ID: 916227507

View in Genome Browser
Species Human (GRCh38)
Location 1:162504033-162504055
Sequence CCTGGCAGCTGCCTTTTCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 692
Summary {0: 1, 1: 0, 2: 6, 3: 75, 4: 610}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916227507 Original CRISPR CCTGGCAGCTGCCTTTTCAC TGG Intronic
900098521 1:951001-951023 CCTGGCCGCCTCCTTGTCACGGG - Intronic
902120085 1:14157574-14157596 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
903786225 1:25863025-25863047 CCTGGCAGCTGCCATGTCTTCGG - Exonic
903969342 1:27108872-27108894 CGTGGCATCTGCCATTACACAGG + Intronic
904351040 1:29906886-29906908 CCTGGCAGTAACCTTTTAACTGG - Intergenic
904473602 1:30750789-30750811 CGTGGCAGCTGCCATTTTTCCGG + Intronic
905397959 1:37679546-37679568 CATCGCAGCTGCCTTTCCCCAGG + Intergenic
905942611 1:41875718-41875740 CCTGGCAGGTGCCCCGTCACTGG + Intronic
906020983 1:42629373-42629395 TCTGGCAGCAGACTTTTCAGTGG - Intronic
906269105 1:44460369-44460391 CCTGGTACCTGCAGTTTCACTGG + Intronic
906826862 1:48991331-48991353 TCTGGCAGCCGACTTTTCAGTGG - Intronic
906903399 1:49862685-49862707 CCTGGCGGCAGACTTTTCAGTGG + Intronic
906915688 1:50006597-50006619 CCTGGCAGCAGACTTTTCAATGG + Intronic
907066823 1:51492809-51492831 CCTGACAGCTGCCATTTGAGGGG - Intronic
907942363 1:59101070-59101092 CATGGCAGCTGGCTTCTCTCAGG - Intergenic
908253932 1:62287060-62287082 TCTGGCAGCTGCCTGCTCCCTGG - Intronic
908598802 1:65717143-65717165 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
909182138 1:72438172-72438194 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
909386782 1:75067369-75067391 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
909615991 1:77608298-77608320 TCTGGCAGCAGACTTTTCAGTGG + Intronic
910547549 1:88434811-88434833 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
910716222 1:90234437-90234459 CCTGGCAGAAGACTTTTCAGTGG - Intergenic
910819064 1:91326402-91326424 TCTGGCAGCAGACTTTTCAGTGG + Intronic
910821216 1:91349518-91349540 CATGGCAGCTGACTTTTCTCAGG - Intronic
911496688 1:98639503-98639525 CCTGGCAGCAGATTTTTCAGTGG + Intergenic
911512925 1:98829072-98829094 CATGGCAGCTGGCTTTTCCTGGG - Intergenic
911949914 1:104159623-104159645 CCTGACAGCTGACTTTTCAGTGG + Intergenic
911987985 1:104655934-104655956 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912031655 1:105253524-105253546 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912036420 1:105322855-105322877 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
912633062 1:111265822-111265844 TCTGGCAGCAGACTTTTCAATGG - Intergenic
913032357 1:114921986-114922008 TCTGGCAGCAGACTTTTCAATGG - Intronic
914241949 1:145858524-145858546 CCTCTCAGCTGCCTTTCCCCCGG + Intronic
916074607 1:161193251-161193273 CCTGGCAGGTGAGTTTGCACTGG + Exonic
916227507 1:162504033-162504055 CCTGGCAGCTGCCTTTTCACTGG + Intronic
916830386 1:168485196-168485218 CCTGGCAGCTTCCTTAACACTGG - Intergenic
917246165 1:173003658-173003680 TCTGGCAGCAGTCTTTTCAGTGG - Intergenic
917579825 1:176364575-176364597 CCTGGCAGCTTTCTTTCCACTGG + Intergenic
917986421 1:180324950-180324972 TCTGGCAGCAGACTTTTCAGTGG - Intronic
918018544 1:180662472-180662494 TCTGGCAGCAGACTTTTCAGTGG - Intronic
918321443 1:183368979-183369001 CCTGACAGCTGCCTAATCACGGG + Intronic
918415892 1:184308494-184308516 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
918666043 1:187152849-187152871 TCTGGCACCAGCCTTTTCAGTGG - Intergenic
919346478 1:196386040-196386062 TGTGGCAGCTGGCTTTTCCCAGG - Intronic
920400436 1:205672864-205672886 CCCGGCAGTTGCTTCTTCACGGG + Intronic
920549847 1:206849219-206849241 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
920923954 1:210324492-210324514 TCTGGCAGCAGACTTTTCAGGGG - Intergenic
921072975 1:211677316-211677338 TCTGGCAGCAGCCTTTTCTCTGG - Intergenic
921179213 1:212618562-212618584 GCTGGCAGCTTCCTTTTCTCAGG - Intronic
922065682 1:222137933-222137955 GCTGGCAGCGGACTTTTCAATGG + Intergenic
922319923 1:224478011-224478033 TCTGGCAGCAGACTTTTCAGTGG - Intronic
