ID: 916213127

View in Genome Browser
Species Human (GRCh38)
Location 1:162374354-162374376
Sequence GCCATGCCTGGATTTCTTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916213120_916213127 11 Left 916213120 1:162374320-162374342 CCATTAGGATGTCCTGGGATGTG 0: 1
1: 0
2: 2
3: 35
4: 141
Right 916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
916213116_916213127 22 Left 916213116 1:162374309-162374331 CCACCTGGAAGCCATTAGGATGT 0: 1
1: 0
2: 2
3: 12
4: 172
Right 916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
916213122_916213127 -1 Left 916213122 1:162374332-162374354 CCTGGGATGTGATGGAGTCCAGG 0: 1
1: 0
2: 1
3: 30
4: 202
Right 916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
916213117_916213127 19 Left 916213117 1:162374312-162374334 CCTGGAAGCCATTAGGATGTCCT 0: 1
1: 0
2: 3
3: 20
4: 179
Right 916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG 0: 1
1: 0
2: 0
3: 9
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916213127 Original CRISPR GCCATGCCTGGATTTCTTGG TGG Exonic
902482390 1:16718727-16718749 GCCCTGCCAGGCCTTCTTGGTGG - Intergenic
903340439 1:22651050-22651072 GCCATGCCTGGATTAGGAGGAGG - Intergenic
905768576 1:40623150-40623172 GCAATGCCAGCATTTCATGGGGG - Exonic
907541784 1:55222059-55222081 TCCATACCTGGATCTCTTGTGGG + Intergenic
911792294 1:102032726-102032748 GCCATGACTGGATTGCTTTCTGG + Intergenic
915590715 1:156868670-156868692 GCTCTGCCTGGACCTCTTGGGGG - Intronic
916213127 1:162374354-162374376 GCCATGCCTGGATTTCTTGGTGG + Exonic
917377425 1:174364546-174364568 GCCCGGCCTGGATTTCTTCATGG + Intronic
917790583 1:178496438-178496460 GCTTTTCCTGGCTTTCTTGGTGG + Intergenic
919947034 1:202327159-202327181 GCCATGCCTGCATTTTATAGAGG + Intergenic
921275144 1:213511703-213511725 CCCATGCCTGGATTTCCTTCTGG + Intergenic
922803815 1:228375718-228375740 GCCATGCCCGGATATCGGGGAGG + Exonic
923524287 1:234760261-234760283 GCCTTTCATGGACTTCTTGGGGG - Intergenic
923961288 1:239086467-239086489 GCTATGACAGGATTTCTTTGGGG + Intergenic
924641679 1:245839042-245839064 GCCACACCTGGCTTTCTGGGCGG + Intronic
1063979610 10:11443217-11443239 GCCAGGCAAGCATTTCTTGGTGG - Intergenic
1067677841 10:48400654-48400676 GTCATATCAGGATTTCTTGGGGG + Intronic
1069279560 10:66637948-66637970 ACCATGGCTGGATTACTTGAGGG + Intronic
1072141603 10:92593345-92593367 GCCGGGCCTTGATTTTTTGGCGG + Exonic
1072789896 10:98310314-98310336 ACCATGCCTGGCCTGCTTGGTGG - Intergenic
1074573091 10:114642881-114642903 GCAATACCTGGATGTCTTGAGGG + Intronic
1074987123 10:118668512-118668534 GCCAGACCTGGATTTGTGGGAGG + Intergenic
1075784811 10:125041952-125041974 CCCATGTCTGGCTTTTTTGGGGG + Intronic
1076445340 10:130510241-130510263 GCCATGCCTGGATGCCCCGGAGG + Intergenic
1076579672 10:131498897-131498919 GCCTGGCCTGTATTTTTTGGAGG - Intergenic
1078420143 11:11204729-11204751 GCCATTCCTGGATCTGTTGGGGG + Intergenic
1079057604 11:17220146-17220168 TCCATCCATGGATTTCTTTGGGG + Intronic
1081332591 11:41822960-41822982 TCCATGCCTGGCTTTCTCTGAGG - Intergenic
