAAAAAATAAAATAAAATAAAGG + Intergenic
1144789375 17:17848869-17848891 GAGCAGAGAAAATGAAATTAGGG + Intronic
1145095696 17:20023804-20023826 GAAAATAAAAAAAAAAAACATGG + Intronic
1146009598 17:29182933-29182955 GAGAATAGCAAATTAAAGCCAGG + Intergenic
1146009628 17:29183252-29183274 GAGAATAGCAAATTAAAGCCAGG + Intergenic
1146073527 17:29706409-29706431 ATGAAAACAAAATAAAATCAAGG - Intronic
1146759283 17:35462081-35462103 GAAAGTTGAAAATAAAATGATGG - Intergenic
1147412246 17:40262055-40262077 GAGAAAAGAAAAGAAAAGAAAGG - Intronic
1147473167 17:40683772-40683794 AAAAAGAGGAAATAAAATCAAGG - Intergenic
1147646127 17:42035140-42035162 GAGAAGAGAAAAGAAAAGAAAGG + Intronic
1147768133 17:42850393-42850415 GAGAATAGAAAGTAGAAACAGGG - Exonic
1148050066 17:44765588-44765610 GAGAAAAGAAAAGAAAAACCAGG - Intronic
1148592899 17:48830117-48830139 GAAAAAAGAGAATAAACTCATGG - Intergenic
1148609504 17:48955103-48955125 AATAAAATAAAATAAAATCAGGG - Intergenic
1148640648 17:49184771-49184793 CACAATAGAAAAGAAAATCCTGG + Intergenic
1148833449 17:50451749-50451771 AAAAAAATAAAATAAAATCAAGG - Intronic
1148882283 17:50738636-50738658 AAGATTTGAAAATAAAATTAAGG + Intronic
1149287339 17:55179308-55179330 GAGCATGGAAAAAAAAATAAAGG + Intergenic
1149346760 17:55746045-55746067 AGAAATAGAAAATAAAATCCTGG + Intergenic
1149483220 17:57020202-57020224 GTGAAAAGAAAATAAAAACTTGG + Intergenic
1149618685 17:58024359-58024381 AAGAAAAGAAAAGAAAATTAGGG + Intergenic
1149698072 17:58632751-58632773 GGGAATCGAAAATTAAAGCAGGG + Intronic
1150029018 17:61711895-61711917 AAAAATAAAAAATAAAATGATGG + Intronic
1150114635 17:62535792-62535814 GAAAAAAGAAAAAAAAGTCATGG + Intronic
1150140198 17:62721833-62721855 AACAAGAGAAAAAAAAATCAGGG - Intronic
1150453201 17:65286761-65286783 TAGATTTGAAGATAAAATCAAGG - Intergenic
1150749936 17:67851531-67851553 GAGAATAGAATAGAAAATGTTGG + Intronic
1150931836 17:69593345-69593367 CAAAAAAGAAAAAAAAATCATGG - Intergenic
1151240850 17:72756822-72756844 GAGAAAAAAAACTAAAATGAAGG + Intronic
1151712765 17:75816304-75816326 GAGAATGGAAAATAAATCGAGGG + Intronic
1151780625 17:76242569-76242591 TAGAATAGTAAAGAAAAACAAGG + Intergenic
1152974211 18:197736-197758 AAAAATAAAAAAAAAAATCAAGG - Intronic
1152984102 18:306454-306476 GAGAAAAAAAAAAAAAAGCAGGG - Intergenic
1153005042 18:490456-490478 GGGAATGGAAAATGAAATGAAGG + Intronic
1153146349 18:2037383-2037405 AAGAAAAGAAAAGAAAATGAAGG - Intergenic
1153146405 18:2037714-2037736 GGAAATAGAAAATAAAATGAAGG - Intergenic
1153148513 18:2061063-2061085 GGAAATAGGTAATAAAATCAAGG + Intergenic
1153240599 18:3028197-3028219 GAAAAAAGAAAAAAAAATCATGG - Intergenic
1153309258 18:3662014-3662036 GAAAATAGAAAATATACCCAAGG + Intronic
1153380200 18:4429761-4429783 GATAATAGAAAAAAAAAGCCAGG + Intronic
1153399117 18:4662968-4662990 GTAATGAGAAAATAAAATCACGG + Intergenic
1153467757 18:5408251-5408273 GAAAAAAGAAAAGAAAATCAAGG - Intronic
1153524477 18:5981217-5981239 TCAAATAGAAAATAAAATTAAGG + Intronic
1153734566 18:8051748-8051770 AAGAATAAAAAAGAAAAGCAAGG - Intronic
1153801335 18:8673206-8673228 GAGAAAAGAAAATCCTATCAAGG + Intergenic
1154128421 18:11714831-11714853 GTGAAAGGAAAATAAAATCTCGG - Intronic
1154262143 18:12844494-12844516 GAAAATGCAAATTAAAATCATGG - Intronic
1154289077 18:13090475-13090497 AAAACTAGAAAATAAAAACAGGG - Intronic
1154318466 18:13325243-13325265 GTGAAAGGAAAATAAAATCCTGG - Intronic
1154323523 18:13373201-13373223 GAGAAAAGGAAATCAAAACAAGG - Intronic
1154342793 18:13518032-13518054 AAGAAAAGAAAAGAAAGTCATGG - Intronic
1154422568 18:14247268-14247290 GACACTAGGAAATAAAAGCAGGG + Intergenic
1154481552 18:14831269-14831291 GAGAACAAAAAACAAAATCTGGG - Intronic
1155036168 18:22026638-22026660 TGGACTAGAAAATGAAATCAGGG + Intergenic
1155445766 18:25911658-25911680 GAGAAGACAAAAAAAGATCAGGG - Intergenic
1155448005 18:25932552-25932574 GTTTATAGAAAATGAAATCAAGG + Intergenic
1155464934 18:26123679-26123701 AAGATTAAAAAAAAAAATCAAGG + Intergenic
1155511089 18:26578033-26578055 AAGAAAAGAAAAGAAAAGCAAGG - Intronic
1155692138 18:28637947-28637969 GAGCAAATAAAAGAAAATCAAGG - Intergenic
1155987075 18:32241501-32241523 GTGAAAGGAAAATAAAATCCTGG + Intronic
1156135060 18:34027587-34027609 GAGTTTAGAAAATAGAATAAAGG - Intronic
1156143767 18:34149660-34149682 GAGAATAGAAAGACAAATTATGG - Intronic
1156296754 18:35799222-35799244 GAGACTATAAAATAAAATTGTGG - Intergenic
1156332659 18:36139033-36139055 GAGTATAGAACATAAAGTTAAGG + Intronic
1156490979 18:37495911-37495933 GAGAATAGATCATAACAGCAAGG + Intronic
1156726085 18:40129211-40129233 GAAAATAGAAAAAAAAAAAATGG + Intergenic
1156745897 18:40390706-40390728 TAGATAAGAAAATATAATCAGGG - Intergenic
1156766806 18:40666352-40666374 GAGAAGAGTGAATAAAAGCAGGG + Intergenic
1156913951 18:42443541-42443563 GAGTAAAGAGAAGAAAATCAGGG + Intergenic
1157078550 18:44495812-44495834 GATAAGGGAAAGTAAAATCAAGG - Intergenic
1157241245 18:46011296-46011318 AAGAATTAAAAAAAAAATCAAGG + Intronic
1157405318 18:47417786-47417808 GAAAAGAGAAAAGAAAGTCACGG - Intergenic
1157828449 18:50833940-50833962 GTGCACAGAGAATAAAATCAGGG - Intergenic
1157865741 18:51182752-51182774 AAGAAAAGAAATTAAAATGAAGG + Intronic
1157956379 18:52102007-52102029 AAGAAAAAAAAATAAAATAAAGG - Intergenic
1157988813 18:52471048-52471070 GAGAATAGAATATCAACTCCTGG + Intronic
1158048481 18:53186676-53186698 TGGGATAGAAAATAAAATAAGGG + Intronic
1158062165 18:53357898-53357920 GAAATTATAAAATAATATCAAGG - Intronic
1158172823 18:54618170-54618192 GAGAATAGAAAATTAAAGTGAGG + Intergenic
1158237993 18:55340674-55340696 TAGAATAGAAACTAAGACCAGGG - Intronic
1158541149 18:58355606-58355628 GAGAAAAGAAAACCAAATAAAGG - Intronic
1158651528 18:59292139-59292161 ACTAATAGAAAATAAAATCCAGG - Intronic
1159165754 18:64697106-64697128 GATAAAAGAAAATAAAATTGAGG - Intergenic
1159185639 18:64969340-64969362 AAAAATAGAAAATAATATTATGG - Intergenic
1159274381 18:66196459-66196481 CTGAATAGAAAATAATATTAAGG + Intergenic
1159420749 18:68216422-68216444 GAAAATAAAAAAAAAAATGAGGG - Intergenic
1159503302 18:69301514-69301536 GAGAAGAGTAAATAAATTCCAGG - Intergenic
1159618372 18:70608636-70608658 AAAAATAGATATTAAAATCAAGG - Intergenic
1159804360 18:72938197-72938219 GAAAGAAGAAAAAAAAATCAAGG - Intergenic
1159805210 18:72948665-72948687 GAGAAAAGAAAGTAATATTAGGG + Intergenic
1159826407 18:73217372-73217394 GAGCAGAGAAAGCAAAATCAAGG - Intronic
1159934538 18:74352203-74352225 TAGAATAGAAAGTAAAATAGAGG + Intronic
1159991795 18:74917341-74917363 TATAATAGAACATAAAAACACGG + Intronic
1160091521 18:75831733-75831755 GAGAATAGAAACTTAAATTATGG + Intergenic
1160111451 18:76036096-76036118 GAAACAAGAAAATAAAATTAAGG - Intergenic
1160278777 18:77466371-77466393 GAAAACACAAAATAAAACCACGG - Intergenic
1161118038 19:2510358-2510380 AAGAAAAGAAAAGAAAATCTAGG - Intergenic
1161157972 19:2744044-2744066 GAAAATACAAAATAAAACAAGGG + Intergenic
1161285472 19:3466200-3466222 AACAAAAGAAAATAAAATCAAGG - Intronic
1161539034 19:4838567-4838589 AAAAAAAGAAAAAAAAATCAGGG - Exonic
1161628703 19:5340634-5340656 CAAAAAAAAAAATAAAATCATGG - Intronic
1162287798 19:9752661-9752683 GAGAATAGAAAAAAAAAAAAGGG - Intronic
1162629908 19:11919195-11919217 GAGAATAAAAAAGAAAAACAAGG - Intergenic
1163260207 19:16185103-16185125 TAAAAAAGAAAAAAAAATCAAGG + Intergenic
1163663366 19:18591610-18591632 GAAAAAAGAAAAGAAAATAAAGG - Intronic
1163876890 19:19878229-19878251 GATAATAGAGCATAAAATTAAGG - Intronic
1163902523 19:20117377-20117399 GAGAAAAGAAAAGAAAAGAAAGG - Intronic
1164086207 19:21904857-21904879 GAAAGTAGAACATAAAATCTTGG - Intergenic
1164224680 19:23232522-23232544 GATAATAAAATATAAAATTAAGG + Intronic
1164455710 19:28404905-28404927 ATGAAAAGAAAATAAAATCTCGG - Intergenic
1164791985 19:30994625-30994647 CAGAATAGAAAAAACAATCTTGG - Intergenic
1164863745 19:31585927-31585949 GAGAATAGAAAATATTTTAAAGG + Intergenic
1164947797 19:32310944-32310966 AAGAAAAGAAAAGAAAAGCACGG + Intergenic
1165001862 19:32770328-32770350 GAAAATAGAAAGGAAAATTACGG - Intronic
1165183168 19:33990329-33990351 GATAAAATAAAATAAAATAAAGG + Intergenic
1165351465 19:35278182-35278204 GAGGAAAAAAAACAAAATCACGG + Intronic
1165872072 19:38980176-38980198 AAGAAAAGAAAAAAAAATTAGGG - Intergenic
1165876553 19:39011812-39011834 AAAAAAAGAAAAGAAAATCAGGG - Intronic
1165998183 19:39860321-39860343 GAAAAAAGAAAAGAAAAACATGG - Intergenic
1166192541 19:41184680-41184702 GAGTATAAAAAAGCAAATCAAGG + Intergenic
1166400317 19:42474098-42474120 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1167062306 19:47157207-47157229 GTGAATAGACACTAAAATTAGGG - Intronic
1167548339 19:50142635-50142657 AAAAATAAAAAATAAAATTAGGG - Intergenic
1168142503 19:54398474-54398496 AGAAATAGAAAATAAAATCTTGG - Intergenic
925020002 2:561183-561205 GAGAAAGGAAAAGAGAATCAAGG - Intergenic
925479673 2:4256164-4256186 GAGAATCAAAAATCAAAACAAGG + Intergenic
925604658 2:5646825-5646847 TAGAATAGAAAATAGAAGAAAGG + Intergenic
925711176 2:6741879-6741901 CAAAATAGAAAAAAAAAACAAGG + Intergenic
925729720 2:6910574-6910596 GGGAATAAAAAATAAAAATAGGG - Intergenic
925858131 2:8150188-8150210 GAGACTGGAAAATAAGATGAAGG - Intergenic
926144399 2:10387880-10387902 GAGAAAAGAAAAGAAAAGAAAGG - Intronic
926677028 2:15633727-15633749 GAGCATAGAAAACCAAATAAAGG + Intergenic
926817044 2:16808754-16808776 GAAAACAAAAAATAAAATGAGGG + Intergenic
927205260 2:20604974-20604996 GAGAAAAGGAAAAAGAATCATGG + Intronic
927220581 2:20704782-20704804 GAGAAAAGAAAATCAAGTAAAGG - Intronic
927245585 2:20955064-20955086 AAGAAAAGAAAATAAAAGAAAGG - Intergenic
927261065 2:21090808-21090830 GGAAAAACAAAATAAAATCAAGG - Intergenic