922394255 1:225179961-225179983 TCTGGCAGCAGACTTTTCATTGG - Intronic
923434641 1:233956645-233956667 CCTGCCAGCTGCCTTTTGAATGG + Intronic
1063954234 10:11251338-11251360 CCTGGCAGCTGCCTGTAGAAAGG - Intronic
1064031269 10:11884976-11884998 CCTGGCTGCTGGCTCTGCACTGG - Intergenic
1065426740 10:25613994-25614016 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1067134128 10:43593349-43593371 CCTGGCAGCAGCTTTTGTACTGG + Intergenic
1067153200 10:43753304-43753326 CCTGGCAGATGCCCTCACACAGG - Intergenic
1067492478 10:46724301-46724323 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1067525700 10:47037130-47037152 ACTGGCAGGTGCCTCTTCACTGG - Intergenic
1067602189 10:47616093-47616115 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1068392207 10:56413015-56413037 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1068813719 10:61285957-61285979 CATGGCAGCTGGCTTTCCCCAGG + Intergenic
1069147995 10:64919266-64919288 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1069249344 10:66247638-66247660 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1069343682 10:67441603-67441625 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1069955859 10:72051075-72051097 CCTGGCAGCAGCCCTCTCTCCGG + Intergenic
1070014740 10:72515154-72515176 CCTTACAGCTGCCATTGCACTGG + Intronic
1070608042 10:77913277-77913299 CCTGGCAGCTCCCCTTGCCCAGG - Intronic
1071197030 10:83173804-83173826 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1071899410 10:90103021-90103043 TCTGGCAGCTGCCTTTTTCATGG + Intergenic
1071963189 10:90826143-90826165 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1072058981 10:91789834-91789856 CCTGGCAGCAGACTGTTCAGTGG + Intergenic
1072115316 10:92365113-92365135 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1072260104 10:93661557-93661579 CCTGCTAGCTGCCTTTACATTGG - Intronic
1073872600 10:107882080-107882102 TCTGGCAGCAGATTTTTCACTGG + Intergenic
1074408672 10:113203459-113203481 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1074638832 10:115354535-115354557 TCTGGCAGCAGCCTTCTCAGTGG - Intronic
1074874555 10:117603667-117603689 CCTGCCAGCTGCATTTTCTTTGG + Intergenic
1076015373 10:127023506-127023528 CCTGGCAGCTGGCCTATCTCAGG + Intronic
1076600727 10:131655338-131655360 CCTGGCCAGTGCCTTTTCCCAGG + Intergenic
1076693957 10:132238032-132238054 CTTAGCAGCTGCCTTTTCTCTGG - Intronic
1077132190 11:978644-978666 CCTGGCAGCTGTCTTTTGTGTGG + Intronic
1077300058 11:1842601-1842623 CCTGTCAGCTGCCTTGTCCTTGG - Intergenic
1077970467 11:7183535-7183557 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1078739676 11:14054848-14054870 CCAGGCAGCTGGCTTTGTACAGG + Intronic
1078858623 11:15226964-15226986 ACGGTCAGCTGCCCTTTCACAGG - Intronic
1079135304 11:17773091-17773113 CCTTGCACCTGCCTTTGCAAGGG - Intronic
1079291701 11:19193962-19193984 CAGGGGAGCTGCATTTTCACTGG + Intronic
1079473681 11:20806385-20806407 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1079692576 11:23438244-23438266 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1079713087 11:23710283-23710305 CCTGGCAGCAGACTTTTGAGTGG + Intergenic
1079729123 11:23919014-23919036 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1080489585 11:32748889-32748911 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1081555397 11:44156072-44156094 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1081644957 11:44783845-44783867 CCTGGCAGCTGCCTTCACAGAGG + Intronic
1081875281 11:46404343-46404365 CCTGCCAGCTGCCTCTGCATGGG + Intronic
1082113274 11:48300106-48300128 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1082114557 11:48314180-48314202 CCTGGCAGCATACTTTTCAGTGG - Intergenic
1082759848 11:57116931-57116953 ACAGACAGCTGCCTTCTCACAGG + Intergenic
1082880405 11:58031393-58031415 TCTGGCAGCTGCCTGTTGGCTGG + Exonic
1083858143 11:65404090-65404112 CCTGGCTCCTGCCTCTCCACAGG - Intronic
1083941944 11:65900557-65900579 TCCGGCTGCAGCCTTTTCACCGG + Intronic
1084110426 11:67010681-67010703 GCTGGAAGCTGCCCTTTCCCAGG - Intronic
1084349122 11:68581638-68581660 CATGGCAGCTGGCATCTCACAGG - Intronic