1081962475 11:47148480-47148502 TCCATGACTGGACTTCTTTGAGG - Intronic
1089187478 11:116629296-116629318 GCCATGCCTGGATTTTATTTTGG - Intergenic
1092001951 12:5040018-5040040 ACCATGCCTGGGTTTCCTGGTGG + Intergenic
1095993211 12:48053321-48053343 ACCATGCCTGGCTTTTTTGTTGG - Intronic
1096388406 12:51210783-51210805 GCTCTGCCTGGATTTCTGGTGGG - Intronic
1096483832 12:51962627-51962649 GCAATGTGTGGCTTTCTTGGGGG - Intronic
1099870001 12:88335304-88335326 CCCATTCCTGGACTTCTTCGGGG + Intergenic
1104098670 12:125585276-125585298 GCCCTGCCTGGGGTTCCTGGTGG + Intronic
1108154959 13:47575570-47575592 GCCATGCCTAGAGTTCTTCCTGG - Intergenic
1110048388 13:70860486-70860508 GCTATGCCTGGATGTCCAGGCGG - Intergenic
1113140173 13:107138729-107138751 GCAATGCCTGGAAATGTTGGGGG - Intergenic
1113527406 13:110991840-110991862 GCCAAGCATGGATGACTTGGGGG + Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1116694073 14:48150097-48150119 GAAATGCCTGGATGTCTAGGCGG + Intergenic
1117855789 14:60031307-60031329 GACATGCCTGTATTCCTTTGTGG - Intronic
1118150156 14:63180346-63180368 GTTTTGCCTGGACTTCTTGGGGG - Intergenic
1119537893 14:75417914-75417936 GCCATGGCTGGACATCTTGCTGG + Intergenic
1120130941 14:80807226-80807248 GCCATGTCTTGAATTCTTAGTGG - Intronic
1120805176 14:88739417-88739439 GTCATGCCTTGATATTTTGGGGG - Intronic
1125326693 15:38542412-38542434 TCCATCCCTGGATCTCTTGATGG - Intronic
1125716034 15:41820407-41820429 CCCTGGGCTGGATTTCTTGGGGG + Intronic
1128773514 15:70301560-70301582 GGCCTGCTTGGAATTCTTGGTGG - Intergenic
1129449446 15:75642237-75642259 GCCATGTGTGGATATCTAGGGGG + Intronic
1131059523 15:89395968-89395990 GCCCTGCCTGGTCTCCTTGGGGG - Intergenic
1131538693 15:93258258-93258280 GCCATACATGGCTTTCTTGATGG - Intergenic
1132647865 16:1007387-1007409 GCCATGCCTGGTGTTCGGGGAGG - Intergenic
1136002397 16:27304813-27304835 GGCATGCCAAGATTTCATGGTGG - Intergenic
1136099292 16:27981612-27981634 ACCATGCCTTGATTTCTGGCAGG + Intronic
1138089609 16:54163474-54163496 GACGTGCCTGGCTTTCTGGGTGG - Intergenic
1138285866 16:55809879-55809901 TCCATGCCTGGAGTTATTGTGGG - Intronic
1140224154 16:73065312-73065334 CCCATGCTTGCATTTCTTGCAGG + Intergenic
1140254216 16:73321029-73321051 GCCATGACAGGATCTCCTGGGGG - Intergenic
1142208377 16:88794913-88794935 ACCATGCCTGGCCTTCTTGTTGG + Intergenic
1144465369 17:15492943-15492965 GCCATGCCTTGCTCTCTGGGAGG - Intronic
1147331278 17:39700710-39700732 GCCTGGGCTGGATTCCTTGGGGG + Intronic
1147690163 17:42309920-42309942 GCCAGGGCTGGATGTCTGGGAGG + Intronic
1149655814 17:58309067-58309089 GACATGCCTGGATTAGTTGGTGG - Exonic
1152640579 17:81447643-81447665 ACCAGGCCTGGATGCCTTGGTGG + Exonic
1157816955 18:50736480-50736502 GCCATGACTGGATGACATGGAGG - Intergenic
1159884563 18:73891763-73891785 GCCAAGGCTGGCTTTCTCGGGGG + Intergenic
1160169256 18:76539229-76539251 GGCATGCATTGCTTTCTTGGGGG + Intergenic
1162319623 19:9963544-9963566 ACCATGCCTGTTTTTTTTGGGGG + Intronic
1164473088 19:28552241-28552263 GACATGCTTGGTCTTCTTGGTGG + Intergenic
1165676983 19:37734668-37734690 ACCATGCCTGGGTTTCATGTAGG + Intergenic