927365337 2:22288783-22288805 GATAATAAAAAACAAAATCATGG + Intergenic
927661166 2:24994277-24994299 GATAAGAGAAAAAAAAATCAAGG + Intergenic
928003718 2:27544338-27544360 GAGACTAGAAAATAACATGAGGG - Intronic
928040231 2:27868020-27868042 CAAAATAGAAAATAAAATATTGG - Intronic
928072079 2:28227133-28227155 GAGATTAAAAAAAAAAATCTGGG - Intronic
928738409 2:34320547-34320569 GAAAAAAGAAAAAAAATTCATGG - Intergenic
929083319 2:38143096-38143118 GAAAATAGAAAATAACATTATGG - Intergenic
929107866 2:38381480-38381502 AAGAAAAGAAAAAAAAATCAAGG + Intergenic
929193203 2:39158984-39159006 TAGAATAGATGATAAAACCAGGG - Intergenic
929244166 2:39684130-39684152 CAGAGGAGAAAATAAAAACATGG - Intronic
929449031 2:42024415-42024437 AAAAATAAAAAATAAAATAAAGG + Intergenic
929653819 2:43709021-43709043 GAATATATTAAATAAAATCAAGG - Intronic
929899025 2:45985628-45985650 GAGAATTGGAAATAAGATCAGGG + Intronic
929926129 2:46211355-46211377 GAGATTAAAAAAAAAAATCTAGG - Intergenic
930263308 2:49171583-49171605 GATAATCAAAATTAAAATCAGGG + Intergenic
930356449 2:50327155-50327177 GAGAATAAATAATCAAATCGTGG + Intronic
930603818 2:53471993-53472015 TACAATAGAAAATAGCATCAAGG + Intergenic
931191527 2:60005323-60005345 GGGAATAGAAAATAGAATATAGG - Intergenic
931227632 2:60347321-60347343 GAGAACAGAAAAACAAATTATGG + Intergenic
931379063 2:61735327-61735349 AAAAAAAGAAAAAAAAATCAAGG + Intergenic
931527713 2:63175808-63175830 GAGAATGGAAAAACAAAGCATGG - Intronic
931543791 2:63358240-63358262 TAAAAAAGAAAAAAAAATCATGG + Intronic
931650387 2:64463209-64463231 GAGAAGAGAAAGTTAAGTCAGGG - Intergenic
931692802 2:64849638-64849660 GACAAGCAAAAATAAAATCAAGG - Intergenic
931894875 2:66717539-66717561 AAGAATAGAAAATACATTCTTGG + Intergenic
932236610 2:70125443-70125465 GAAAAGAAAAAAGAAAATCAAGG - Intergenic
932402425 2:71490285-71490307 GAGAAAAGAGAAGAAATTCATGG - Intronic
932510456 2:72282697-72282719 AAAAATTGAAAATAAAATGATGG + Intronic
932600389 2:73120351-73120373 AACAATTGAAAATAAAATTAAGG + Intronic
932998397 2:76886097-76886119 CTGAATAGAAAATCAAAGCAAGG + Intronic
933019463 2:77173212-77173234 GACCAAAGAAAATGAAATCATGG - Intronic
933046357 2:77541517-77541539 AAAAAAAGAAAAAAAAATCAAGG + Intronic
933334841 2:80944529-80944551 GAGGATATAAAATATAATTATGG + Intergenic
933352043 2:81166118-81166140 GAGGATAGAACATGAAATAAAGG - Intergenic
933375016 2:81467785-81467807 GAAAATAGAAAGTAAAAGGATGG - Intergenic
933471363 2:82729897-82729919 GGGAACAGAAAATTAAATTAGGG + Intergenic
933659699 2:84917270-84917292 GTGAATAGAAAACCAAACCATGG + Intergenic
933694165 2:85204126-85204148 GAGAGGGGAAAAGAAAATCAAGG - Intronic
933711467 2:85329119-85329141 TAGAATATATAATAAACTCAAGG + Intergenic
933878193 2:86640972-86640994 GAAAACAAAAAATAAGATCAAGG - Intronic
934012054 2:87831066-87831088 GAAAATAGTCAATAAAATAATGG + Intergenic
934914282 2:98287094-98287116 GAGAATGGAGAATAAAAAGAGGG + Intronic
935140949 2:100352427-100352449 AAGAAAAGAAAAAAAAATCAGGG + Intergenic
935278383 2:101495914-101495936 AAGAAAAGAAAAGAAAAACATGG - Intergenic
935283729 2:101544858-101544880 GTGAAAAGGAAATAAAATCTTGG + Intergenic
935314089 2:101814286-101814308 TAAAATAGAAAATAGAATCAAGG - Intronic
935429386 2:102958187-102958209 AAGAAAAAAAAAGAAAATCAGGG - Intergenic
935537037 2:104307239-104307261 GAGAATAGAGAAGAGAAACAAGG + Intergenic
935757289 2:106286136-106286158 GAAAAAAGAAAAAAAAATAATGG - Intergenic
935855268 2:107266825-107266847 GAGAAAAGAAAATGCAACCAAGG + Intergenic
935880223 2:107558001-107558023 GTGTTTAGAAAAAAAAATCATGG - Intergenic
935894926 2:107725438-107725460 GAGAAGTGAAATTAAAATCCAGG + Intergenic
935954805 2:108365349-108365371 GATATAAGAAAAAAAAATCAAGG - Intergenic
936468254 2:112773786-112773808 GAGAAAAAAATATAAAATCTTGG + Intergenic
936803670 2:116298278-116298300 GACAATAAAAAATGAAAACAGGG + Intergenic
937381199 2:121378557-121378579 GAGAATATAAAAGAAAAGCATGG + Intronic
937524134 2:122746482-122746504 TAAAATAGTAAATTAAATCATGG - Intergenic
937709560 2:124963788-124963810 AACAATAGAATATAAAATGATGG - Intergenic
937792188 2:125973622-125973644 CAGAATGGAAAAAAAAATAATGG - Intergenic
938172690 2:129094300-129094322 GAAAATCTGAAATAAAATCAAGG - Intergenic
938180079 2:129173865-129173887 AAGAATAGAAAATGAAAGCTAGG + Intergenic
938312022 2:130299036-130299058 GAGAATCCAAAGTAAAATAATGG + Intergenic
938678037 2:133658413-133658435 GAGGATGAAAAATAAAATGAAGG + Intergenic
938978866 2:136506856-136506878 TAACATAGAAAATAAAATCTGGG + Intergenic
939080723 2:137658495-137658517 GGGAATAGGAAAGAAAATCTTGG - Intronic
939107532 2:137966617-137966639 AAGAAAAGAAACCAAAATCAAGG - Intronic
939108286 2:137975516-137975538 GTGAAAGGAAAATAAAATCCTGG - Intronic
939135094 2:138284388-138284410 GAGGTTAGAAAATAAAACCAAGG + Intergenic
939212162 2:139189974-139189996 GAGAATACAGAGTATAATCAAGG + Intergenic
939555519 2:143668265-143668287 AAAAAAAGAAAATAGAATCAAGG - Intronic
939575889 2:143893957-143893979 GAGAAGAGAAAATACAATGATGG - Intergenic
939650234 2:144751962-144751984 GTGAATGGAAAAACAAATCATGG + Intergenic
939756719 2:146122598-146122620 GAGCACAAAAAAGAAAATCAAGG + Intergenic
939770943 2:146317513-146317535 TGGAAGTGAAAATAAAATCAGGG + Intergenic
939801394 2:146714571-146714593 GAGGAGAGAAAACAAAATCTTGG - Intergenic
939901210 2:147851950-147851972 CAGAGTAGGAAAAAAAATCAGGG - Intronic
939973483 2:148688998-148689020 TAGATTAGAAAAAAAAGTCACGG + Intronic
940077284 2:149756696-149756718 TAAAATAGAAAAAAAAATCCTGG + Intergenic
940083437 2:149831019-149831041 GAGAACAGAAGAAAAAATCTAGG - Intergenic
940138316 2:150464164-150464186 GAGAGTAGAAAATAATACAATGG - Intergenic
940372500 2:152918556-152918578 GAAAATAGGACATAAAGTCAAGG + Intergenic
940436210 2:153658330-153658352 GTGAATAGGAAATAACACCAGGG - Intergenic
941193968 2:162423222-162423244 GAGAGAAGAAAACAAAAGCAAGG + Intronic
941246920 2:163109892-163109914 GTGAAAGGAAAATAAAATCTCGG + Intergenic
941260852 2:163295214-163295236 GGAAAAATAAAATAAAATCATGG - Intergenic
941493648 2:166173883-166173905 GAGAGAAAAAAAAAAAATCAAGG - Intergenic
941651634 2:168098603-168098625 GGGAGCAGAAAATAAAAGCAGGG - Intronic
941724628 2:168848036-168848058 GAGAAGAGAAAATAAAAGCCAGG - Intronic
941961722 2:171260681-171260703 GTGAAAGGAAGATAAAATCATGG + Intergenic
942775423 2:179575814-179575836 AAGAATATAAACTAAAAACATGG - Intronic
943210737 2:184962596-184962618 AAGACAAGAAAATAAAATAAAGG - Intergenic
943396608 2:187345227-187345249 GAGACTATAAAATAAAATAATGG + Exonic
943402951 2:187439180-187439202 GAAAATAAAAAATAATAGCAAGG + Intronic
943417414 2:187625732-187625754 GAGAAAAGAAAAAAAAATGTTGG + Intergenic
943477804 2:188380556-188380578 AAAAATAGAAAAGAAAATCAGGG + Intronic
943542610 2:189236186-189236208 AAGGATACAAAGTAAAATCAGGG - Intergenic
943772887 2:191737757-191737779 AAGAAAAAAAAATACAATCACGG + Intergenic
943783909 2:191855306-191855328 GAAAATACAAATTAAAAGCATGG + Intergenic
943808185 2:192150468-192150490 AGGAACAGAAACTAAAATCAGGG + Intronic
943870189 2:192985439-192985461 GGTAATAGAAAATAAAACAATGG - Intergenic
944238320 2:197461190-197461212 GAGAAAAAAAAATAAACTCTTGG - Intronic
944445816 2:199787167-199787189 AAGAAAAGAAAAGAAAATTAAGG - Intronic
944448526 2:199817483-199817505 AAAAACAGAGAATAAAATCATGG + Intronic
944802655 2:203251818-203251840 AAAAATAAAAAATAAAAACAAGG + Intronic
944807152 2:203293961-203293983 AAAAATAAAAAATAAAGTCAGGG - Intronic
944922606 2:204431142-204431164 GAATAAATAAAATAAAATCAAGG - Intergenic
944961529 2:204880117-204880139 TAGTCTGGAAAATAAAATCATGG - Intronic
945096296 2:206222745-206222767 AAGAAAAGAAAAAAATATCAAGG - Intergenic
945137660 2:206645944-206645966 TAGAATAAAAAAAAAAACCATGG - Intergenic
945144862 2:206727552-206727574 GTGGATAGAATAGAAAATCAGGG - Intergenic
945392024 2:209276115-209276137 GAGAGGAGAAAAGAAAATCCTGG + Intergenic
945440514 2:209873355-209873377 TAGAATAGAAACTGAAATAAGGG - Intronic
945558683 2:211311104-211311126 CAAAATATAAAATAAAAGCATGG + Intergenic
945578657 2:211564692-211564714 TAGAAGAGTACATAAAATCAAGG + Intronic
945664323 2:212721812-212721834 GAGGACAGCAAATAAAATAAGGG + Intergenic
945777329 2:214122853-214122875 AACAATAGAATATAAAATTAAGG + Intronic
945867433 2:215191864-215191886 GAGAAGAAGAAAAAAAATCAAGG + Intergenic
945879898 2:215314492-215314514 GAGAAAAAAAAAAAAAATCTTGG - Intronic
947338796 2:229115421-229115443 GAGAAGAGAAAAAGAAATAAAGG + Intronic
947406608 2:229784127-229784149 GAGAAAAGAAAAAAAAAAAAAGG + Intronic
947442766 2:230137541-230137563 GAGAAGAGAAAATAAATGCCTGG + Intergenic
947464656 2:230331459-230331481 AAGAATAAAAAATATAACCATGG - Intronic
947977002 2:234375516-234375538 GAGAATAAAAAATAAAATGATGG - Intergenic
948146615 2:235712899-235712921 GTGAAAGGAAAATAAAATAAGGG - Intronic
948219004 2:236254634-236254656 AAGAAGAGAAAGTAAAATGATGG - Intronic
948330554 2:237161050-237161072 TAGAAGAGAATATAAAATGAAGG - Intergenic
949076605 2:242063122-242063144 GTGAACAGAAAATAAATTCGGGG - Intergenic
1169414001 20:5400222-5400244 CAGCAAAGAAAAAAAAATCAAGG + Intergenic
1169524738 20:6412058-6412080 GAGTATAGAAAAGAAAAAGAGGG + Intergenic
1169584443 20:7064923-7064945 GAATATAGAAAAAAAAAACAGGG - Intergenic
1169864085 20:10181488-10181510 CAGAAATCAAAATAAAATCATGG + Intergenic
1170028851 20:11923009-11923031 GAGCATTGAAAATAAACGCAAGG + Exonic
1170118745 20:12889569-12889591 GAGAATAAAAATGAATATCAAGG + Intergenic
1170139091 20:13107288-13107310 GAAAATAGAAAAAAAAGTCAAGG + Intronic
1170344889 20:15374064-15374086 GAGAATAGAGAATGAGATAAAGG - Intronic
1170352727 20:15459812-15459834 GAAAACAGAAAAAAAAAACAAGG - Intronic