1085178656 11:74512917-74512939 ACTGGCAGCAGACTTTTCAGTGG + Intronic
1085412182 11:76297899-76297921 CCTGGCAGGTGCCTGTTCCCTGG + Intergenic
1085562989 11:77489092-77489114 CCTGACAGCAGGCTTTTCAGTGG + Intergenic
1085921565 11:80963994-80964016 CCTGGTATTTGCCTTTTCCCAGG + Intergenic
1086828430 11:91528357-91528379 TCTGGCAGCAGACTTTTCAGGGG + Intergenic
1087080478 11:94166505-94166527 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1087207026 11:95407461-95407483 CCTGGAAGCCCTCTTTTCACAGG + Intergenic
1087307207 11:96501408-96501430 GCTGGCAGCTGCCGTTCAACAGG + Intronic
1087350268 11:97021954-97021976 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1087466016 11:98507125-98507147 CCTGGCAGCAGACTTCTCAGAGG - Intergenic
1087598193 11:100281435-100281457 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1087877133 11:103371598-103371620 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1088177365 11:107068973-107068995 CATGGCAGCTGAATTTTCCCAGG + Intergenic
1088648993 11:111940952-111940974 CCTGGCTACTTCCTCTTCACTGG - Intronic
1088927376 11:114316005-114316027 CCTGGTAGCAGCCTCCTCACAGG + Intergenic
1088938030 11:114424294-114424316 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1089239418 11:117063421-117063443 CCTGGCAGCTGACTTTACATTGG - Intronic
1089395675 11:118135331-118135353 GCTTGCAGCTGCTTTTTGACAGG + Exonic
1089761988 11:120734387-120734409 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1089981910 11:122779693-122779715 CCTGGCAGCTGTTTGCTCACCGG - Exonic
1090111383 11:123912795-123912817 TCTGGCAGCTAACTTTTCAGTGG + Intergenic
1090229608 11:125092156-125092178 CCTGGTACCTGCCTTCTCCCTGG + Intergenic
1090488139 11:127133223-127133245 TGTGACAGCTGCTTTTTCACAGG - Intergenic
1090662169 11:128890452-128890474 CCTGGCAGCTGCCTTTCCTACGG + Intergenic
1090676708 11:129005602-129005624 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1091048451 11:132347015-132347037 CCTGGATGCTGCCTTTTTCCCGG + Intergenic
1091875810 12:3931891-3931913 CCTGCCAGCTGCGTTTTCATCGG - Intergenic
1092326552 12:7537558-7537580 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1093123120 12:15296669-15296691 CCTGGCAGCAGACTTTTTAGTGG + Intronic
1093403975 12:18781992-18782014 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1093538385 12:20249688-20249710 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1093988639 12:25565943-25565965 CCTGGCAGCAGACTTTTCAGTGG - Intronic
1094787190 12:33862280-33862302 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1095788813 12:46142236-46142258 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1095860432 12:46910203-46910225 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1097770128 12:63573728-63573750 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1098142690 12:67467411-67467433 TCTGGCAGCAGACTTTTCAGCGG - Intergenic
1098705775 12:73686759-73686781 CCTGGCAGCAGACATTTCAGTGG + Intergenic
1099564693 12:84228730-84228752 CCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1099609917 12:84855630-84855652 TCTGGCAGCAGGCTTTTCAATGG - Intergenic
1100875913 12:98961277-98961299 CCTGGTAGCAGACTTTTCAGCGG + Intronic
1100908987 12:99336852-99336874 CCTGGCAGCAGACTTCTCAGTGG - Intronic
1100946571 12:99790158-99790180 TCTGGCAGCAGACTTTTCAATGG + Intronic
1101607722 12:106260536-106260558 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1102546305 12:113659087-113659109 CCTGGTAGCTACCTTGTTACCGG - Intergenic
1104377120 12:128274585-128274607 CCTGGCAGCTTCCTGCTCATAGG - Intronic
1104745471 12:131207720-131207742 CCTGTCCGCTGACGTTTCACTGG - Intergenic
1104982724 12:132581483-132581505 CCTGGCAGCTTCCTGCCCACTGG + Exonic
1104991261 12:132625044-132625066 CCTGCCTGCTGCTTCTTCACAGG + Intronic
1105217344 13:18296627-18296649 ATTGTCAGCTGCCTTTTCTCAGG - Intergenic
1106420068 13:29578690-29578712 CTTGCCCGGTGCCTTTTCACTGG + Intronic
1107083754 13:36403969-36403991 TTTGGCAGCAGACTTTTCACTGG - Intergenic
1107287607 13:38813410-38813432 CCTGGCAGCAGACTTTACAGTGG - Intronic
