ID: 916214391

View in Genome Browser
Species Human (GRCh38)
Location 1:162383291-162383313
Sequence TACTCCAGACTGCTGAGGAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916214391_916214395 -2 Left 916214391 1:162383291-162383313 CCTGTCCTCAGCAGTCTGGAGTA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 916214395 1:162383312-162383334 TATGGGACAGAGCCATCACCTGG 0: 1
1: 0
2: 0
3: 10
4: 131
916214391_916214397 3 Left 916214391 1:162383291-162383313 CCTGTCCTCAGCAGTCTGGAGTA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 916214397 1:162383317-162383339 GACAGAGCCATCACCTGGGCAGG 0: 1
1: 0
2: 2
3: 41
4: 421
916214391_916214398 9 Left 916214391 1:162383291-162383313 CCTGTCCTCAGCAGTCTGGAGTA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 916214398 1:162383323-162383345 GCCATCACCTGGGCAGGCCCAGG 0: 1
1: 0
2: 6
3: 82
4: 741
916214391_916214396 -1 Left 916214391 1:162383291-162383313 CCTGTCCTCAGCAGTCTGGAGTA 0: 1
1: 0
2: 0
3: 8
4: 141
Right 916214396 1:162383313-162383335 ATGGGACAGAGCCATCACCTGGG 0: 1
1: 0
2: 2
3: 17
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916214391 Original CRISPR TACTCCAGACTGCTGAGGAC AGG (reversed) Exonic
900312896 1:2043030-2043052 TCCTCCAGCCTGGTGTGGACGGG + Intergenic
902939929 1:19793704-19793726 TCCTCCAGACTGCTGAAGCGAGG - Intronic
904467370 1:30716317-30716339 CACTGCAGACTGTGGAGGACAGG + Exonic
905601767 1:39258272-39258294 ATAACCAGACTGCTGAGGACAGG - Intronic
909611628 1:77557150-77557172 TACTGCAGAATTCTGAGGAAGGG - Intronic
913451392 1:118994985-118995007 TCCTCCAGGCTGCCGAGGTCAGG + Intergenic
916030899 1:160876760-160876782 ATCTCCACACTGCTGGGGACTGG + Exonic
916214391 1:162383291-162383313 TACTCCAGACTGCTGAGGACAGG - Exonic
916935747 1:169626545-169626567 CACTCCAGCCTGCTGAAGATTGG + Intronic
917431562 1:174974852-174974874 CAGCCCAGTCTGCTGAGGACTGG - Intronic
917524268 1:175773396-175773418 GACACCAGGCTGCTGAGGAAGGG + Intergenic
918233311 1:182555406-182555428 TATTCCAGGCTGCTCAGGGCAGG + Intronic
920224642 1:204429763-204429785 TGCTCCAGTCTGCAGAAGACAGG - Intronic
924419959 1:243898521-243898543 TTCTCCTGAATGCTGAGGACTGG - Intergenic
1065338159 10:24676350-24676372 TACTGCATGCTGCTGAGGACTGG + Intronic
1067701653 10:48577541-48577563 TACTCCTGACTGCTGGGGCTTGG + Intronic
1071964878 10:90842497-90842519 TACTCCTGGGTGATGAGGACAGG - Intronic
1074557815 10:114508054-114508076 GAGTCCAGACTGCTGAGCAACGG - Intronic
1075909166 10:126108394-126108416 TAGTCCAGACTGCTGTGGTTTGG + Intronic
1076599959 10:131650971-131650993 AACTCCTGACTGCCGAGCACAGG + Intergenic
1076809616 10:132879750-132879772 TGCTCCACTCTGCTGAGGGCCGG + Intronic
1077141789 11:1028017-1028039 TGCTCCATGCTGCTGAGGACAGG - Exonic
1081979848 11:47259452-47259474 AAATCCAGACTGGGGAGGACTGG - Intronic
1082802573 11:57425656-57425678 TACTCCAGACTGCAAAGCCCAGG - Exonic
1082811929 11:57483490-57483512 GTCTCCAGACCCCTGAGGACAGG + Intergenic