1170825801 20:19794158-19794180 CAGAATAGAAAAGAAAAGAAAGG + Intergenic
1170877129 20:20260837-20260859 CATAAAAGAAAATAAAATCTGGG - Intronic
1170896086 20:20415721-20415743 TAGAATAAAAAATAAAAAAATGG + Intronic
1171470341 20:25365377-25365399 GTTGATAGAAAAAAAAATCAAGG - Intronic
1171540689 20:25952123-25952145 GGGAAAAGAAAAAAAAATAAAGG - Intergenic
1171843717 20:30248496-30248518 GGGAAAAGAAAAAAAAATAAAGG - Intergenic
1172075794 20:32296278-32296300 CAAAAAATAAAATAAAATCAAGG - Intronic
1172150186 20:32784985-32785007 GAAACTAGAAAATATAAGCAAGG + Intronic
1172249905 20:33471814-33471836 GAAAATAAAAAACAAAATTAGGG - Intergenic
1172363320 20:34330247-34330269 AAGAAAAGAAAATACAACCAAGG - Intergenic
1173406191 20:42767335-42767357 AAGAATAGAACAGAAAAGCAGGG + Intronic
1173431561 20:42991991-42992013 GAGAATAGAAACAAAATTCTTGG + Intronic
1173478100 20:43377306-43377328 GTGAATATAATATAAAACCAAGG - Intergenic
1174297267 20:49557576-49557598 AAGAAAAGAAAAGAAAACCAGGG + Intronic
1174867243 20:54149534-54149556 GAGAAAGGAAAAAAAAATGAAGG + Intergenic
1175728815 20:61338284-61338306 TTGAAGAGAAAAAAAAATCAGGG + Intronic
1176152151 20:63597095-63597117 GAAAATAAAAAATAAAAGAAAGG - Intronic
1176529045 21:7943998-7944020 GAGAATGGAAAAGAATATAATGG - Intergenic
1177021529 21:15865210-15865232 GACACTAGAAAATAATTTCAGGG + Intronic
1177054820 21:16288522-16288544 GAGAATACATAACCAAATCATGG + Intergenic
1177180170 21:17736311-17736333 GAGAAGAGAAAGCAAAACCAGGG - Intergenic
1177202563 21:17974064-17974086 GAGAAGTGAAAATAGAAACAAGG - Intronic
1177227097 21:18271580-18271602 AAGAAAAGAAAAGAAAATTAAGG - Intronic
1177253887 21:18634334-18634356 GAAAACAGAAAAAAAAAGCAGGG + Intergenic
1177368273 21:20167699-20167721 GAGAAGAGAAAAGAGAAGCAGGG + Intergenic
1177432132 21:21003697-21003719 GTGATTAGAAAAAAATATCAAGG + Intronic
1177456001 21:21340663-21340685 GAGTATAGAAAAATAAGTCAAGG - Intronic
1177467148 21:21500121-21500143 AAGAATATAAAATTCAATCATGG + Intronic
1177498680 21:21921716-21921738 GCGATTAAAAAAAAAAATCAAGG + Intergenic
1177546940 21:22570787-22570809 GATTATAGAAAAAAAAATCATGG + Intergenic
1177742817 21:25174446-25174468 TAGAACAGAAAATAGAAGCATGG + Intergenic
1177795611 21:25775622-25775644 AAGAAAAGAAAATTAAATAAAGG + Intergenic
1178008411 21:28252060-28252082 TAGAAGAGAAAATGTAATCACGG - Intergenic
1178388518 21:32179066-32179088 GAGTATTGAAAATAAAACTAAGG - Intergenic
1178835846 21:36096849-36096871 GTGAAAGGAAAATAAAATCTTGG + Intergenic
1179062971 21:37996740-37996762 GTGAATGTAAAAAAAAATCATGG + Intronic
1179240594 21:39587298-39587320 CAGAAGAGAAAATGAAAACATGG - Intronic
1179324250 21:40324151-40324173 GAGAAAAGGAAATAAAAGGAAGG + Intronic
1179825742 21:43965252-43965274 AAGAATTGAAAATAAAACCGTGG - Intronic
1180227909 21:46407907-46407929 AAGAAGAGAAAATAAACCCAAGG - Intronic
1180893335 22:19307875-19307897 GAGACTAGAAAATATCTTCATGG + Intergenic
1181336886 22:22142339-22142361 GAGAAAGGAAAATAAAAACTTGG + Intergenic
1181678464 22:24473695-24473717 TAAAATAAAAAATAAGATCATGG - Intergenic
1182376404 22:29851652-29851674 AAAAATAAAAAATAAAATAAAGG - Intergenic
1182682652 22:32093553-32093575 GAGAAAAGAAAAGAAAAGAAAGG - Intronic
1182841023 22:33390027-33390049 AAGAAAAGAAAATTAAATTATGG - Intronic
1182943464 22:34300363-34300385 GAGAAAAGAAAAGAAAATGGAGG - Intergenic
1182961278 22:34477618-34477640 GTGGATAGATAAGAAAATCAGGG + Intergenic
1183557100 22:38537510-38537532 TAGAATAGAAAATAATTTCAAGG - Intronic
1184295444 22:43520965-43520987 GAAAATAGAAATTAAAACCATGG - Intergenic
1184408853 22:44315224-44315246 GAAAATAGAATAGAAAATCAAGG + Intergenic
1184909120 22:47514239-47514261 AAGAACAGAAAAAAAAATCTTGG + Intergenic
1203278239 22_KI270734v1_random:106542-106564 AAGAAAAAAAAAAAAAATCAAGG - Intergenic
949140074 3:621785-621807 GAAATTAAAAAATAAAATAAAGG + Intergenic
949186825 3:1201891-1201913 TAGTATAGAAAAAAAAATCCTGG + Intronic
949314224 3:2733853-2733875 AAGCACACAAAATAAAATCATGG - Intronic
949361687 3:3238876-3238898 GAGAATATAAAAGAGAGTCAGGG - Intergenic
949450841 3:4183144-4183166 GAGATTAGAAACTAAAAGCTTGG + Intronic
949710579 3:6865748-6865770 GAGAAAAGAAAAAAAAATCTAGG - Intronic
949740010 3:7221581-7221603 TAGATTAAAAAATAAAATCATGG - Intronic
950031612 3:9857489-9857511 AAGAAAAGAAAAGAAAATCTAGG + Intergenic
950340760 3:12242061-12242083 CAGAATAGAAAAGAGAATCTGGG - Intergenic
950457002 3:13098755-13098777 GAAAAAAGAAAGTAAATTCAAGG + Intergenic
950618650 3:14184149-14184171 GAGCATAGCAATTAAAAGCAAGG + Intronic
950861983 3:16156263-16156285 GATGATAAAATATAAAATCAAGG + Intergenic
950916886 3:16655250-16655272 CAGAATAGAAAATAAAAGTGGGG + Intronic
950961193 3:17109601-17109623 GAGGAAAGGAAATGAAATCAAGG + Intergenic
951122709 3:18947113-18947135 GAAAATAGAAAATAAAAATTGGG - Intergenic
951185285 3:19705456-19705478 AAGAATAAAGAATACAATCAAGG + Intergenic
951233638 3:20209296-20209318 AAAAATAAAAAATAAAAACATGG - Intergenic
951285343 3:20805405-20805427 GAAAATAGAAAGTAAAAAGATGG + Intergenic
951300761 3:20993941-20993963 CAGAAAAGAAAATAAAACCTAGG + Intergenic
951441158 3:22725728-22725750 GAGAAAAAAAAAAAAACTCAGGG - Intergenic
951546873 3:23835008-23835030 GAGCATAGAAAAAAAAATACGGG + Intronic
951573391 3:24089057-24089079 AAAAATTGAAAATAAAATCTAGG - Intergenic
951625240 3:24653861-24653883 AAAAATAGAAAATGAAATAAAGG - Intergenic
951912532 3:27766750-27766772 AAGAATAGAAAAGAAAAACTGGG - Intergenic
951965449 3:28379155-28379177 GAACAAAGAAAATAGAATCAAGG + Intronic
952200104 3:31117331-31117353 TAGAAAAGAAAAGAAAATTATGG + Intergenic
952544728 3:34406705-34406727 GTGAAAGGAAAATAAAATCTCGG + Intergenic
952695155 3:36256766-36256788 GTAAATAGAAAATAAGGTCAAGG - Intergenic
952787485 3:37169990-37170012 GAGAAGGGAAAATAAGATAATGG + Intronic
952877728 3:37961016-37961038 TAGAAGAAAATATAAAATCAAGG - Intronic
953142995 3:40246724-40246746 GTGAAATGAAAATAAAATCTCGG - Intronic
953146954 3:40286500-40286522 GAAAATAAAATATAAATTCAAGG - Intergenic
953150060 3:40316506-40316528 CACAATATAAAATCAAATCAGGG + Intergenic
953581525 3:44161422-44161444 GAAAAAAGAAAACAAAATTAGGG - Intergenic
954157159 3:48692260-48692282 GATTTTAGAAAATAAAATTAAGG + Intronic
954973113 3:54668238-54668260 GAGAAAAGAGAAAAAACTCAAGG - Intronic
955270671 3:57495255-57495277 CAGAATAAGAAATATAATCAGGG + Intronic
955783466 3:62510791-62510813 GAGAATAGAGCACAAATTCATGG - Intronic
956068955 3:65427318-65427340 AAAAATAAAAAATAAAATCAAGG + Intronic
956216094 3:66850548-66850570 GGGAATAGACATTAAAATCCTGG - Intergenic
956385898 3:68718927-68718949 GAGAAAAGAAAACAAAACCCAGG + Intergenic
956479955 3:69663355-69663377 GAGAAAAGAAGAAAAAATAATGG - Intergenic
957251199 3:77773143-77773165 GAGAGTAGAAAATTAAAGCCTGG + Intergenic
957307329 3:78474430-78474452 GAAAACAGAAAAAAAAACCAGGG + Intergenic
957345373 3:78953924-78953946 GAGAATCTAAAATCAAATAATGG - Intronic
957384719 3:79481365-79481387 AAAAATAAAAAATAAAATCCAGG + Intronic
957474613 3:80707004-80707026 AAGATTAAAAAAAAAAATCATGG + Intergenic
957513862 3:81225285-81225307 TATAACAGAAAATAAAATCCTGG - Intergenic
957653686 3:83041732-83041754 TAGAATATAAAAGTAAATCATGG + Intergenic
958048908 3:88319574-88319596 TAAAAAAGAAAAAAAAATCAGGG + Intergenic
958529734 3:95311316-95311338 AAAAATGGAAAAAAAAATCAAGG - Intergenic
958580927 3:96021770-96021792 CAGAATAGAAAACTAAATTAAGG - Intergenic
958670304 3:97196162-97196184 GACAAAAGAAAAAAAAAACAAGG - Intronic
958883991 3:99705502-99705524 GAGAGAAATAAATAAAATCAAGG - Intronic
959128662 3:102322974-102322996 TATTATAGAAAATAATATCAAGG + Intronic
959243975 3:103839218-103839240 AAGAATACAAAATAAATCCATGG - Intergenic
959273845 3:104250895-104250917 GAGGATAGAAAAAAAATACAAGG - Intergenic
959720101 3:109477261-109477283 AAAAATAGAAAATAAAAACCAGG - Intergenic
960002932 3:112751894-112751916 GAGAAAAGAAAAAAGAATAACGG + Intronic
960014379 3:112870337-112870359 AAGAAAAGAAAAAAAAATGAAGG - Intergenic
960118294 3:113920509-113920531 GAGAAAAATAAATAAAATTAGGG + Intronic
960246263 3:115403651-115403673 GTGAAAGGAAAATAAAATCTTGG - Intergenic
960246447 3:115405272-115405294 GAGAAGACATAAGAAAATCAGGG + Intergenic
960268420 3:115647925-115647947 TAGAAGAGAAAATAAAACCATGG + Intronic
960316448 3:116184069-116184091 GAGAACAGAAAGTAGAATCTGGG + Intronic
960394586 3:117120613-117120635 GACAATGAAAAAGAAAATCACGG - Intronic
960550465 3:118970489-118970511 AAGAAAATAAAATAAATTCATGG + Intronic
960555774 3:119028905-119028927 CAGAATACAAAATAAAAACCAGG - Intronic
960775606 3:121248362-121248384 GAGAAATGAAAATCAAAACATGG - Intronic
961022882 3:123524130-123524152 TAGAAAAGTAAATTAAATCAAGG + Intronic
961217347 3:125169969-125169991 GAAAATAGAAAGCAAAAACAGGG + Intronic
961398619 3:126616901-126616923 GGGAAAAGAAAATAAATTCTTGG - Intronic
961680784 3:128598659-128598681 GAAAATAGAAAATAAATTGAAGG + Intergenic
961980849 3:131076524-131076546 GAGATTATGAAATATAATCAGGG - Intronic
962053658 3:131845963-131845985 CAGAATTGAGAATAAAAGCAAGG - Intronic
962113760 3:132479174-132479196 GTGAATAGAAATAAAAATTAAGG - Intronic
962365777 3:134779344-134779366 TAAAATAGAAAAATAAATCATGG - Intronic
962405730 3:135098300-135098322 CAAAATGGAAAATAAAATCTGGG - Intronic
962474136 3:135740930-135740952 AAGAAAACAAAATAAAACCAAGG - Intergenic
962601951 3:136998114-136998136 AAAAAAAGAAAAGAAAATCATGG - Intronic
963001956 3:140689604-140689626 GAGAATGGAAAAGTAAATCTTGG - Intronic
963095722 3:141537187-141537209 GAGAAGAGAAAAAAAGAACAGGG - Intronic
963177067 3:142309990-142310012 AATAACAGAAAATAAAATCATGG + Exonic
963333248 3:143940162-143940184 GAGAATAAAAGATAAAAACCAGG + Intergenic
963383901 3:144566639-144566661 GACAAGATAAAAAAAAATCAAGG + Intergenic