1107370022 13:39735860-39735882 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1107399860 13:40058955-40058977 AATGGCTGCTGCCTGTTCACAGG - Intergenic
1107469547 13:40679460-40679482 CCTGGGAGCAGCCTGGTCACTGG - Intergenic
1108328765 13:49362890-49362912 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1109016529 13:57021819-57021841 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1109336505 13:61001861-61001883 CCTGGCAGTAGACTTTTCATTGG - Intergenic
1109567250 13:64133237-64133259 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1109620523 13:64899633-64899655 CCCGTCACTTGCCTTTTCACTGG + Intergenic
1109680498 13:65746132-65746154 TCTGGAATGTGCCTTTTCACTGG - Intergenic
1110486770 13:76054153-76054175 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1111405472 13:87798745-87798767 CTTGGCAGCTGCCCCATCACTGG + Intergenic
1111513125 13:89292653-89292675 CCTGGCAGCAGACTGTTCAGTGG - Intergenic
1111639517 13:90949081-90949103 CCTGGAAGCAGACTTTTCAGTGG + Intergenic
1112318181 13:98383414-98383436 CCTGGCAGCAGCCGGTGCACTGG - Intronic
1112618678 13:101033012-101033034 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1113164419 13:107422677-107422699 CATGTAAGCTGTCTTTTCACAGG - Intronic
1113415670 13:110126630-110126652 GCTGGCAGCTGCCGCTGCACCGG - Intergenic
1114455633 14:22851515-22851537 TCTGGGAGCTGCCTCATCACCGG + Intergenic
1114687947 14:24552680-24552702 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1114691068 14:24582101-24582123 ACTGGCAACTGCCTTCTCAGAGG - Intergenic
1115275878 14:31608034-31608056 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1115619911 14:35131457-35131479 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1116392872 14:44414831-44414853 TCTGGCAGCAGACTTCTCACTGG + Intergenic
1116766147 14:49072329-49072351 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1116889317 14:50251665-50251687 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1117110528 14:52448331-52448353 CCTAGCAGCTGACTTTTCAGTGG + Intronic
1117159183 14:52971996-52972018 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117264715 14:54075174-54075196 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117482870 14:56166712-56166734 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1117606753 14:57438208-57438230 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1117634621 14:57729005-57729027 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1118099061 14:62574536-62574558 CCTGGTAGCAGACTTTTCAGTGG + Intergenic
1119611814 14:76069826-76069848 CCTGGCAGCTGCCAGCTCTCAGG + Intronic
1119720502 14:76886800-76886822 CCTGGGAGGTGCCTTCTCAATGG - Intergenic
1119864350 14:77960929-77960951 GCAGGCAGCTGCCTTCTTACTGG - Intergenic
1120770889 14:88379328-88379350 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1124037277 15:26066188-26066210 CCTGGCAGCAAACTTTTCAGTGG - Intergenic
1126184025 15:45813123-45813145 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1126250607 15:46564002-46564024 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1126440797 15:48685593-48685615 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1126517433 15:49552331-49552353 TCTGGCAGCAGTCTTTTCAGTGG - Intronic
1126709254 15:51439484-51439506 TCTGCCAGCTGACTTTTCAGTGG - Intergenic
1126790553 15:52217595-52217617 CATGACAGCTGCCTTTTCTGAGG - Intronic
1127033886 15:54893950-54893972 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1127155542 15:56121331-56121353 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1127347479 15:58114939-58114961 CCTAGCAGCTGTCTTATCAAGGG - Intronic
1127476918 15:59343356-59343378 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1128229240 15:66023443-66023465 CCATTCATCTGCCTTTTCACTGG - Intronic
1128671456 15:69577327-69577349 CCTGGCATCTGGCTGTTCGCTGG + Intergenic
1128795647 15:70464717-70464739 TCTGGCAGCTGCCTTTGCAGGGG - Intergenic
1129501320 15:76040210-76040232 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1131108348 15:89749654-89749676 ACTTGCCGCTGCCTTCTCACAGG + Exonic
