ID: 916218507

View in Genome Browser
Species Human (GRCh38)
Location 1:162419894-162419916
Sequence CCCAGAGGGTACCCGGAGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916218507_916218515 -9 Left 916218507 1:162419894-162419916 CCGGACTCCGGGTACCCTCTGGG No data
Right 916218515 1:162419908-162419930 CCCTCTGGGTGGTGTGGGGCTGG No data
916218507_916218521 26 Left 916218507 1:162419894-162419916 CCGGACTCCGGGTACCCTCTGGG No data
Right 916218521 1:162419943-162419965 GTAAACAAGATGAGTCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916218507 Original CRISPR CCCAGAGGGTACCCGGAGTC CGG (reversed) Intergenic
No off target data available for this crispr