ID: 916220600

View in Genome Browser
Species Human (GRCh38)
Location 1:162440954-162440976
Sequence CCGACTCTGTAGCAGCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916220600_916220611 21 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220611 1:162440998-162441020 GCAGGGCAGATGGAGGACCATGG No data
916220600_916220610 14 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220610 1:162440991-162441013 AGGGACAGCAGGGCAGATGGAGG No data
916220600_916220604 -6 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220604 1:162440971-162440993 AGTCGGCTCACATTTACACCAGG No data
916220600_916220612 26 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220612 1:162441003-162441025 GCAGATGGAGGACCATGGACAGG No data
916220600_916220605 -5 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220605 1:162440972-162440994 GTCGGCTCACATTTACACCAGGG No data
916220600_916220606 3 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220606 1:162440980-162441002 ACATTTACACCAGGGACAGCAGG No data
916220600_916220607 4 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220607 1:162440981-162441003 CATTTACACCAGGGACAGCAGGG No data
916220600_916220608 11 Left 916220600 1:162440954-162440976 CCCTCCTGCTGCTACAGAGTCGG No data
Right 916220608 1:162440988-162441010 ACCAGGGACAGCAGGGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916220600 Original CRISPR CCGACTCTGTAGCAGCAGGA GGG (reversed) Intergenic
No off target data available for this crispr