1132384783 15:101392329-101392351 GATGGCAGCTGACCTTTCACTGG + Intronic
1132403196 15:101526435-101526457 CCGGGCAGCTGTCTTGTCCCAGG - Intergenic
1132514570 16:360157-360179 GCGGGCAGCTGCCTTTGCCCCGG + Intergenic
1132722492 16:1323650-1323672 CCTGGCAGGTGCCTTTTCTCGGG + Intronic
1134406829 16:13968138-13968160 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1134524042 16:14930858-14930880 CCTGGCGGCTGTGTCTTCACAGG + Intronic
1134711634 16:16329343-16329365 CCTGGCGGCTGTGTCTTCACAGG + Intergenic
1134782554 16:16911552-16911574 CCAGCCACCTGCCTTCTCACAGG + Intergenic
1134955194 16:18379350-18379372 CCTGGCGGCTGTGTCTTCACAGG - Intergenic
1136388958 16:29949930-29949952 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1136679392 16:31947422-31947444 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1138844762 16:60552539-60552561 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1138864839 16:60804475-60804497 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1140414033 16:74760493-74760515 CCTGGCAGCTGCCCTTTCATGGG - Intronic
1141874029 16:86809268-86809290 CATGGGAGCTGCCTCCTCACTGG + Intergenic
1142016153 16:87748809-87748831 CCTGTCACCTTTCTTTTCACAGG - Exonic
1142613725 17:1123478-1123500 GCTGGCAGGTGCCTTCTCTCGGG - Intronic
1143413906 17:6730942-6730964 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1143902296 17:10183397-10183419 GCTGACAGCTGCCTGTTAACTGG - Intronic
1144718411 17:17450579-17450601 CCTGGCAGCAGCCCTTCCAGAGG + Intergenic
1146215695 17:30978081-30978103 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1146259241 17:31410912-31410934 CCTGGAAGCTGCATTTTCCAGGG - Intronic
1147673527 17:42190302-42190324 CTTGGCAGCTGCCCATTCACCGG - Intronic
1147832670 17:43307837-43307859 CCTTGCAGCTGATATTTCACAGG - Intergenic
1148352613 17:46951498-46951520 CCTGGGAGGTGCCTTTTAACTGG + Intronic
1149054446 17:52346275-52346297 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1149157180 17:53646142-53646164 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1149239964 17:54637322-54637344 TCTGGCAGCGGACTTTTCAATGG + Intergenic
1149527287 17:57366552-57366574 CCTGGCTGCTGCTTTTGCAAAGG - Intronic
1149600212 17:57888656-57888678 CCTGACAGCTGCCTTTGTCCTGG + Intronic
1149978082 17:61286658-61286680 CCTGGGAGCTGCCTTCACAACGG - Intronic
1150922246 17:69495952-69495974 CCTGCCTCCTGCCTTTTCCCTGG + Intronic
1150966459 17:69974779-69974801 CCTGGCAGCTGGTTTCTCCCAGG + Intergenic
1151088925 17:71412931-71412953 TCTGGCAGAAGTCTTTTCACTGG - Intergenic
1151115767 17:71733165-71733187 CCTGGCACCTGACACTTCACAGG + Intergenic
1151392310 17:73795612-73795634 CCTTGTAGCTCCCTTTTCCCTGG + Intergenic
1151820684 17:76495139-76495161 CCCGGCAGCCGGGTTTTCACGGG + Intronic
1152666836 17:81575472-81575494 ACTGGCAGCTGGCATTTCTCAGG + Intronic
1152905914 17:82970871-82970893 CCGGGCAGCTGCCTTTGCGGGGG + Intronic
1153363526 18:4226086-4226108 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1154162260 18:11989469-11989491 CCTGCCAGCTGCTGTCTCACAGG - Intronic
1155282340 18:24252365-24252387 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1155556057 18:27020478-27020500 CTTTGGAGCTGTCTTTTCACAGG + Intronic
1157287449 18:46386692-46386714 CCTGGCAGCTGTCCTTTCAGTGG + Intronic
1157609516 18:48947773-48947795 CCTGTCTGCTGCTTTGTCACTGG - Intronic
1157937174 18:51885692-51885714 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1158468814 18:57715663-57715685 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1159019271 18:63129848-63129870 CCTGACAGCTCCCTTTCCCCAGG - Intronic
1159080784 18:63733185-63733207 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1161000434 19:1907992-1908014 CCCGGCAGCTGCCTCCTCTCTGG + Intronic
1161005674 19:1935078-1935100 ACTGGGATCTGCCTCTTCACAGG - Intergenic
1162391015 19:10390267-10390289 TCTGGCTGCTGCCTGTTCAGGGG + Intergenic
1162460382 19:10811004-10811026 CCTGGCATCTGGCCATTCACGGG - Intronic
1162666574 19:12218601-12218623 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1163751030 19:19077923-19077945 CCTGGCTTCTGCCTCTTCACTGG + Intronic