963399784 3:144783518-144783540 GAAAATTGAAAATAAGATTAAGG + Intergenic
963556087 3:146790913-146790935 AAGAATGGAAAAGAAAATAAAGG - Intergenic
963881648 3:150535090-150535112 GCAAAAAGAAAATAAAATTAAGG + Intergenic
964449265 3:156794827-156794849 GAGAATAGAGAAAAAGAGCAAGG + Intergenic
964490634 3:157232224-157232246 GAAATTAGAAAGTAAAAACAGGG + Intergenic
964708318 3:159645071-159645093 TAAAATAGGAAATAAAATCAAGG - Intronic
965002635 3:162975743-162975765 AAGAATAGGAAATAAAAATAAGG + Intergenic
965004097 3:162994842-162994864 GACCAAAAAAAATAAAATCAGGG - Intergenic
965575995 3:170219105-170219127 TAGAATAGAATTTAAAATCCAGG + Intergenic
965752649 3:171992286-171992308 AAAAATAAAAAATAAAATAAAGG - Intergenic
965869347 3:173248000-173248022 GAGAAAGGAAAATAAAGACAGGG + Intergenic
966057200 3:175708820-175708842 GAGAATAAAAAAAAAAAAAATGG + Intronic
966116999 3:176476941-176476963 GAGAATAAAAAATATATACACGG + Intergenic
966349260 3:179013075-179013097 GTGAATGGAAAATAAAATTTTGG + Intergenic
966349614 3:179017715-179017737 GAGAATAAAATGTAAAACCAAGG - Exonic
966532365 3:180995057-180995079 GTGAAAAGAAAATAAAAATATGG + Intergenic
966539059 3:181068941-181068963 GAGAATTGAAAACCAAAGCAGGG - Intergenic
967250633 3:187534437-187534459 GAAGATAGAAAATATAATTAAGG + Intergenic
967263439 3:187668927-187668949 GTAAATACAAAATAAAATTATGG - Exonic
967317834 3:188166152-188166174 AAGAAGAAAAAAAAAAATCAGGG - Intronic
967543934 3:190701411-190701433 GAGAAGGGAAAATAAAACCTAGG - Intergenic
967545297 3:190718874-190718896 AAGAACAGAAAATGAAAACATGG + Intergenic
967615158 3:191556289-191556311 GAAAATATAATACAAAATCATGG + Intergenic
968223266 3:196954519-196954541 GAGCAAAGAAATTAAAAACAAGG - Intronic
968270723 3:197401359-197401381 ATGATTAGAAAATAGAATCAAGG + Intergenic
968722968 4:2221320-2221342 GTGAAAGGAAAATAAAATCTTGG + Intronic
969230161 4:5825039-5825061 GTGAGGATAAAATAAAATCATGG + Intronic
969404349 4:6978750-6978772 AAAAAAAGAAAAGAAAATCAGGG + Intronic
969576767 4:8040623-8040645 AAGAAAAGAAAAGAAAAGCAGGG + Intronic
969952824 4:10855239-10855261 GAGAAAATAAAATAAAATTTAGG + Intergenic
969999329 4:11348551-11348573 AAGAGTAGAAAATAGAATAATGG - Intergenic
970139485 4:12966035-12966057 GAGACTAGAAAAAAAAATTGAGG + Intergenic
970217811 4:13778172-13778194 GAGAAAAAAAAAAAAAAACAGGG - Intergenic
970314363 4:14815301-14815323 GAGGATAAAAAATAAAAACAGGG + Intergenic
970373411 4:15432161-15432183 GAGAATAGAAGATGAAGTCAGGG + Intronic
970453475 4:16196626-16196648 GAGTATAGAAGGAAAAATCAGGG + Intronic
970519633 4:16869417-16869439 TGGAAGAGAAAATTAAATCATGG + Intronic
970596781 4:17607729-17607751 GTGAAATGAAAAAAAAATCAAGG - Exonic
970782677 4:19757780-19757802 GTGAAAAGACAAAAAAATCAAGG + Intergenic
971022740 4:22554290-22554312 GAGAAAAGAAAAAAAAATTTAGG - Intergenic
971074068 4:23127768-23127790 GGCATTAGAAAACAAAATCAGGG + Intergenic
971579977 4:28324486-28324508 GAGAACAGAAAATAAAACATTGG + Intergenic
971621102 4:28855325-28855347 GAGAACAAAAAAAAAAAGCAGGG - Intergenic
971756337 4:30713302-30713324 GAGAAAATAAAATAGAAACAAGG + Intergenic
971909224 4:32773257-32773279 CAGAATAAATAATAAAATGAAGG + Intergenic
971927528 4:33032622-33032644 AAGAATAGAAAATAAAATATTGG + Intergenic
971979359 4:33733334-33733356 GAGGATGGAAAATAAATTCAAGG - Intergenic
972016337 4:34250691-34250713 GAGAGGAGAGAAGAAAATCATGG - Intergenic
972081440 4:35155518-35155540 GAGATTCAAAAAGAAAATCATGG + Intergenic
972099831 4:35400860-35400882 AAGAAAAGAAAATAAAAACTTGG - Intergenic
972174178 4:36382872-36382894 AAGAATAGTAAATAAAATCAAGG - Intergenic
972253513 4:37330400-37330422 GGGGATAGAAAATAAGAACAAGG + Intronic
972443024 4:39115639-39115661 GAGACTGGAAAATAAAAACAAGG + Intronic
972482626 4:39512025-39512047 GAAAAAAAAAAAAAAAATCATGG + Intronic
972510483 4:39764420-39764442 GAGAAAAGAAAAAAAAAAAAAGG - Intronic
972645003 4:40959252-40959274 GAGAAGACAAAATACAACCAGGG + Intronic
972840676 4:42926835-42926857 GAGAAACGAAAAGAAAACCATGG - Intronic
973054314 4:45635617-45635639 GAGAATAGAGAGTAAAAGGATGG + Intergenic
973072632 4:45883829-45883851 GTGAAAGGAAAATAAAAACATGG + Intergenic
973080007 4:45979331-45979353 AAGAAAAGAAAAAAAATTCAGGG + Intergenic
973186521 4:47336351-47336373 GATAATAGAAAACACAAGCATGG + Intronic
973712886 4:53646725-53646747 GAGAATAGAAAGTAGAACAATGG - Intronic
973719054 4:53705079-53705101 GTGAATAGACAATAAAACCAGGG - Intronic
973746292 4:53966452-53966474 GAGAATAGAGGATAAGAGCATGG + Intronic
973926244 4:55741139-55741161 AAAAATAGAAACTAAGATCAAGG + Intergenic
973977206 4:56274058-56274080 GACAACAGAAAATAAACACAGGG - Intronic
974106407 4:57474087-57474109 GAGAATAGAAAATAAGAGGGTGG - Intergenic
974382370 4:61157724-61157746 CAACATAGAAATTAAAATCATGG + Intergenic
974448381 4:62016341-62016363 TAGAATAGAAAATAAAAGGACGG - Intronic
974690781 4:65294724-65294746 GAAAATAGAAAAGAAAAAAAAGG - Intergenic
974699774 4:65426205-65426227 GGAAAGATAAAATAAAATCAAGG - Intronic
974711405 4:65601270-65601292 AAGAGTAGAAAATAAGTTCATGG + Intronic
974849043 4:67383798-67383820 GAGAAAAAAAAAGAAGATCAGGG + Intergenic
975028386 4:69580991-69581013 AATAGTAGAAAATAAAATCCTGG - Intergenic
975149652 4:71006416-71006438 GAGAATTGAAATTGAAAGCAAGG + Intronic
975331920 4:73125748-73125770 AAGAAAAGAAAAGAAAAGCAAGG + Intronic
975350029 4:73335272-73335294 GATAATAGACAAGAAAAGCATGG - Intergenic
975391973 4:73830761-73830783 GAATATAAAAAATAAAATCTTGG + Intergenic
975412065 4:74064953-74064975 GTGAATGGAAAATGAAATCTTGG + Intergenic
975499153 4:75066001-75066023 CAGAATAGATGAAAAAATCAAGG - Intergenic
975523089 4:75321163-75321185 GAGAAGAGAAAATAATGTAAAGG - Intergenic
976169718 4:82290764-82290786 GAAAACAGAAAATAAATTTAAGG + Intergenic
976285475 4:83366744-83366766 GAGTAGAGAAGTTAAAATCAGGG + Intergenic
976671152 4:87655101-87655123 GTGAAAGGAAAATAAAATCTTGG - Intronic
976733380 4:88285970-88285992 GACAAAAGAAAAAAAAATCCAGG - Intergenic
976839024 4:89409147-89409169 GAGAAGAAAAAATAAAAGTAAGG - Intergenic
976841020 4:89432502-89432524 GAGAAAAGAGAAAAAAATTAAGG + Intergenic
976906550 4:90243545-90243567 CAAAATAAAAAATAAAAACATGG - Intronic
977014466 4:91675914-91675936 GGGAGAAGAGAATAAAATCAGGG - Intergenic
977063267 4:92282050-92282072 GAGAGAAAAACATAAAATCATGG - Intergenic
977078417 4:92489466-92489488 AACAATAATAAATAAAATCATGG + Intronic
977158732 4:93607741-93607763 GTGAGTACAAAATAAAATGAGGG - Intronic
977210551 4:94212939-94212961 GAGAAGAGTAAAATAAATCAGGG - Intronic
977220686 4:94334412-94334434 GGGAAATGAAAAAAAAATCAAGG - Intronic
977431379 4:96934357-96934379 GTGAATAGAGAAAAGAATCATGG - Intergenic
977776394 4:100925053-100925075 GAGAAGAGAAAATAATACAATGG + Intergenic
977799981 4:101216534-101216556 AAGAAAAGAAAAAAAAATAAAGG - Intronic
978011824 4:103695989-103696011 TAGAATAGAAAAGAAAAAAAGGG - Intronic
978056437 4:104273991-104274013 GAGAATCGGAAATAAAATATTGG + Intergenic
978282163 4:107031288-107031310 GAGGTTAGAAAAAAAAGTCATGG + Intronic
978380021 4:108117259-108117281 TAGATTATAAAATAATATCAGGG - Intronic
978782107 4:112566943-112566965 GAGGAAAAAAAAAAAAATCAGGG + Intronic
978916304 4:114129448-114129470 AAAAATAAAAAAAAAAATCAAGG + Intergenic
978982803 4:114970313-114970335 TAGAATAAAATATAATATCAGGG - Intronic
979246226 4:118508181-118508203 CAAAATATAAAAGAAAATCAAGG + Intergenic
979357739 4:119725334-119725356 GAGAAAAGAAAATATAAACTAGG + Intergenic
979546255 4:121943645-121943667 GACCATAGATAATAAAATTAAGG + Intronic
979637159 4:122969720-122969742 GAAAATCTAAAATAAAATGAAGG - Intronic
979809974 4:125025361-125025383 CAGAAGAGAAAGTACAATCAAGG + Intergenic
979888137 4:126058215-126058237 GAAAATAGAAGAGAAAAGCATGG + Intergenic
979893384 4:126129464-126129486 GATAATAGAAAAGAAAACCAGGG - Intergenic
980069113 4:128223929-128223951 CAGAATAAAAAAGAATATCATGG + Intergenic
980518447 4:133897000-133897022 GAGAAGAGAAAAAAAAAAAAAGG + Intergenic
980575045 4:134676089-134676111 GTGAAAGGAAAATAAAATCTTGG - Intergenic
980740177 4:136940114-136940136 GAGAAAGGAAAAGAAAAACAGGG + Intergenic
980813234 4:137910806-137910828 TAACATATAAAATAAAATCACGG + Intergenic
980831671 4:138136693-138136715 AATAATAGAAAAGAAAATGAGGG - Intergenic
980940552 4:139270321-139270343 AAGAAAAGAAAAGAAAATCTGGG + Intronic
981015277 4:139967981-139968003 GAGAAAAGAAAAGAAAAGCCAGG + Intronic
981119696 4:141035742-141035764 GAGAATAAATATTAAAATAATGG + Intronic
981734038 4:147930673-147930695 GAGAATACAAAATAAAAGGGAGG - Intronic
981810667 4:148770516-148770538 AGGAATAGAAAATAAAATCCTGG + Intergenic
981820071 4:148876441-148876463 GTGAATGGATAAAAAAATCATGG - Intergenic
981835857 4:149052454-149052476 GGGAATAAAAAATAAACTTAAGG + Intergenic
982132319 4:152240980-152241002 GAGAAGAGAAAAAAAAATGAAGG + Intergenic
982222590 4:153137766-153137788 GAGGATGAAAAATAAAAGCATGG + Intergenic
982270411 4:153580170-153580192 GAAAATGAAAAATCAAATCAAGG - Intronic
982377630 4:154711302-154711324 GTGAATAAAAAATAGAAACATGG - Intronic
982631153 4:157830953-157830975 GAGAATAGAAAATTTAAGCTAGG - Intergenic
982719335 4:158843529-158843551 GATAATAGACAATAAAATGTAGG + Intronic
982879250 4:160690309-160690331 GTAAATACAAAAAAAAATCAGGG + Intergenic
982897960 4:160958104-160958126 GAAAAGAGAAAAGAAAATCTAGG + Intergenic
983046552 4:162994132-162994154 AAGAATAGAAAATAGAAAAATGG + Intergenic
983191898 4:164763244-164763266 GGAAATAGGAAATAAAATCAGGG - Intergenic
984267992 4:177516807-177516829 CAAAAAATAAAATAAAATCAAGG + Intergenic
984448549 4:179869509-179869531 GAGAATAGAAATGAAACTGAGGG - Intergenic
984870384 4:184319789-184319811 GATATTAGAAAAAAAAATGAGGG - Intergenic