1165947557 19:39453477-39453499 TCCATGGCGGGGTTTCTTGGGGG - Exonic
927553197 2:24016497-24016519 GCCAGGCCTGGGAGTCTTGGAGG - Intronic
928085505 2:28344103-28344125 GCCATCCCTGGGTTGCTTGTGGG - Intergenic
928394831 2:30935526-30935548 GTTATGCCTGGAATTATTGGAGG + Intronic
931769071 2:65481942-65481964 GCCCAGCCTGGATTCCTGGGAGG - Intergenic
932859706 2:75277201-75277223 GCCAGACCTTGATTTCATGGGGG + Intergenic
933797331 2:85930173-85930195 GCCCTGGCTATATTTCTTGGAGG - Intergenic
942856883 2:180559702-180559724 CCTATGCCTGGATTTCTGTGAGG - Intergenic
946233773 2:218309532-218309554 GCCATGCCTGTAACTCTGGGAGG - Intronic
947415744 2:229893857-229893879 GCCATGCCTGGCTTTCCTTGTGG + Intronic
948050133 2:234973932-234973954 GCCAAGCCTGGATTTTTGGGGGG + Intronic
948423528 2:237874690-237874712 GCCATACCCGGATTTCTCAGTGG - Intronic
948684982 2:239664655-239664677 GCCATGCCTGGGTGTGTGGGAGG + Intergenic
1168889653 20:1286569-1286591 GGCATGCCTGGAACTGTTGGTGG + Intronic
1172168351 20:32912931-32912953 TCCATTCCTGGCTTTCCTGGTGG + Intronic
1172697312 20:36831597-36831619 GCCATGCCTGGTTTCCTTTCTGG - Intronic
1173131391 20:40397498-40397520 TCTCTGGCTGGATTTCTTGGAGG - Intergenic
1173182663 20:40816419-40816441 GCCATGACTGCATTTCTCTGTGG + Intergenic
1173538524 20:43833775-43833797 GCCATTCCTGGATTTCTACAAGG + Intergenic
1174236740 20:49099943-49099965 GTCATTGCTGGATGTCTTGGAGG + Intergenic
1184496132 22:44842687-44842709 GCCCAGCCTGGCTTCCTTGGGGG + Intronic
949319554 3:2793999-2794021 GCCATGCATATTTTTCTTGGTGG + Intronic
949718406 3:6960512-6960534 GGGATGCTTGGATTTTTTGGTGG - Intronic
954213014 3:49108887-49108909 GCCATGCCTGCCTTTGTTGTGGG - Exonic
954244358 3:49318942-49318964 TCCATGGATGGATTCCTTGGTGG - Intronic
954629854 3:52041930-52041952 CCCATCCCTGGAGGTCTTGGTGG - Intergenic
956067101 3:65408426-65408448 GCCATGCTTTTATTTGTTGGGGG + Intronic
956798212 3:72734968-72734990 GCCAGGCGTGGATTTCTCAGTGG + Intergenic
960973845 3:123157198-123157220 GGCCTGCCTGGGTTTCCTGGAGG + Intronic
964200048 3:154108846-154108868 CCCATGCCTCCATTTCTTTGTGG - Intergenic
966383423 3:179367459-179367481 AAGATGCCTGCATTTCTTGGTGG + Exonic
968577683 4:1375601-1375623 GCCTTTTCTGGATATCTTGGTGG + Intronic
976932248 4:90582035-90582057 CCCATTTCTGCATTTCTTGGTGG + Intronic
980201294 4:129658799-129658821 GACATGCCTGGATGTCCAGGCGG - Intergenic
980880123 4:138701309-138701331 GGCATGGCTGGGTTTTTTGGAGG + Intergenic
985614773 5:913049-913071 TCCAGGCATGGTTTTCTTGGGGG + Intronic
985716410 5:1464427-1464449 ACCATCCCTGGATTTCTCGCCGG - Intronic
985897647 5:2758619-2758641 GACATGCTTGGATTTTTTAGAGG - Intergenic
986666710 5:10110767-10110789 GACTTGTCTGTATTTCTTGGGGG - Intergenic
987530591 5:19114173-19114195 GCTATCTTTGGATTTCTTGGGGG - Intergenic
989367639 5:40674723-40674745 ACCATGCCTGAATTTCCTGCTGG - Intergenic
990782930 5:59386557-59386579 GCAATCCCAGGATTTCTGGGAGG + Intronic
991976588 5:72189282-72189304 ACCATCCCTGGATTTCAGGGAGG - Intronic
991985692 5:72284267-72284289 ACCATGCCTGGCCTTTTTGGTGG - Intronic