1165373559 19:35425691-35425713 CCAGGCAGCTGCCTATACTCCGG + Intergenic
1165645666 19:37433646-37433668 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1166258931 19:41624910-41624932 CCTGGCAGCTTCTTGTCCACCGG - Intronic
1166309640 19:41955744-41955766 CCTGGCTGCTGCCATCTCCCAGG + Intergenic
1166408067 19:42537549-42537571 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1166782501 19:45349808-45349830 CCTGCCAGCTTCCGCTTCACTGG - Intronic
1167375034 19:49106518-49106540 CCAGGCACCTGCCATGTCACAGG - Intronic
925269623 2:2593379-2593401 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
925284512 2:2706977-2706999 CCTGGGAGCTGCTTTTTCTAGGG - Intergenic
925970822 2:9105513-9105535 CCAGGCAGCTGCCTTCTTACGGG - Intergenic
926086012 2:10020729-10020751 CCTGGCAGCTTCCTGGTCTCTGG + Intergenic
926145964 2:10397337-10397359 CCTGGAAGCTTCCTTCTCCCAGG + Intronic
926220752 2:10934155-10934177 CCTGGCAGCAGCCTGGACACAGG - Intergenic
927569968 2:24150776-24150798 TCTGGCAGCAGACTTTTCAGTGG - Intronic
927829490 2:26336872-26336894 CCTGGCAGTAGCCATTTCAGTGG + Intronic
928293757 2:30062919-30062941 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
928495481 2:31827545-31827567 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
928609721 2:32980925-32980947 TCTGGCAGCAGGCTTTTCACTGG - Intronic
928715338 2:34054252-34054274 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
928768166 2:34672527-34672549 CCTGGCAGCAGACTTTTTAGTGG + Intergenic
928851828 2:35757765-35757787 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
928900080 2:36308282-36308304 CCTGGCACCTGAATTTTCATAGG + Intergenic
929980107 2:46670224-46670246 CCTGGCTCCTGCCTTGTCGCTGG + Intergenic
931161715 2:59699997-59700019 CCTGTCAGCAGACTTTTCAGTGG - Intergenic
931406672 2:61986225-61986247 TCTGGCAGCAGGCTTTTCAGTGG - Intronic
933227340 2:79766375-79766397 TCTGGCAGCAGACTTTTCAGTGG - Intronic
933339311 2:81002424-81002446 CCTGGCAGCAGAGTTTTCAGTGG - Intergenic
934523121 2:95032362-95032384 CCTGGGACCTGCCTTGACACAGG + Intronic
934707787 2:96496896-96496918 CCTGGGAGATGCCTTTTCCAGGG + Intergenic
934724616 2:96607786-96607808 TCTGGCTGCTGCCTCTTCCCAGG + Intronic
935437689 2:103054474-103054496 TCTGGCAGCAGACTCTTCACTGG - Intergenic
935976914 2:108587168-108587190 CCTGGCAGGTGACTATTTACAGG - Intronic
936162225 2:110092997-110093019 ACTGACAGCTGACTTTTCAATGG - Intronic
936559956 2:113528830-113528852 CCTGGCAGGCTCCTCTTCACAGG + Intergenic
936825217 2:116574284-116574306 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
938076201 2:128339910-128339932 CTTGGCTGCTTCCTTTTCATTGG + Intergenic
939244624 2:139608206-139608228 TCTGGCAGCAGACTTTTCAATGG - Intergenic
939443008 2:142274312-142274334 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
939483210 2:142776233-142776255 TCTGGCAGCAGACTTTTCAGCGG - Intergenic
940049687 2:149449082-149449104 ATTGTCTGCTGCCTTTTCACAGG - Exonic
940468844 2:154066522-154066544 TCTGGCAGCAGACTTTTCAGTGG + Intronic
940503580 2:154525759-154525781 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
942750315 2:179279079-179279101 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
943117312 2:183690141-183690163 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
943128088 2:183821514-183821536 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
943170258 2:184388340-184388362 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
943532300 2:189098041-189098063 CCTGGCAACAGCCATTTCCCAGG - Intronic
944078833 2:195761625-195761647 TCTGGCAGCAGACTTTTCATTGG + Intronic
944377190 2:199059390-199059412 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
944955492 2:204803071-204803093 TCTGGCAGCAGACTTTTCAGTGG + Intronic
945211019 2:207382050-207382072 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
945252734 2:207778001-207778023 TGTGGCAGTTGCCTTGTCACAGG - Intergenic
945754269 2:213827857-213827879 TCTGGCAGCAGACTTTTCAGTGG - Intronic
946047130 2:216830531-216830553 CCTGGCAGCTGCCATTCCCATGG - Intergenic