984957064 4:185055378-185055400 GAAAAAAGAAAAAAAAAACAAGG + Intergenic
985193328 4:187401434-187401456 GAGCATAGTGAATAAAAGCATGG - Intergenic
985899340 5:2776360-2776382 GGAAATACAAAATATAATCAAGG - Intergenic
986365517 5:7025366-7025388 TAGAATTAAAAATAAAAACATGG + Intergenic
986365551 5:7026297-7026319 AAAAACAGAAAATTAAATCATGG - Intergenic
986708569 5:10471122-10471144 AAGAAAAGAAAAGAGAATCAAGG - Intronic
986767432 5:10940438-10940460 GAGAATAAAGAATAAATTAAGGG + Intergenic
987122497 5:14780239-14780261 ATGGTTAGAAAATAAAATCATGG + Intronic
987349350 5:17007907-17007929 TAGCATAAAAAAAAAAATCAAGG - Intergenic
987477007 5:18402676-18402698 GAAAATCGAAAATACAATCTTGG - Intergenic
987661041 5:20876550-20876572 CAGAAAAAAAAAAAAAATCATGG + Intergenic
987689618 5:21250124-21250146 GAGAATAGAAAGTAGAAAGATGG - Intergenic
987791930 5:22579606-22579628 AAGAAAAGAAAAGAAAATTAGGG - Intronic
987802121 5:22712522-22712544 GAGAGCTGAAAATAGAATCATGG - Intronic
987820492 5:22960279-22960301 GAAAATAGAAAATAATTTAAAGG + Intergenic
987926420 5:24347924-24347946 GAAAATGAAAACTAAAATCATGG - Intergenic
988112206 5:26836239-26836261 GAGAAAAGAAAAGAAGAACAGGG - Intergenic
988145027 5:27294027-27294049 GAAAATATAATATAAAATGAGGG - Intergenic
988199591 5:28051391-28051413 GACAACATAAAAAAAAATCAAGG + Intergenic
988220161 5:28334310-28334332 GATAATAAAACATAAAAACATGG + Intergenic
988614389 5:32760090-32760112 AAGAATAGATAAACAAATCATGG - Intronic
988804841 5:34730680-34730702 AAAAATAAAAAATAAAAACAGGG + Intronic
989015514 5:36927281-36927303 GAGAGGAGAAAAGAATATCAAGG + Intronic
989155674 5:38342656-38342678 CAGAATAGTAAAACAAATCAGGG + Intronic
989265320 5:39466672-39466694 GAGAGCTGAGAATAAAATCAAGG + Intergenic
989325862 5:40193559-40193581 GATTATAGGAAATAAAATTAAGG + Intergenic
989441452 5:41476651-41476673 AAGAATACAAAGAAAAATCAGGG - Intronic
989456211 5:41647206-41647228 GAAAACAGAAAAAAGAATCATGG - Intergenic
989487279 5:42006280-42006302 GATAATAGAAAATAAACTTTTGG - Intergenic
990015063 5:51050637-51050659 AAGAGAAGAAAAAAAAATCAGGG + Intergenic
990063615 5:51683614-51683636 GACAGCAGAAAATAAGATCAAGG - Intergenic
990220587 5:53584294-53584316 GAGAATAGGAATTAGAATCTTGG + Intronic
990808663 5:59696979-59697001 TAGTCTAGAAAATAAATTCAAGG + Intronic
990826729 5:59908604-59908626 GTGAATAAAATATACAATCATGG - Intronic
990872654 5:60449669-60449691 TAAAATAAAAAATAAAATTAGGG + Intronic
991139476 5:63223614-63223636 GGGACTGGAAGATAAAATCAAGG - Intergenic
991197820 5:63956917-63956939 AAGAGTGAAAAATAAAATCAGGG - Intergenic
991341671 5:65617674-65617696 GATATTAGTAAATAAAAACATGG + Intronic
991362503 5:65835664-65835686 GAAAATGGATAATAAATTCAAGG + Intronic
991630319 5:68650077-68650099 TAGAAAAAAAAAAAAAATCAAGG - Intergenic
992126041 5:73642592-73642614 CAGAACAAAAAAAAAAATCAGGG - Intronic
992264510 5:75005175-75005197 GAGAATAGAAAAAAAATGAAGGG + Intergenic
992372236 5:76155249-76155271 GTGAAAGGAAAATAAAATCTCGG - Intronic
992812786 5:80406952-80406974 AAAAATAAAAAATAAAAACAAGG - Intergenic
992932626 5:81665275-81665297 GAGAATAAATAATAAAATGAAGG + Intronic
993179916 5:84539478-84539500 GAGAAGAGAAAAGAAAAGAAAGG + Intergenic
993181388 5:84558053-84558075 AAGAATAGATAATATAATGATGG + Intergenic
993196987 5:84761735-84761757 GAAAATAAATAATAAAATCAGGG - Intergenic
993296333 5:86146198-86146220 AAAAATAAAAAATAAAATAAAGG - Intergenic
993425204 5:87754816-87754838 AAGTAAAGAAAATGAAATCAAGG + Intergenic
993687207 5:90952818-90952840 GCAAATAGGAAATAAAATAAAGG - Intronic
993717083 5:91285756-91285778 GTGAAAGGAAAATAAAATCTTGG - Intergenic
993843340 5:92908241-92908263 GGAAATATAAAATAAAAACAAGG - Intergenic
993866012 5:93196416-93196438 GAGCTTAAAAAATAAATTCAAGG - Intergenic
994000260 5:94771452-94771474 GCGAATAGAGAAGAAATTCATGG - Intronic
994054201 5:95397559-95397581 GAGATGAGAAAATAAATTCCTGG + Intronic
994191465 5:96874092-96874114 GAGAAAAGAAAAAAAAAAGAAGG + Intronic
994228134 5:97278252-97278274 GAAAACAGAAAATAACTTCAAGG - Intergenic
994526592 5:100913480-100913502 GGGAACAGAAAACTAAATCAAGG + Intergenic
994548361 5:101199909-101199931 TATAATAGAAAAAAAAATCCTGG + Intergenic
994640386 5:102401291-102401313 ACTAAGAGAAAATAAAATCAGGG + Intronic
994910506 5:105899312-105899334 GATAAAAGAGAATAAAATAATGG - Intergenic
995105111 5:108368757-108368779 GTCAGAAGAAAATAAAATCAGGG + Intronic
995114659 5:108466293-108466315 GAGAAAAAATAATAAGATCAGGG + Intergenic
995209737 5:109523703-109523725 AAGAAATGAAAATAAAATAAGGG + Intergenic
995243735 5:109914266-109914288 GACAACACAAAATAAAACCAAGG + Intergenic
995253750 5:110022013-110022035 GAAAACAGAAAAAAAAAGCATGG + Intergenic
995266312 5:110165663-110165685 AAGAATTGAAAATAAGATCATGG - Intergenic
995287784 5:110411283-110411305 GAAAACAGAAAATAAAATATTGG - Intronic
995308736 5:110687123-110687145 GAGAAAAGAAAAATAACTCAGGG + Intronic
995351229 5:111177852-111177874 AAAAATAAAAAATAAAATAAGGG + Intergenic
995625689 5:114074063-114074085 AAGAAGAGAGAATAAAACCAGGG - Intergenic
995640100 5:114246109-114246131 GAAAATAGGAAATAAACTCAGGG - Intergenic
995654720 5:114412660-114412682 GAAAATACAAAATAAAATCATGG - Intronic
995757340 5:115521844-115521866 CCTAAAAGAAAATAAAATCAGGG + Exonic
995908619 5:117157879-117157901 AAAAATAAAAAATAAAATCCTGG - Intergenic
996102051 5:119454148-119454170 CAGAATAGAAAATAAATTTCAGG - Intronic
996169489 5:120271518-120271540 AAGAAGAGAAAGTAAAAGCATGG + Intergenic
996278867 5:121702645-121702667 AATAAAATAAAATAAAATCATGG - Intergenic
996281480 5:121734730-121734752 GAGAATATAAACTAAAACAAAGG + Intergenic
996285656 5:121788428-121788450 GAGAATAAAAAATAGCATAAAGG + Intergenic
996470173 5:123851523-123851545 GAGAAGAAAAAAGAAAAACAAGG - Intergenic
996533236 5:124548387-124548409 GAGACTTGAAAATAAAATAATGG + Intergenic
996963324 5:129278193-129278215 GGAAATTGTAAATAAAATCAGGG + Intergenic
997204286 5:132033517-132033539 GAGCAGAGAAAGTATAATCATGG + Intergenic
997558910 5:134827254-134827276 AAGAAAAGAAAAAAAATTCAAGG - Intronic
997636716 5:135414242-135414264 GAGAATGGATAAACAAATCATGG - Intergenic
997736276 5:136214819-136214841 GAGAACAGAAACTTCAATCATGG + Intronic
997765222 5:136496363-136496385 GACAAGAGAAAAAAAAATAAAGG - Intergenic
998285221 5:140853232-140853254 GAGAATAGAGATTAATATGAAGG - Intronic
998474617 5:142409713-142409735 GAGAAGAGAATATAAATGCAAGG - Intergenic
998545217 5:143022062-143022084 AATAAAACAAAATAAAATCAGGG - Intronic
998792870 5:145784253-145784275 AAGAAAAGAAAAAAAATTCATGG + Intronic
999028333 5:148260824-148260846 GATAAAATAAAATAAAATAATGG - Intergenic
999045747 5:148467870-148467892 GTGAGTAGAAAACAAAATAATGG - Intronic
999345382 5:150814170-150814192 GAGAATAGAAAAGCAATTGAGGG + Intergenic
999527183 5:152419897-152419919 AAGAATAGAAAAAAAAACTATGG - Intronic
999546225 5:152631515-152631537 TAAAAGGGAAAATAAAATCAGGG + Intergenic
999578062 5:153002770-153002792 GAAAATAGGAAATAAAATGGGGG + Intergenic
1000299959 5:159947350-159947372 AAGAAAAGAAAAGAAAACCATGG + Intronic
1000398198 5:160797989-160798011 GAGAAGAGATAATGAAAACAAGG + Intronic
1000501075 5:162051233-162051255 AAGAAAGGAAAATAAAATGAAGG + Intergenic
1000740250 5:164960346-164960368 GAAAATTGAAAATAACATCCTGG - Intergenic
1000804188 5:165768709-165768731 TAGTATAAAAAATAACATCACGG + Intergenic
1000826321 5:166048861-166048883 GAAAATATGAAATAGAATCATGG + Intergenic
1000862532 5:166473642-166473664 GGGAAAAGAAGGTAAAATCATGG + Intergenic
1001349171 5:170940010-170940032 GACAATAGACAATAAAAAAATGG + Intronic
1001423749 5:171609296-171609318 GAGAATAAAAATGAAAATAAAGG - Intergenic
1002685667 5:181007718-181007740 AAGAAAAGAAAAGAAAAACATGG + Intergenic
1003015887 6:2467109-2467131 AAGTATAGAAAATAAAGGCACGG + Intergenic
1003036767 6:2646754-2646776 GAGAATAGAAAATAATAGCAGGG + Intergenic
1003336157 6:5174836-5174858 GAGAATATAAAAGATAAGCAAGG + Intronic
1003523459 6:6878674-6878696 GAGAATATAAAGTAAGATAAAGG - Intergenic
1003608383 6:7585939-7585961 AATAATAGAAAAGAAAATCCCGG + Exonic
1003814593 6:9824327-9824349 GAGAATGGGAACTAAACTCAAGG + Intronic
1003814604 6:9824521-9824543 GAGAATAGAAAAAACAGTAATGG - Intronic
1004286247 6:14323220-14323242 GAGAATAGAAATTGAGTTCAAGG + Intergenic
1004666375 6:17751869-17751891 GAAAAAAAAAAAAAAAATCAGGG + Intergenic
1004668989 6:17777682-17777704 TAGAATAAAAAATAAAGTAATGG - Intronic
1004961514 6:20795084-20795106 GTGAATAGAAAAGGAAAACAAGG - Intronic
1005026710 6:21469551-21469573 TAGAAGTGAAAATAACATCAAGG + Intergenic
1005233041 6:23726906-23726928 GAGAATGGGAATTATAATCAAGG - Intergenic
1005593235 6:27349844-27349866 TAAAATTGAAAATACAATCAAGG + Intergenic
1005909491 6:30295753-30295775 GAGAAGAGAAAATAAAAGATGGG - Intergenic
1006210672 6:32391616-32391638 AAAAATAGAAAAAAAAATGATGG + Intergenic
1007616725 6:43184246-43184268 GAGAAAAGAAAAAAAATACATGG - Intronic
1008057292 6:46958310-46958332 GAGTATGTAAAATAAAAACAGGG + Intergenic
1008225912 6:48916495-48916517 GAGAATAGAAAAAAAAAACTTGG + Intergenic
1008296537 6:49785375-49785397 AAGAAAAGAAATTAAACTCAAGG - Intergenic
1008399901 6:51052557-51052579 GATAAAAGAAAATAAGCTCAGGG + Intergenic
1008510907 6:52274690-52274712 GAAAAAAAAAAAAAAAATCAAGG + Intronic
1008570552 6:52812425-52812447 GAAAATAGAAAAAAAAAAAAAGG + Intergenic
1008617896 6:53243806-53243828 GAGAAAAGAAAAGAAAAGAAAGG - Intergenic
1008735082 6:54533512-54533534 TCAAAGAGAAAATAAAATCATGG + Intergenic
1008812484 6:55520586-55520608 GAGAAAAAAAAATTAAAGCAAGG - Intronic
1009551519 6:65100430-65100452 AAGAATAAAAAAGAAAGTCAAGG + Intronic
1009776406 6:68210894-68210916 GAGAATTGAAAATATAATGTGGG - Intergenic