1084466639 11:69327166-69327188 TACTCAAGTTTGCTGAGGATTGG + Intronic
1084522099 11:69669770-69669792 TTCACCAGACTGCTGAAGCCGGG + Intronic
1086557471 11:88128108-88128130 TACTCAGGACAGCTTAGGACAGG + Intronic
1090264416 11:125345006-125345028 TCCTCCAGTCTGCTGAGGTCAGG - Intronic
1090612532 11:128484252-128484274 TTCACCACACTGCTGATGACTGG + Intronic
1090747680 11:129720358-129720380 TAATGCAGGGTGCTGAGGACAGG - Intergenic
1091049625 11:132355621-132355643 TACCCCTGACTGCTGATGCCTGG - Intergenic
1091062279 11:132474727-132474749 TGCTCCACCCTGGTGAGGACAGG - Intronic
1091168453 11:133500728-133500750 AACTCCAGCCTGCTGGGGTCAGG - Intronic
1093317260 12:17666856-17666878 CCCTCCAGACTGCTGATGAGTGG - Intergenic
1100694325 12:97075089-97075111 TACTCAACAGGGCTGAGGACAGG + Intergenic
1100869728 12:98897027-98897049 GACTCTAGAGTGCAGAGGACTGG - Intronic
1104625308 12:130348537-130348559 TACTGCATAATGCTGAGGTCTGG - Intronic
1105370557 13:19798263-19798285 TACTGCAGCCTCCTGAGTACTGG - Intergenic
1106129037 13:26924212-26924234 TAGTTCAGACAGCTGATGACTGG - Intergenic
1107239585 13:38215910-38215932 TACTCAAAACTGCTGTGGAATGG + Intergenic
1110270881 13:73588912-73588934 TACTGCATACTGCTGGGGACTGG - Intergenic
1111653845 13:91128557-91128579 TGCTCAAGTCTGCTGATGACTGG + Intergenic
1111953559 13:94731147-94731169 TTCTCCAGCTTGCTGATGACAGG - Intergenic
1112789155 13:102984629-102984651 TATTCCAGACTGCTTATGACAGG - Intergenic
1114285064 14:21233643-21233665 TCCTCCAGTCTGCTGTGGGCAGG + Intronic
1117207864 14:53463260-53463282 TAGTCCACACTGCCGAGCACTGG - Intergenic
1117627558 14:57655449-57655471 GACTCCACAGCGCTGAGGACAGG - Intronic
1118716508 14:68563871-68563893 TACTCAAGGCTGCAGAGCACAGG - Intronic
1119331823 14:73800601-73800623 TCCACCAGACAGCTGGGGACAGG - Intergenic
1120106297 14:80499184-80499206 TACTCTATAAGGCTGAGGACAGG + Intronic
1126088464 15:45030805-45030827 CTCTCCAGCCTGGTGAGGACAGG + Intronic
1126431372 15:48588879-48588901 TCCTCCAGACTTCTGGGGATAGG - Intronic
1127066084 15:55240320-55240342 TACTCCAGCCTACTGAGGTTTGG + Intronic
1128397735 15:67245940-67245962 AACTCCAGCCTGCTGAGATCAGG - Intronic
1131156030 15:90076143-90076165 TGATCCAGACTGCAGAGGGCTGG + Intronic
1133398643 16:5468556-5468578 TACCCCAAATTGCTGAGAACAGG + Intergenic
1134122973 16:11597759-11597781 TCCTTCAGACTGCGGAGGGCAGG - Intronic
1134505051 16:14798412-14798434 CACTCCAGACTCCTCAGCACAGG - Intronic
1134575524 16:15330497-15330519 CACTCCAGACTCCTCAGCACAGG + Intergenic
1134726921 16:16426003-16426025 CACTCCAGACTCCTCAGCACAGG - Intergenic
1134940516 16:18285860-18285882 CACTCCAGACTCCTCAGCACAGG + Intergenic
1135239740 16:20793704-20793726 TATTCCAGGCAGCTGAGGGCAGG + Intronic
1135816181 16:25636061-25636083 AACTCCAGGCTGCTGTGGTCAGG + Intergenic
1139106913 16:63837046-63837068 TATTCGAGAATGCTGATGACAGG - Intergenic
1142691625 17:1609884-1609906 TATTCCAAACTGATGAAGACAGG + Intronic