992123001 5:73613794-73613816 GCCCTACCTGGACTTATTGGTGG - Intergenic
993218395 5:85056930-85056952 TACATGCCTGAATTTCATGGTGG - Intergenic
993516077 5:88836576-88836598 GCCCTGCCTGGATTGTATGGAGG - Intronic
995165144 5:109030997-109031019 GCCATCCCAGTATTTCTTGGTGG + Intronic
997862759 5:137433361-137433383 GCCATGTCTTTATTTCATGGAGG + Intronic
998208900 5:140178889-140178911 ACCATGCCTGGACTTTTTGCTGG + Intronic
998396543 5:141822244-141822266 GCCTTGGCTGGAATTCTGGGTGG + Intergenic
999261645 5:150242120-150242142 CCCAGGCCTGGACTTCTAGGAGG - Intronic
1006473094 6:34238851-34238873 GGCCTGCCTGGAGATCTTGGCGG - Intronic
1007836557 6:44678402-44678424 GCCAGCCCTGGGTTTCTTGCAGG - Intergenic
1008631449 6:53366173-53366195 GAAATGCCTGGATGTCTAGGTGG - Intergenic
1013079842 6:106802486-106802508 GCCATGCCAGGATTTTTTGCTGG - Intergenic
1014567904 6:122973130-122973152 GACTTGCCTGGATTTATTGTGGG - Intergenic
1018391668 6:163345954-163345976 CCCATGCCTGAATTGCATGGAGG - Intergenic
1018826413 6:167410647-167410669 GCCCTGCCTTGCTTTCTGGGCGG - Intergenic
1022749169 7:33205219-33205241 ACCATGGCTGTATTCCTTGGTGG + Intronic
1031539523 7:122976795-122976817 GACATTCCTGGTTTTGTTGGGGG - Intergenic
1032264131 7:130359004-130359026 GCCATGCCTGGCTTTCTGAATGG + Intronic
1033673376 7:143513791-143513813 GAGATGCCTGGCTTTCTTGGAGG + Intergenic
1036658228 8:10691284-10691306 GCCGTGCCTGGGTGTCCTGGCGG - Intronic
1037201434 8:16257787-16257809 GCCAAACCTGGATTTGGTGGTGG + Intronic
1038056618 8:23864354-23864376 CCCATGGCTTGTTTTCTTGGAGG + Intergenic
1038288676 8:26228704-26228726 GGCATGGCTGGGTTGCTTGGGGG + Intergenic
1039573034 8:38602229-38602251 TCCGGGCCTGGCTTTCTTGGGGG + Intergenic
1040469350 8:47724413-47724435 GCCTTGCCTGGATCTGATGGAGG - Intronic
1044199102 8:89413240-89413262 GCCATGCCTGGCTTGCATGCTGG + Intergenic
1049201400 8:141342221-141342243 GCCAGGGCTGGCTTCCTTGGAGG - Intergenic
1049308829 8:141922653-141922675 GCCATGCCTTGGTGTCCTGGGGG - Intergenic
1049771889 8:144386654-144386676 GCCATGCCTGGAGTTTTTGTTGG + Intronic
1051867231 9:21696121-21696143 GGCATGCCTGGACCCCTTGGAGG - Intergenic
1053019948 9:34687846-34687868 GCCATGGCTGGCTGGCTTGGTGG + Intergenic
1057073152 9:92117928-92117950 GCCACGCCTGCATTTCTCAGAGG + Intergenic
1061083436 9:128385781-128385803 CCCATGCCTGGATTTGGGGGTGG - Intronic
1061083775 9:128387434-128387456 GCCATGGCTGGACTTCTGAGAGG - Intronic
1061571075 9:131477757-131477779 GCCTTGCCTGGAGGTCTTAGTGG + Exonic
1185890336 X:3816424-3816446 GCCCTGCGCGGAGTTCTTGGTGG + Intergenic
1189186905 X:39062587-39062609 GGTATGCCTGGAATTCTTGCTGG - Intergenic
1190726840 X:53195374-53195396 CCCCTGCCTGGATGACTTGGAGG - Exonic
1192233859 X:69284123-69284145 GCCCTGCCTGGCTGTCTGGGAGG + Intergenic
1192366267 X:70476194-70476216 GCGATGACTGGATATCTTTGTGG + Intronic
1195482169 X:105358307-105358329 GCTATGACTGGATATCTAGGAGG + Intronic
1199709156 X:150456212-150456234 TACATGCCTGGGGTTCTTGGGGG + Intronic
1199969896 X:152852040-152852062 GGCATGGCTGGATGTCTGGGTGG - Intronic