1010022810 6:71180928-71180950 GAGAATATGAAATAAATACATGG - Intergenic
1010131587 6:72500420-72500442 GGGAATAGAAAAAAAAAACTAGG + Intergenic
1010283746 6:74050838-74050860 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1010439307 6:75875004-75875026 GAGAATTCAAAAGAAAAGCAGGG - Intronic
1010461685 6:76120824-76120846 AAGAATAGAGAATAAAATTGTGG + Intergenic
1010522640 6:76859061-76859083 GAAAAAAGAAAATAAAATAAGGG + Intergenic
1010527075 6:76914347-76914369 TAGAATAGAATAGAAAATAATGG + Intergenic
1010527168 6:76916125-76916147 TAGAATAGAATAGAAAATAATGG + Intergenic
1010929607 6:81785104-81785126 CAGAAAAGAAAATGAAATAAAGG - Intergenic
1010970188 6:82254509-82254531 AAGAATAGAAAAGAAATGCATGG + Intergenic
1011447894 6:87462408-87462430 GATAATAGAAAATAATATGGGGG - Intronic
1011695726 6:89911151-89911173 AAGAAAAGGAAAGAAAATCATGG - Intergenic
1011853391 6:91658789-91658811 GAGAATAGAAAAGAAGACCCTGG - Intergenic
1012461770 6:99471143-99471165 GAGTAGAGAATATAAATTCACGG - Intronic
1012542188 6:100373896-100373918 GAGAATAATAAATAACATTAAGG + Intergenic
1012577785 6:100824929-100824951 GTGAATAAAAAATACAATAAAGG + Intronic
1012712426 6:102624467-102624489 GGGGATAGAAAATAGAATAATGG - Intergenic
1012747246 6:103107950-103107972 TAGTACAGAAAATGAAATCAAGG + Intergenic
1012770774 6:103431800-103431822 GATATTAGAGAAAAAAATCATGG + Intergenic
1012956407 6:105575379-105575401 GAGAATAGCAAAGAAAATTCTGG - Intergenic
1013242048 6:108255334-108255356 AAGCAAAGAAAAAAAAATCAGGG - Intronic
1013256060 6:108386982-108387004 GAAAACAAATAATAAAATCATGG + Intronic
1013355448 6:109342235-109342257 AATAAAATAAAATAAAATCATGG + Intergenic
1013581541 6:111539721-111539743 GAAAATAGAAAATATAATCTGGG - Intergenic
1013648666 6:112171184-112171206 GATAAAAGGAAATGAAATCAAGG - Intronic
1013781617 6:113734557-113734579 GAAAATAAAAAATAAAAAGAAGG - Intergenic
1013814709 6:114084065-114084087 AAGAAAAGAAAATATGATCAGGG - Intronic
1013840964 6:114393257-114393279 CAGAAAAAAAAAAAAAATCAAGG - Intergenic
1013909791 6:115260777-115260799 TAGAATATAAAATAAATTCCAGG - Intergenic
1013972100 6:116032944-116032966 GAGAAAAGCAAATGCAATCAAGG + Intronic
1014016818 6:116540723-116540745 GACAATATAAATTAAAATTAAGG + Intronic
1014054456 6:116997538-116997560 GTGAAAGGAAAATAAAATCTAGG + Intergenic
1014070295 6:117174152-117174174 GGGAAAAGAAAAAAAAATCCAGG + Intergenic
1014132341 6:117848516-117848538 GAAAACAGAAAAAAAAAACAGGG + Intergenic
1014255048 6:119152730-119152752 AAGAATATAAGATAAAATAAAGG + Intergenic
1014332120 6:120082027-120082049 GAAAAAAGAAAAAAAAATCCAGG - Intergenic
1014404682 6:121036595-121036617 TTGAAAAGAAAAAAAAATCAAGG + Intergenic
1014428000 6:121332859-121332881 GAAAATAAACAAGAAAATCATGG + Intronic
1014472680 6:121835545-121835567 GAAAATAGTAAATAAAAAGAAGG + Intergenic
1014606794 6:123484802-123484824 CAGAAAAGAAAACAAAATGAAGG - Intronic
1014669918 6:124289634-124289656 GACAATTAAAAATCAAATCACGG - Intronic
1014755322 6:125296537-125296559 GGGAAGAGAGAAGAAAATCAGGG - Intronic
1014854579 6:126383596-126383618 GAAAAAAGAAAAAAAAATCAGGG + Intergenic
1014894096 6:126879945-126879967 GAGAACAGAGAATTATATCAAGG - Intergenic
1015159292 6:130134268-130134290 GACACTGGAAAATAAAATAATGG - Intronic
1015198949 6:130557098-130557120 GCGAATAGATAATAGAATAAGGG + Intergenic
1015270872 6:131337612-131337634 AAGAGTAGGAAACAAAATCATGG + Intergenic
1015299614 6:131637947-131637969 GAAAAAAGAAAATAAAATCAAGG - Intronic
1015321334 6:131878685-131878707 GAGAATAACCAATAAAATAAAGG + Intronic
1015373698 6:132485722-132485744 GAAAATACAAATTAAAAGCACGG - Intronic
1015599578 6:134899434-134899456 GAGAATAGAAAGTAGAATTGTGG - Intergenic
1015653809 6:135494781-135494803 TACAATATAAAGTAAAATCAGGG + Intronic
1015682944 6:135828033-135828055 TAGAATAGAAGATGAAATGATGG - Intergenic
1015778666 6:136840932-136840954 GAGAACAGAAAATAATGACAAGG - Intronic
1015953113 6:138573933-138573955 AAAAAAAGAAAATAAAATAATGG - Intronic
1016026791 6:139295617-139295639 GTGAGTTGTAAATAAAATCAAGG - Intergenic
1016091978 6:139990869-139990891 GAGTCCTGAAAATAAAATCAGGG + Intergenic
1016163635 6:140911881-140911903 GAATATGGAAAATAAAATAATGG + Intergenic
1016324418 6:142883317-142883339 GAGAAGAGAATATAATTTCAAGG - Intronic
1016404979 6:143720335-143720357 GAGAAGAGAAAATTAAAGCAAGG + Intronic
1016882701 6:148926614-148926636 GAGAATAGAATGGAAAGTCAAGG + Intronic
1017167998 6:151427791-151427813 GAGAATGGAGAAGAAAATCAAGG + Intronic
1017323711 6:153122570-153122592 TAGCATAGAAATTACAATCAGGG + Intronic
1017426227 6:154324263-154324285 GGATATATAAAATAAAATCATGG + Intronic
1017429387 6:154355783-154355805 GAAAATAGAAAATAGAATGCCGG - Intronic
1017560599 6:155624387-155624409 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1017645953 6:156540298-156540320 TAAAATAAAAAATAAAATTATGG - Intergenic
1017693518 6:156990818-156990840 AAAAATATAAAATAAAACCAAGG - Intronic
1018286082 6:162239272-162239294 TAAAATAGAAAATAAAATCTGGG - Intronic
1018395489 6:163375136-163375158 AAGAAAAGAAAAGAAAATTACGG + Intergenic
1018518058 6:164609939-164609961 GAAAAAAGAGAATAAAATAAAGG - Intergenic
1018667426 6:166151338-166151360 GAGAAAAGCAAATAAAAAGATGG - Intergenic
1018714632 6:166522216-166522238 GATAATACAAAAGAAAATTAAGG + Intronic
1018801262 6:167224045-167224067 GTGAAAGGAAAATAAAATCTCGG + Intergenic
1018886992 6:167947713-167947735 GAGATGAAAAAAAAAAATCAAGG - Intronic
1019824121 7:3269302-3269324 AAGAATATTAAATAAAACCAGGG + Intergenic
1020563090 7:9756314-9756336 GAGAAAAGAGAACAAGATCATGG - Intergenic
1020818277 7:12933627-12933649 GACTATAGAAAATAAGATTACGG + Intergenic
1020880488 7:13756152-13756174 GAGACAAGAAAATAAAATTTGGG - Intergenic
1020899132 7:13981695-13981717 GATAATAGAAAAGAAAAATAAGG - Intronic
1021133683 7:16941748-16941770 GAGAATAAAAAAGATAATAATGG - Intergenic
1021472294 7:21018206-21018228 AAGAATAGAAAATAAACCAATGG - Intergenic
1021547124 7:21826413-21826435 GAAAATATAAAAGAAAATTAAGG + Intronic
1021591870 7:22272370-22272392 AAAAAAAGAAAAAAAAATCAAGG + Intronic
1021591888 7:22272742-22272764 GAAAATAAAAAATAAAAGTACGG - Intronic
1021632567 7:22661426-22661448 GAGCATAGACTCTAAAATCAGGG - Intergenic
1021673357 7:23055176-23055198 AAGAAAAGAAAAAAAAATCTTGG + Intergenic
1021831387 7:24615487-24615509 GAAAATAGATAATAAATTCCTGG + Intronic
1021852507 7:24822295-24822317 GATCATATAAAACAAAATCAAGG + Intronic
1021931905 7:25589429-25589451 CAGAAAAGAAAATGAGATCAAGG + Intergenic
1021934523 7:25616615-25616637 GAGAATAGAAACTCAAATACAGG + Intergenic
1022152733 7:27625537-27625559 GAGAAAAGAAAATAGGATCAGGG + Intronic
1022340925 7:29467593-29467615 GAGATTAGAAAATGAAGTCCAGG + Intronic
1022770309 7:33464346-33464368 CAGAAGAGAAAATAAAGCCAGGG - Intronic
1023229884 7:38015805-38015827 AAAAATAGAAAAAAAAATCTTGG - Intronic
1023230781 7:38026409-38026431 GATAATAGAAAATCAATTAATGG + Intergenic
1023231639 7:38037956-38037978 AAAACTAGAAAATAAAATCTGGG + Intergenic
1023348244 7:39293470-39293492 AAGAAAGGAAAATAAATTCAAGG - Intronic
1023389951 7:39700123-39700145 AAAAATAAAAAATAAAATAAAGG + Intronic
1024319623 7:48051899-48051921 GAGAAGAGAAAAGAAAAGGAAGG - Intronic
1024334186 7:48188624-48188646 GAGAAAAGAAAATAAATTAGAGG - Intronic
1024662261 7:51509673-51509695 GAAAAAATAAAATAAAATGAAGG - Intergenic
1024663582 7:51522624-51522646 GAGAATAGAAAATTAGTCCATGG - Intergenic
1024957884 7:54944763-54944785 TAGAATAAAAATTAATATCATGG + Intergenic
1025292120 7:57738369-57738391 GGGAAAAGAAAAAAAAATAAAGG - Intergenic
1025901087 7:65745394-65745416 GAAAAGAGAAAAAAAAATCAAGG + Intergenic
1026092483 7:67312667-67312689 GAGAAGAGAAAAGAAAAGAAAGG + Intergenic
1026167956 7:67927785-67927807 GAGAATAGAAACTCAAAACCGGG - Intergenic
1026599947 7:71769655-71769677 AAGAAAAGAAAGAAAAATCACGG - Intergenic
1026624825 7:71982604-71982626 CAGAATAAAAAATAAATGCAAGG + Intronic
1026662978 7:72318230-72318252 GAGAAAATAACGTAAAATCAAGG - Intronic
1026780364 7:73262425-73262447 GAGAAAATAAATTAAAACCAGGG + Intergenic
1026852080 7:73730926-73730948 AAGAAAAGAAAAAAAAAGCATGG + Intergenic
1027021223 7:74815866-74815888 GAGAAAATAAATTAAAACCAGGG + Intronic
1027066803 7:75130071-75130093 GAGAAAATAAATTAAAACCAGGG - Intronic
1027366140 7:77460348-77460370 GAGAATAGTGAAAAAGATCAAGG - Intergenic
1027474213 7:78609482-78609504 AGGAAAAGAAAATAAAATGAAGG + Intronic
1027622375 7:80505323-80505345 GATAATAGAATATAAAATTCTGG + Intronic
1027868770 7:83679846-83679868 GACAATAGAAAATAAATTGGGGG - Intergenic
1027884181 7:83881830-83881852 GAAAACATAAAATAGAATCAAGG - Intergenic
1027919268 7:84371527-84371549 GAAAATAAAATATTAAATCATGG + Intronic
1028216708 7:88141580-88141602 AAATATAGAAAATAAAATCTTGG + Intronic
1028365260 7:90021654-90021676 GAGATTACCATATAAAATCAAGG + Intergenic
1028718191 7:93998707-93998729 AAGAAAAGAAAAGAAAACCAGGG + Intronic
1028768081 7:94583124-94583146 TTAAATAGAAAATAACATCAAGG - Intergenic
1028901219 7:96102384-96102406 GAGGGTGGGAAATAAAATCAAGG + Intronic
1029880428 7:103802969-103802991 GAGAAATGAAAATAATATTACGG - Intronic
1030167812 7:106572171-106572193 GAAAAAAGAAAAAAAAATAAAGG - Intergenic
1030373379 7:108726370-108726392 CAGGATAGAAAATAATATCTAGG - Intergenic
1030674444 7:112369969-112369991 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1030735807 7:113047106-113047128 GAGATTAGATAATAACATAATGG - Intergenic
1030746159 7:113169164-113169186 GAGAACACAAAATATAATCTTGG - Intergenic
1030920932 7:115386095-115386117 GAGATTTAAAAATAAAATCAAGG - Intergenic
1031187712 7:118503923-118503945 GAGAATAGAGAGAAGAATCAAGG + Intergenic
1031188947 7:118521369-118521391 GAAGGTAGTAAATAAAATCATGG - Intergenic