1143967892 17:10770016-10770038 AACGCCAGCCTGCTGAGTACTGG - Intergenic
1144577749 17:16439670-16439692 CACTGCAGAGTGCTGAAGACGGG + Intergenic
1145838745 17:27975812-27975834 AATTCCAGATTGCTGAGGCCAGG + Intergenic
1146627077 17:34442953-34442975 CACTCCAGAGTGCTGAGGAGGGG - Intergenic
1154032492 18:10765961-10765983 TTCTCTAGGATGCTGAGGACAGG - Intronic
1161306401 19:3571525-3571547 TACTCCAGACAACTGAAAACAGG - Intronic
1162507046 19:11091751-11091773 TCCTCCAGACTTCTGAGAGCTGG + Intronic
1164709923 19:30348557-30348579 TGCTCCTGAGTCCTGAGGACTGG + Intronic
1166920682 19:46227103-46227125 TTCTCCAGACACTTGAGGACAGG + Intergenic
1167373387 19:49098191-49098213 TAATCCAGGCTGCTGAGGAGAGG - Intronic
1168397655 19:56062804-56062826 TAATTCATACTGCTTAGGACAGG - Intergenic
929401494 2:41587443-41587465 TATTGCATACTGCTGAGGCCTGG + Intergenic
929806651 2:45152454-45152476 CACCACTGACTGCTGAGGACAGG - Intergenic
930599292 2:53424896-53424918 GGATCCAGACTGCTGAGGAGTGG - Intergenic
932271475 2:70413788-70413810 TTCCCCAGAGAGCTGAGGACTGG + Intergenic
932688496 2:73893201-73893223 TACTGCAGCCTGCTGAGAAAAGG + Intronic
934969189 2:98749322-98749344 TACTCAAGGCTGCTGACAACAGG - Intergenic
936295015 2:111261316-111261338 TCCTGCATACTGCTGAGGCCAGG - Intergenic
947620891 2:231590407-231590429 TAGTCCAGTCTGCTGGGGCCTGG + Intergenic
947629185 2:231640867-231640889 TACCCCAGACTGATCAGGTCGGG - Intergenic
1168874916 20:1164765-1164787 TACCCAAGACTGCTGAAGAAAGG - Intronic
1172298195 20:33828890-33828912 CCCTCCAGACTGCTGAGTGCTGG - Intronic
1173422581 20:42915549-42915571 TACTCCTCACAGCTGGGGACAGG + Intronic
1174782189 20:53400054-53400076 TACTGTAGAGTGCTGAGCACAGG + Intronic
1176102274 20:63369967-63369989 TACCCCAGGCTTCTGAGGCCGGG + Intronic
1179526897 21:41984843-41984865 TATTCCAGACTGCAGGAGACTGG + Intergenic
1183291852 22:37007512-37007534 CCGTCCAGACTGCTGTGGACTGG - Exonic
1184678349 22:46055355-46055377 TGCTCCAGCCTGCGGTGGACAGG + Intronic
1184873087 22:47253313-47253335 TTCTCCAGAGAGCTGATGACAGG + Intergenic
949860734 3:8502471-8502493 TACTTCAGCCACCTGAGGACAGG - Intronic
952378392 3:32785582-32785604 TACTCCAGCCTGGTGAAGAGAGG + Intergenic
954430870 3:50470305-50470327 TCCTCCAGGCTGCTGAGGCTGGG - Intronic
954637532 3:52079365-52079387 GTCTCCAGCCTGGTGAGGACAGG - Intronic
957376525 3:79365966-79365988 TCTTCCAGACTTCTCAGGACAGG + Intronic
959878015 3:111409081-111409103 TACTCCAGACAGCACAAGACAGG + Intronic
961259632 3:125591107-125591129 TACTCCATATCTCTGAGGACTGG + Intronic
964171916 3:153781047-153781069 TCCGCCAGACTCCTGAGGAAGGG - Intergenic
967076452 3:186007513-186007535 TCCTGCAGACTTCTGAGAACTGG + Intergenic
968010571 3:195271319-195271341 GACTCCAGCGTGCTGAGGGCTGG + Intergenic
975968047 4:79999523-79999545 TTCACCAGACTGCTAAGGAGTGG - Intronic
992388350 5:76307508-76307530 GACTCCATTCTGCTTAGGACTGG + Intronic
993250766 5:85519259-85519281 GAGCCAAGACTGCTGAGGACTGG - Intergenic