947439510 2:230107133-230107155 TCTGGCAGCAGACTTTTCAATGG - Intergenic
947892874 2:233641854-233641876 TCTGGCAGCAGCCTTTTCAGTGG - Intronic
948725569 2:239931723-239931745 CAGGGCAGCTGTCTTCTCACAGG - Intronic
1169587213 20:7098360-7098382 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1170086768 20:12542788-12542810 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1170863898 20:20136081-20136103 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1172520618 20:35563154-35563176 ACTGACTGCTGGCTTTTCACTGG - Intergenic
1173246989 20:41343757-41343779 CCTAGCATCTGCATTTTAACAGG - Intronic
1174390685 20:50216692-50216714 CCTGGCAGCTGCCTCTCCAGGGG + Intergenic
1176195042 20:63832817-63832839 CCTGGAAGCCGCCTCTTCTCAGG - Intergenic
1177105370 21:16947915-16947937 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1177667736 21:24183112-24183134 CATAGCAGCTGCTTTTTCCCTGG - Intergenic
1177970254 21:27779801-27779823 TTTGGCAGCAGGCTTTTCACTGG + Intergenic
1178777453 21:35565713-35565735 CCTGGCACCTGCGGTCTCACGGG - Intronic
1179155034 21:38842206-38842228 CCTGGCTGCTGATTTTTCCCAGG + Intergenic
1179158203 21:38869432-38869454 GCTGGGCGCTGCCTCTTCACTGG + Intergenic
1179264865 21:39794421-39794443 GATGGGAGCTGTCTTTTCACAGG + Intronic
1179487853 21:41722393-41722415 CCTGGCTGCTGCCTTTCTCCAGG - Intergenic
1180716287 22:17874532-17874554 TGTGGCAGATGCCTTTGCACGGG - Intronic
1180956244 22:19742688-19742710 CCTGCCAGCTGCCCTTCCTCTGG - Intergenic
1181337751 22:22153591-22153613 CCTAGATGATGCCTTTTCACAGG - Intergenic
1181717126 22:24739482-24739504 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1181844907 22:25699257-25699279 CCTGGCAGCTGTCTTTTCTCAGG + Intronic
1184438479 22:44494864-44494886 CCTTCCAGGTGCCTTTTCCCAGG + Exonic
1184862703 22:47183448-47183470 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1184924967 22:47630398-47630420 TCTGCCAGCTCCCTTTTCAGAGG + Intergenic
1185117033 22:48943905-48943927 GCTGGCACCTGCGTTTTCACTGG + Intergenic
1185122816 22:48982683-48982705 CCTGGCATCTGTCTTGGCACAGG - Intergenic
1185199134 22:49491315-49491337 CCTTGCAGCTGCCTCTTCCCAGG + Intronic
1185292121 22:50032389-50032411 CCTGGGAGCTGCTTTTGCACAGG + Intronic
950695362 3:14697020-14697042 TCTGGCAGCAGACTTTTCAGTGG - Intronic
951032053 3:17893759-17893781 TCTGGCAGCAGACTTTTCAGTGG - Intronic
951255188 3:20440360-20440382 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
951310099 3:21115400-21115422 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
951436783 3:22674756-22674778 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
951860850 3:27250764-27250786 TCTGGCAGCAGACTTTTCAGTGG - Intronic
952202948 3:31150002-31150024 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
953194817 3:40722423-40722445 CCTGGCACCAGCCTCTTCAATGG - Intergenic
953217408 3:40932392-40932414 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
953398134 3:42589293-42589315 GATGAAAGCTGCCTTTTCACAGG + Intronic
953703720 3:45215704-45215726 CCTGGCAGCTTCCGTTTAGCTGG - Intergenic
956075259 3:65498124-65498146 CCTGGCAGATGGCATTTCAAAGG + Intronic
957485690 3:80859182-80859204 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
957916016 3:86688604-86688626 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
958078534 3:88714474-88714496 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
958756709 3:98258519-98258541 TCTGGCAGCAGACTTTTCAATGG - Intergenic
958840156 3:99193539-99193561 CCCGGCAGCAGACTTTTCAGTGG + Intergenic
958975220 3:100659853-100659875 CCTGGCAGCTTCCCATTCATTGG - Intronic
959118310 3:102204448-102204470 TCTGGCAGCAGACTTTTCAGTGG - Intronic
959408603 3:105993501-105993523 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
960214291 3:115011448-115011470 TCTGGCAGCAGACTTTTCACTGG + Intronic
960565135 3:119124954-119124976 TCTGGCAGCAGACTTTTCAGTGG + Intronic
960870189 3:122240181-122240203 TCTGGCAGCAGACTTTTCAGTGG + Intronic
961397982 3:126610695-126610717 ACTGAAAGCTGCCTTTTCCCAGG - Intronic
961964220 3:130886183-130886205 TCTGGCAGCAGACTTTTCAGTGG - Intronic