1031459294 7:122026146-122026168 TAGAAGAAAAAATAAAATCTAGG + Intronic
1031572363 7:123375005-123375027 AAGAAAAGAAAAAAAAATCAGGG + Intergenic
1031736727 7:125373342-125373364 GAGAAAAGAAAAAGAAATCATGG + Intergenic
1031797594 7:126195831-126195853 TATAATAAAAAAAAAAATCATGG + Intergenic
1031823941 7:126539149-126539171 GACAATTTAAAATAAAATTAAGG + Intronic
1032140505 7:129325591-129325613 GGGTATAGAAAATAGAATAATGG - Intronic
1032163965 7:129531519-129531541 CAAAATACAAAATAAAATCAAGG + Intergenic
1032303386 7:130710155-130710177 AAAAATAAAAAATAAAAACAGGG + Intergenic
1032309931 7:130775820-130775842 TAGAATAGAAAATAAAATGGTGG - Intergenic
1032341258 7:131075464-131075486 GGGAAAATAAAATAAAATCATGG - Intergenic
1032555699 7:132832061-132832083 TAAAAAAGAAAAAAAAATCAAGG + Intronic
1032650880 7:133877164-133877186 CAGAATGGAAAATATAAACACGG - Intronic
1032749192 7:134819982-134820004 GAGAATGGAAACTGAAATAATGG + Intronic
1032928886 7:136642156-136642178 GAGAATAGAAAGTAGAATTGTGG + Intergenic
1032938488 7:136761507-136761529 GAGGATAGTAAAGAAAAGCAAGG + Intergenic
1033017347 7:137685262-137685284 AGGAAAACAAAATAAAATCAAGG + Intronic
1033037699 7:137890283-137890305 GATAATAGATAAAAGAATCAAGG + Intronic
1033907802 7:146227122-146227144 GAGAATAGAAAAAAACTTTAGGG + Intronic
1033951899 7:146795317-146795339 GAGAATACTAAGTAAACTCAGGG - Intronic
1034022708 7:147662404-147662426 TAGAGTAGGAAATAAAATTAAGG + Intronic
1034525260 7:151655651-151655673 GACAATAGAGCATCAAATCAAGG + Intronic
1034713825 7:153220721-153220743 GTGAAAAGAAAATAAAAACTTGG + Intergenic
1034796053 7:154014678-154014700 GAAAAAAGAAAAAAAAATCATGG + Intronic
1034987647 7:155527012-155527034 GAAAAAAGAAAAGAAAAGCATGG - Intronic
1035498259 8:71381-71403 GAGAATGGAAAATAAATCCTGGG + Intergenic
1035714411 8:1743178-1743200 GAGAATACAAAATAAATGGATGG + Intergenic
1035830039 8:2685951-2685973 GGGAATAGAAAAAAATATCTTGG - Intergenic
1036024882 8:4895688-4895710 GAGGAGAAAAAAAAAAATCAGGG - Intronic
1036241444 8:7084728-7084750 CAGAATATGAAATAACATCAAGG + Intergenic
1036496539 8:9275181-9275203 AACAATAGAAAAAAAAATCCTGG - Intergenic
1036619097 8:10411449-10411471 AAGACTAAAAAATAAAATAAGGG - Intronic
1037173547 8:15921845-15921867 AACAATATAATATAAAATCAAGG - Intergenic
1037266469 8:17067425-17067447 GGGAAAAAAAAAAAAAATCATGG - Intronic
1037544381 8:19904039-19904061 CAGACTAGTAAACAAAATCAGGG + Intronic
1037904483 8:22707547-22707569 GGAAATAGAAAAGAAAAACATGG - Intergenic
1037939519 8:22941176-22941198 GAGAATAGGAAAAAAAAGAATGG + Intronic
1038048529 8:23787926-23787948 AACAATAAAAGATAAAATCATGG + Intergenic
1038094585 8:24293595-24293617 AGGAATAGAACATAAAATAATGG + Intergenic
1038157788 8:25007149-25007171 GAGATTAAAAAATGAAACCAGGG - Intergenic
1038374024 8:27020005-27020027 GAGAATAAAAAAAGAAATCTAGG - Intergenic
1038403317 8:27302701-27302723 GCAAATAGAAAATAAAATATAGG - Intronic
1038529587 8:28307519-28307541 AAGAACATAAAATAAAATCTTGG + Intergenic
1038549527 8:28454372-28454394 GATAATAAAAAATAACTTCAGGG + Intronic
1038728651 8:30105677-30105699 GAAAATAAAAAAAAAAATCAAGG - Intronic
1039560316 8:38507433-38507455 GAGAAGAGAAAAGAAAAGAAAGG - Intergenic
1039729478 8:40258733-40258755 GAGCTTTGAAAATAAAACCAGGG + Intergenic
1039815924 8:41094401-41094423 GAGAAGAGAAAAAAAAACAAGGG - Intergenic
1040417497 8:47208053-47208075 GAGCAAAGCAAAAAAAATCATGG + Intergenic
1040562031 8:48531487-48531509 GAAAATACAAATTAAAACCACGG - Intergenic
1040597779 8:48856710-48856732 CAAAAAAGAAAATAAAATGAAGG - Intergenic
1040623850 8:49121911-49121933 GAGAATAGACTACAAAACCAGGG - Intergenic
1040904026 8:52446440-52446462 AACAATTGAAAATAGAATCAAGG - Intronic
1040962585 8:53050620-53050642 GAGAAAAGAAAGTCAAACCAAGG - Intergenic
1041095345 8:54343830-54343852 TAGAAGAGAGAATAAAACCATGG - Intergenic
1041299018 8:56391477-56391499 GGAATTAGAAAACAAAATCAGGG - Intergenic
1041472012 8:58221074-58221096 GAGAATAAAAAGAAAAATGATGG - Intergenic
1041537093 8:58938888-58938910 GAAAATAGGAAGGAAAATCAAGG + Intronic
1041829607 8:62139111-62139133 GAAAAAAAAAAATAAAATCCAGG - Intergenic
1042130283 8:65581063-65581085 AAGAATAAACAATAAAAACAAGG + Intergenic
1042313042 8:67397361-67397383 GATAATAGCAAATAAAATTCAGG - Intergenic
1042421757 8:68598978-68599000 GAGAATAGAAAATGACAATATGG + Intronic
1042689370 8:71480161-71480183 AAGAATTACAAATAAAATCAAGG - Intronic
1042728841 8:71908890-71908912 TACAATGAAAAATAAAATCATGG - Intronic
1042736027 8:71989603-71989625 AAGTATAGAAAATAATATAATGG - Intronic
1043011108 8:74883033-74883055 AAGAAAATAAAATAAATTCATGG - Intergenic
1043066308 8:75575612-75575634 GAGAAAAGAAAATAAAAACTAGG - Intergenic
1043146749 8:76666988-76667010 GAGAAAAGAAAATAAAGCAAAGG - Intergenic
1043247972 8:78029960-78029982 AACAAAAAAAAATAAAATCATGG + Intergenic
1043600692 8:81934271-81934293 GAGAATAGAGAATAGAAGTATGG + Intergenic
1043753812 8:83976338-83976360 GATAATTAAAAATAAAATCAAGG + Intergenic
1043764614 8:84114629-84114651 GATTGTAGAAAATATAATCAAGG - Intergenic
1043979549 8:86622303-86622325 GAGAAAAATAAATAAATTCAAGG - Intronic
1044007142 8:86951798-86951820 GTGAAAAGAAAAAAAAATCTTGG + Intronic
1044024304 8:87149779-87149801 GAGAATAGAAGGTGAAATGATGG + Intronic
1044037032 8:87319007-87319029 AAGAAGAGTAAATAAAATCATGG + Intronic
1044062515 8:87655774-87655796 CACAAAAGAAAATAAACTCAAGG + Intergenic
1044082778 8:87905570-87905592 GAAAATAGTCAATCAAATCAAGG - Intergenic
1044175319 8:89113410-89113432 TAGAATAGACAACAAAACCATGG + Intergenic
1044460134 8:92434590-92434612 GGTAATAGAAAAGCAAATCAAGG - Intergenic
1044932680 8:97265197-97265219 GATGATGAAAAATAAAATCAAGG - Intergenic
1045087785 8:98705639-98705661 GAAAAGAGAAGATAATATCATGG - Intronic
1045669955 8:104539776-104539798 GAGAAGATAAAAAAAAATGAGGG + Intronic
1045742281 8:105375328-105375350 GAGAAAAGGAAAGAGAATCAGGG + Intronic
1045915813 8:107469249-107469271 GAGAATACAAAATAAAAGATTGG - Intronic
1045998611 8:108393282-108393304 GAGAATAGAAAAATACATCATGG + Intronic
1046010783 8:108544128-108544150 AAGAATTGAGAATAAAATTATGG - Intergenic
1046286282 8:112096326-112096348 AAAAATAAAAAATAAAAACAAGG + Intergenic
1046467343 8:114623146-114623168 AAGGATAGAAAAGTAAATCAAGG + Intergenic
1046505555 8:115133387-115133409 AAGAATAGAAAATTATACCATGG - Intergenic
1046779867 8:118203556-118203578 AAGAAAAGAAAATAGAAACAAGG - Intronic
1046840000 8:118845626-118845648 GAGAAAAGAAAATAAGACAAGGG - Intergenic
1046884625 8:119351860-119351882 TAAAATAAAAAATAAAATCGGGG + Intergenic
1047091115 8:121576820-121576842 GAGAATACAAAATAAGTTCAAGG + Intergenic
1047180180 8:122580072-122580094 AGGAAGAGAAAATAAAATCCAGG + Intergenic
1047320389 8:123774570-123774592 GAAAGAAGAAAAAAAAATCATGG - Intronic
1047511057 8:125515882-125515904 GAGATCAGAAAAATAAATCAGGG + Intergenic
1047567441 8:126061425-126061447 CAGGCTAGAAGATAAAATCAAGG - Intergenic
1048132532 8:131713684-131713706 TTGAATAGAAAGTAAAGTCAAGG + Intergenic
1048255506 8:132902291-132902313 GAGATTAGAAAATAAGAATAAGG - Intronic
1048284907 8:133134105-133134127 GAGAAAAGAAATTATAATGAAGG + Intronic
1048359498 8:133685236-133685258 AAGAAGAAAAAATAAAATCTAGG - Intergenic
1048388955 8:133942249-133942271 TAGAATAGTAGATAAAATCTTGG + Intergenic
1048528954 8:135229904-135229926 CAGAATAGAAGCTAAGATCAAGG - Intergenic
1048683736 8:136877500-136877522 CACAATAGATTATAAAATCACGG - Intergenic
1048715536 8:137264749-137264771 GAAAATACAAAAAAAAATCTGGG - Intergenic
1048719569 8:137308248-137308270 AAGAAAAGAAAAGAAAATAATGG + Intergenic
1048775489 8:137941498-137941520 GAGAAGATAGAATAAAAGCATGG + Intergenic
1048793474 8:138126511-138126533 TAGAATAAAAGATAAAATGAAGG + Intergenic
1049833812 8:144719944-144719966 GAGAATGCAAATTAAAACCATGG + Intergenic
1050354511 9:4770063-4770085 TAAAAAATAAAATAAAATCAAGG - Intergenic
1050456388 9:5838846-5838868 GTGAATAGTAAATAAAAGAAAGG + Intergenic
1050491522 9:6193568-6193590 GAGAATTGAGAGGAAAATCATGG + Intergenic
1051206212 9:14692440-14692462 TAGAAGAGAAAAAAAAATCAAGG - Intronic
1051376326 9:16406233-16406255 GAAAAAAAAAAAAAAAATCAAGG - Intergenic
1051775133 9:20623855-20623877 GAGAAGAGAAGGAAAAATCAAGG - Intergenic
1051828154 9:21244956-21244978 GAGAAAAAAAAATGAAATCATGG - Intergenic
1051901306 9:22044721-22044743 AGGAATAGAAAAAAAAATGATGG - Intergenic
1052308724 9:27040672-27040694 GTCAACAGAAAACAAAATCAGGG - Intronic
1052350090 9:27449672-27449694 TACAATAGAAAATAAAAACTTGG + Intronic
1052402160 9:28013910-28013932 AAGAATTGAAAAGAAAATAACGG - Intronic
1052417473 9:28195437-28195459 GATAATAAAAAATAGAAACATGG + Intronic
1052459547 9:28744933-28744955 TAGAATAAAATATAAAAACAAGG - Intergenic
1052499228 9:29267968-29267990 AAGAAGAAAAAATAAAATAAAGG + Intergenic
1052592574 9:30516631-30516653 GTGAAAGGAAAATAAAATCTTGG - Intergenic
1052599962 9:30614470-30614492 TGGATTAGTAAATAAAATCATGG + Intergenic
1052613192 9:30802193-30802215 TAGAAAAGAAAATAAATCCAAGG - Intergenic
1055411603 9:76035971-76035993 GTGAAAAAAAAATAAAATAAGGG - Intronic
1055510993 9:76995446-76995468 CAAAAAAGAAAATAAAATGAAGG - Intergenic
1055635167 9:78270059-78270081 TGGATTAGAAAATAAAATCAGGG + Intronic
1055673493 9:78631303-78631325 GAGAATAGAAAAAAGAACAAGGG + Intergenic
1055698377 9:78914402-78914424 GACAATAGAAATAAAAATAACGG - Intergenic
1055739232 9:79367687-79367709 AAAAAAAGGAAATAAAATCATGG + Intergenic
1055873512 9:80915248-80915270 GAAAATAAAAAAAAAAAGCAGGG - Intergenic
1055899207 9:81215174-81215196 GAGAGCAGATAATAAAATTATGG - Intergenic
1056080473 9:83088053-83088075 GAAATTAGAAACTAAAATAAGGG - Intergenic