1000095362 5:157966743-157966765 TGTTCCAGAGTGGTGAGGACTGG - Intergenic
1002092445 5:176813238-176813260 TGCTCAAGACTGCAGAGGTCTGG - Intronic
1004437611 6:15612382-15612404 TACTGCAGAATGCAGTGGACTGG + Intronic
1006645233 6:35511075-35511097 TCCTCCAGACTGCTGGGAAGTGG + Intronic
1006989877 6:38206027-38206049 TAGTCCAGACTGCAGAGGGAAGG + Intronic
1015697127 6:135993086-135993108 TTGACCAGACTGCAGAGGACGGG - Intronic
1017762374 6:157579886-157579908 TCCTCCTGACTGCTCTGGACAGG + Intronic
1018051839 6:160016088-160016110 TAATACAGACTGCTTGGGACTGG + Intronic
1018706363 6:166466296-166466318 CATTCCAGAATGCTGAGGTCCGG - Intronic
1018756135 6:166851206-166851228 TCCTCCTGCCTGCAGAGGACTGG - Intronic
1023058634 7:36309480-36309502 TACTCCAGACACCTGAGGCTGGG - Intergenic
1023941295 7:44769731-44769753 TTCTCCAGTCTTCTGAGGATGGG - Exonic
1026065601 7:67069627-67069649 TACTCCAGAAGGCTGAGGTGGGG + Intronic
1026711273 7:72742237-72742259 TACTCCAGAAGGCTGAGGTGGGG - Intronic
1027497555 7:78907108-78907130 TACTGCAAACTACTGAAGACAGG + Intronic
1028452362 7:90999604-90999626 TACCCCAGAGTACTGATGACAGG - Intronic
1028476642 7:91261039-91261061 TTCTCCAGACTGCTTATGTCAGG - Intergenic
1029248719 7:99221023-99221045 CAGTCCAGGCTGCTGAAGACAGG - Intergenic
1030078053 7:105753634-105753656 TACAGCAGACAGCTGAAGACAGG + Intronic
1032510485 7:132468087-132468109 TATTCCAGAGAGCTAAGGACTGG - Intronic
1032704108 7:134407194-134407216 TTCTCCTGTCTGCTGAGTACAGG + Intergenic
1035039490 7:155917107-155917129 TCCCCCAGAGTGCTGAGGAGAGG - Intergenic
1041971376 8:63746918-63746940 GACTCCTGCTTGCTGAGGACAGG - Intergenic
1043280375 8:78457683-78457705 TGCTCCAGATTGCAGAGGAAAGG - Intergenic
1044535940 8:93356510-93356532 TAATCCTGATCGCTGAGGACAGG + Intergenic
1044646601 8:94449974-94449996 TAGTCCAGTCTGCTGAAGAAGGG - Intronic
1045342963 8:101270652-101270674 TTCTCCAGACTGCAGTTGACAGG + Intergenic
1046048673 8:108994117-108994139 TTGTCCAGACTGGTGAGGAATGG - Intergenic
1049157378 8:141075321-141075343 GACTCCAGGCTGCTGCGGCCAGG - Intergenic
1049434914 8:142582051-142582073 ACCTCCAGACTGTTGAGAACTGG - Intergenic
1049933745 9:480863-480885 TGGACCAGACTGCAGAGGACTGG + Intronic
1054821860 9:69530652-69530674 TACTGCATACTGGTGGGGACTGG - Intronic
1054866502 9:70007661-70007683 AACTCCAGACTGCTCAGTTCTGG + Intergenic
1056839540 9:89987304-89987326 CCCTCCAGAGAGCTGAGGACTGG + Intergenic
1060303803 9:122392589-122392611 CATTCCAGAGTGCTGAGGCCAGG + Exonic
1060779848 9:126403352-126403374 GACTCCAGAATGCTTAGGATTGG + Intronic
1189195387 X:39148075-39148097 TACTCCTGACTGCTGACAAGTGG - Intergenic
1190757215 X:53411639-53411661 TAATCCAAAATGCTTAGGACCGG + Intronic
1198032283 X:132765049-132765071 TACTACAGAGTGCTAAGCACTGG + Intronic
1198173614 X:134132171-134132193 TACTCCAGGCTGGTGTGGTCTGG + Intergenic
1202347917 Y:23954580-23954602 TGCTTCAGATTGCTGGGGACAGG + Intergenic
1202522856 Y:25715524-25715546 TGCTTCAGATTGCTGGGGACAGG - Intergenic