1056080810 9:83092706-83092728 CAGATAAGAAAATAAAAGCAGGG - Intergenic
1056098742 9:83280157-83280179 CAGAAGAGAAAATAAGATCTAGG + Intronic
1056465736 9:86852568-86852590 AAGAAAAGAAAAAAAAAGCAGGG - Intergenic
1056868035 9:90248038-90248060 GAAAATATAAAATAAGATGATGG - Intergenic
1056975567 9:91250011-91250033 AAGAAAAAAAAAAAAAATCAGGG + Intronic
1057341302 9:94204311-94204333 CAGAATAGAGAATAGAATGATGG + Intergenic
1057949019 9:99355069-99355091 GAAAATACAAATTAAAATCATGG + Intergenic
1058220183 9:102289911-102289933 GAATATAGAAAATAATATAAAGG - Intergenic
1058341845 9:103906933-103906955 GAGAAGAAATAATTAAATCAAGG - Intergenic
1058558224 9:106193875-106193897 AAAAATTGAAAATAAAATAATGG - Intergenic
1058617917 9:106853877-106853899 AAGAAAAAAAACTAAAATCAAGG - Intergenic
1058665671 9:107313203-107313225 GAAAAGAGAAAAGAAAATAAAGG - Intronic
1058822005 9:108741049-108741071 GAGAATAGATAAATAAATTATGG + Intergenic
1058883193 9:109303096-109303118 GAGAAAAGAAAAGAAAAAAAGGG + Intronic
1059244473 9:112837774-112837796 AAGGTTAAAAAATAAAATCAGGG - Intronic
1059378317 9:113903273-113903295 GAGAATGGAAAGTAATGTCAAGG - Intronic
1059530216 9:115028581-115028603 GTGAAAGGAAAATAAAATCTTGG + Intronic
1059547303 9:115190563-115190585 GAAAAAAAAAAAAAAAATCAAGG + Intronic
1059564202 9:115366604-115366626 GATAAAAGAAAATAAAAACCTGG + Intronic
1059781106 9:117528558-117528580 GACAATAGAAACTACAATAAAGG + Intergenic
1059828246 9:118058380-118058402 TGGAATAGTAAATAAACTCAAGG + Intergenic
1059862002 9:118475212-118475234 GAGTCTTAAAAATAAAATCATGG + Intergenic
1059930630 9:119256993-119257015 GAGAATAGAAAATGAAGTTTGGG + Intronic
1060489519 9:124072306-124072328 CAGAAGAGAAAAAAAAAGCACGG - Intergenic
1060653889 9:125354807-125354829 GAGCAAAGAAAAGAAGATCAGGG + Exonic
1060840323 9:126788333-126788355 CTGAAGAGAAAATAAATTCATGG + Intergenic
1061711916 9:132493842-132493864 GAGAAAAGAAAAGAAAAGAAAGG - Intronic
1061938157 9:133869999-133870021 GAAAAAAGAAAAAAAAATGAAGG - Intronic
1062369902 9:136232944-136232966 AAGAAAAAAAAAGAAAATCATGG + Intronic
1203730843 Un_GL000216v2:88179-88201 GAAAATATAAAATAAAAAAATGG + Intergenic
1203387905 Un_KI270438v1:71674-71696 GAGAATGGAAAAGAATATAATGG + Intergenic
1185719074 X:2367516-2367538 GGGAATTGAAAATAAGAACAGGG + Intronic
1186086904 X:6000560-6000582 GAACATAAAAAAAAAAATCATGG + Intronic
1186817465 X:13252144-13252166 GAGAATAGCCAATAACATCATGG - Intergenic
1187173928 X:16878563-16878585 AAGAAAAGAAAAAAAAATAAAGG - Intergenic
1187290712 X:17950751-17950773 AAGAAAAGAAAAGAAAAGCAAGG + Intergenic
1187631940 X:21182964-21182986 GAGACTAAAGAATAACATCATGG - Intergenic
1187885190 X:23882952-23882974 CAGATTAAAAAATAAAATAAGGG + Intronic
1188145662 X:26609258-26609280 GAAAATAGTAAATAAAAATAAGG + Intergenic
1188211617 X:27432375-27432397 GGGAGAAGAAAAAAAAATCAAGG + Intergenic
1188360923 X:29252283-29252305 GAAAAAAAAAAAGAAAATCAGGG + Intronic
1188366949 X:29328007-29328029 GAAAAAGGAAAACAAAATCAAGG - Intronic
1188383384 X:29526076-29526098 AAGAAAAGAAGATAAAATCAAGG + Intronic
1188466918 X:30491849-30491871 CTGAATAGAAAACAAAGTCAAGG + Intergenic
1188648562 X:32600361-32600383 TATAATAGAAAACAAAAACAAGG + Intronic
1188816348 X:34719196-34719218 AAGAATAAAAAATAAAATGGTGG + Intergenic
1188913616 X:35881866-35881888 GAAAATAGGAGATAAAATTAGGG + Intergenic
1189079757 X:37958579-37958601 GTGAAAAGAAAATAAAATTTGGG - Intronic
1189400397 X:40662738-40662760 AAGAATGGAAAAGAAAATAATGG + Intronic
1189690768 X:43614568-43614590 TAGAATTGTAAATAAATTCAGGG - Intergenic
1189894570 X:45641092-45641114 GTGGATAGCAAATAAAAACATGG - Intergenic
1190083818 X:47377787-47377809 GAGAATTGCAAATTAAAACAAGG - Intronic
1190099258 X:47508449-47508471 GACAAGAGAAAATAAAATAGTGG + Intergenic
1190132090 X:47757532-47757554 GATACTACAAAATAAAATAATGG + Intergenic
1190185219 X:48227841-48227863 GAGGATAGAAAGTCAAACCAAGG + Intronic
1190197953 X:48335893-48335915 GAGCATAGAAAGTCAAACCAAGG + Intergenic
1190474162 X:50811581-50811603 CATAAAAGGAAATAAAATCAAGG + Intronic
1190475439 X:50822630-50822652 GAAAAAAGAAAATAAAAGAAAGG - Intergenic
1190548676 X:51556598-51556620 CAGAATAAAAAATAAAAACAAGG - Intergenic
1190664700 X:52686327-52686349 GAGCATAGAAAGTCAAACCAAGG + Intronic
1190674722 X:52772091-52772113 GAGCATAGAAAGTCAAACCAAGG - Intronic
1190682702 X:52841681-52841703 GAAAACAGAAAACAAAAACAGGG + Intergenic
1190882202 X:54499724-54499746 AAGAATAGAAAATATAAGAATGG + Intergenic
1190999266 X:55642836-55642858 GAAAACAGAAAAGAAAAACAGGG + Intergenic
1191043962 X:56116057-56116079 CAGAATAAAAAGTCAAATCAGGG - Intergenic
1191217229 X:57946074-57946096 GATAACAGAAAAAAAAAACAGGG - Intergenic
1191597423 X:62960748-62960770 TAAAAAAGAAAAAAAAATCAGGG - Intergenic
1191806472 X:65140546-65140568 AAGAATAGAAAAGAAAATTATGG - Intergenic
1192037215 X:67576835-67576857 AAAAATAGAAAAGAAAATAAGGG - Intronic
1192346317 X:70310458-70310480 GAGAATAGAAAAACAAATAGTGG - Intronic
1192489019 X:71557931-71557953 GATAAAAGAAAAAAAAATTATGG - Intronic
1192707974 X:73547260-73547282 GAAAATGGAAAAAAAAAGCAGGG + Intergenic
1192924920 X:75746425-75746447 TAAAATAGAAAATAAAATCTTGG - Intergenic
1193219362 X:78904279-78904301 GAAAACAGAAAATAGAATGAAGG - Intergenic
1193287468 X:79729982-79730004 GTAAATTGAAAATAAAATAAAGG - Intergenic
1193347154 X:80417122-80417144 GAAAATAGAAAAAAAAAGCAGGG - Intronic
1193440302 X:81532675-81532697 GAGAATAAAAAAAAAACTAATGG + Intergenic
1193667151 X:84335127-84335149 TAGAATAGAAAACAAAATATTGG - Intronic
1193823814 X:86197583-86197605 GAAAACAGAAAAAAAAAGCAGGG + Intronic
1194016452 X:88626966-88626988 GAAAACAGAAAAAAAAAGCAGGG + Intergenic
1194024066 X:88729478-88729500 AAGAATAGAAATAAAAATCAGGG + Intergenic
1194097424 X:89659068-89659090 TAGAATAAAAAATAAAAGCGGGG - Intergenic
1194098170 X:89668959-89668981 GTAATTAGAAAATAAAATTAAGG - Intergenic
1194179116 X:90691305-90691327 TAGAATAAAAATTATAATCAAGG - Intergenic
1194265461 X:91747973-91747995 GACAATAGAAAAAAAAATAAAGG + Intergenic
1194307881 X:92270903-92270925 GGGAATGGAAAATAAAAACATGG - Intronic
1194425412 X:93731518-93731540 GATAATAAAACAGAAAATCATGG + Intergenic
1194664798 X:96665571-96665593 GAAAAGTGAAAACAAAATCAGGG - Intergenic
1194721143 X:97341378-97341400 GAGAATAGAAATTAAGAATACGG - Intronic
1194793328 X:98178503-98178525 GAGAATACAAAGTAGAATCATGG - Intergenic
1195397137 X:104423564-104423586 GATAAAAGTAAAGAAAATCAAGG - Intergenic
1195550894 X:106169196-106169218 GAGATGAGAACTTAAAATCATGG + Intronic
1195684064 X:107570056-107570078 GAGAAAAGAAAAGAAAAGAAAGG + Intronic
1195792758 X:108607064-108607086 TTGAATAGATAATAAAATCATGG + Intronic
1195894230 X:109729313-109729335 GAGAATGGCAAATAAACACATGG + Intronic
1195932642 X:110094505-110094527 GCAAATAGAAAACAAAAGCAGGG - Intronic
1195965343 X:110425132-110425154 GAAAATTAAAATTAAAATCAAGG + Intronic
1196004761 X:110823769-110823791 GAAAATAGAAAATATAGCCATGG + Intergenic
1196030458 X:111090825-111090847 GAAAGTAGAAAACAAAATCTAGG - Intronic
1196146316 X:112321235-112321257 TAAAATAGAAAATAAAATTTGGG + Intergenic
1196391742 X:115213965-115213987 AAAGATAGAAAATAAAATGATGG + Intronic
1196672269 X:118381541-118381563 AAGAAAAGAAAAGAAAAGCAAGG - Intronic
1196802220 X:119554078-119554100 CAGGATAGGAAAGAAAATCAAGG - Intronic
1196994304 X:121364427-121364449 GACAAGAGAAAAAAAAATAAAGG - Intergenic
1197200120 X:123741507-123741529 GAGAAATAAAAATAAAATCCTGG + Intergenic
1197419920 X:126226356-126226378 CAGAATAGAAAAATAAGTCATGG - Intergenic
1197451409 X:126623243-126623265 AAGAAAAGAAAAGAAATTCAGGG - Intergenic
1197474999 X:126911247-126911269 GTGAATAGAAAATTAAATTATGG + Intergenic
1197560763 X:128017628-128017650 TAGAATAGTAAATACAATAATGG + Intergenic
1198450658 X:136764391-136764413 GTGAATAGAAAAACAAAACATGG + Intronic
1198871934 X:141185280-141185302 GAAAATAGAAAGTATAAGCAAGG - Intergenic
1198961139 X:142184738-142184760 AGGAACAGAAAATAAATTCATGG + Intergenic
1199087382 X:143643446-143643468 GAGAATAGAAAAGTAAGTAAAGG - Intergenic
1199121934 X:144064934-144064956 GACAAGAGAAAAAAAAATAAAGG + Intergenic
1199132429 X:144207479-144207501 GAAAATAGTCAATAAAATAATGG - Intergenic
1199147440 X:144385512-144385534 TAGAATAGAAAACACAATCTTGG - Intergenic
1199354877 X:146850447-146850469 CTTAATAGAAAAGAAAATCATGG - Intergenic
1199375240 X:147100220-147100242 GAGCCTATAAAATAAAACCAAGG - Intergenic
1199466714 X:148146242-148146264 TAGGATAGAAGATAAAAACAAGG - Intergenic
1199519092 X:148714978-148715000 GAGAAACAAAAATAAAATAAAGG + Intronic
1199816914 X:151406000-151406022 AAGATACGAAAATAAAATCAAGG - Exonic
1199819824 X:151433380-151433402 GAGAATAGAAAACAAAGCCCTGG - Intergenic
1199840253 X:151639232-151639254 GAGAATAAAAAATAAACTTAGGG - Intronic
1200333035 X:155318212-155318234 CAGAAAAGAGAAAAAAATCAAGG + Intronic
1200372921 X:155746478-155746500 GAGAATAGAAAATTTAATTGAGG - Intergenic
1200411911 Y:2869345-2869367 GAGACTAGGAAACAAAGTCATGG - Intronic
1200416154 Y:2912473-2912495 GAGAAAACCAAATAACATCAAGG + Intronic
1200450441 Y:3320445-3320467 TAGAATAAAAAATAAAAGCGGGG - Intergenic
1200451187 Y:3330347-3330369 GTAATTAGAAAATAAAATTAAGG - Intergenic
1200525782 Y:4273472-4273494 TAGAATAAAAATTATAATCAAGG - Intergenic
1200833307 Y:7708951-7708973 GAAAATGGAAAATAAAAAAAAGG - Intergenic
1200968681 Y:9126486-9126508 GAGAAAACAAAATAAAACCCTGG - Intergenic
1201009813 Y:9539745-9539767 GAAAAAAGAAAAAAAAATGAAGG + Intergenic
1201058540 Y:10019778-10019800 GAAAAAAGAAAAAAAAGTCAAGG + Intergenic
1202142143 Y:21736021-21736043 GAGAAAACAAAATAAAAACCTGG + Intergenic
1202144722 Y:21767781-21767803 GAGAAAACAAAATAAAAACCTGG - Intergenic