962870723 3:139490304-139490326 CCTGGCAGTAGACTTTTCAGTGG - Intergenic
963154358 3:142079684-142079706 CCCGGCAGCAGACTTTTCAGTGG + Intronic
963179695 3:142340716-142340738 TCTGGCAGCAGACTTTTCAGTGG + Intronic
963310292 3:143701957-143701979 TCTGGCAGCAGACTTTTCAGTGG + Intronic
963411512 3:144933159-144933181 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
963591981 3:147271450-147271472 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
963763120 3:149305874-149305896 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
964208871 3:154206235-154206257 TCTGGCAGCAGACTTTTCAGTGG - Intronic
964253890 3:154751883-154751905 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
965144802 3:164888189-164888211 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
965236712 3:166134502-166134524 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
965951538 3:174314308-174314330 CCTGGCAGCTCCTTTTTAAAGGG + Intergenic
965975160 3:174612140-174612162 CCTGGCAGCAGACTTTCCAGTGG - Intronic
966401188 3:179548440-179548462 TCTGGCAGCTGACTTTTCAGTGG + Intergenic
966904364 3:184511085-184511107 CATGTCAGCTGCCTTCTCCCAGG - Intronic
967659936 3:192093943-192093965 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
969560421 4:7943273-7943295 CCTGCCAGCTGCCTTCTCCCTGG + Intergenic
970152141 4:13101166-13101188 CCTGGCCCCTGCCTTGTCAGAGG - Intergenic
970191424 4:13522820-13522842 CCTGGCAGCTCCCTCTCCTCTGG + Intergenic
970413234 4:15831632-15831654 TCTGGCAGCAGACTTTTCAGTGG - Intronic
971054903 4:22901041-22901063 ACAGACAGCTGTCTTTTCACTGG - Intergenic
971095493 4:23397655-23397677 TCTGGCAGCTGACTTTTCAATGG - Intergenic
971914344 4:32849214-32849236 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
972143004 4:35984783-35984805 TCTGGCAGCAGACTTTTCAGTGG + Intronic
972207966 4:36800468-36800490 TCTGGCAGCAGACTTTTCAATGG + Intergenic
972278246 4:37579622-37579644 TCTGGCAGCAGACTTTTCAGTGG - Intronic
974352730 4:60771369-60771391 TCTGGCAGCGGACTTTTCAGTGG - Intergenic
974692514 4:65315832-65315854 CCTTGAAGCTACCTATTCACTGG + Intergenic
974893059 4:67905681-67905703 TCTGGCAGCAGACTTTTCATTGG - Intergenic
975629954 4:76389753-76389775 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
976171430 4:82308970-82308992 TCTGGCAGCTGACTTTTCAGTGG - Intergenic
976722259 4:88180216-88180238 CCTGGCAGCAGACTTTTCAGTGG + Intronic
976728306 4:88238271-88238293 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
976943578 4:90737463-90737485 TATGGCAGCAGCCTTTTCAGTGG - Intronic
977307643 4:95344234-95344256 CCTGGCAGCAGACTTCTCAGTGG + Intronic
977753551 4:100637244-100637266 TCTGGCAGCAGACTTTTCAATGG + Intronic
977985806 4:103381470-103381492 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
978116347 4:105024266-105024288 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
978116686 4:105026947-105026969 TCTGGTAGCAGTCTTTTCACTGG + Intergenic
978297792 4:107228034-107228056 TCTGGCAGCAGACTTTTCAGTGG + Intronic
979413640 4:120408575-120408597 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
979573193 4:122253942-122253964 ACTGGCAGCAGACTTTTCAGTGG + Intronic
979862486 4:125711000-125711022 CCTGGTGGCTGCCTTTTCCCAGG - Intergenic
980172229 4:129304230-129304252 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
980413172 4:132448919-132448941 TCTGGCAGCAGACTTTTCAGAGG + Intergenic
980443180 4:132873277-132873299 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
981154772 4:141421948-141421970 TCTGGCAGCAGCCTTTTCTAAGG - Intergenic
981870885 4:149485058-149485080 TCTGGCAGCAGACTTTTCACTGG - Intergenic
981975739 4:150725379-150725401 TCTGGCAGCAGACTTTTCAGCGG + Intronic
981996350 4:150979182-150979204 TCCGGCAGCTGACTTTTCAGTGG + Intronic
982346264 4:154363880-154363902 CTTAGCAGCTGCCTGTTCACCGG + Intronic
983389112 4:167104882-167104904 TCTGGCAGCAGACTTTTCACTGG + Intronic
983931983 4:173462349-173462371 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
984915628 4:184720676-184720698 TCTGGCAGCAGACTTTTCAGTGG + Intronic
986302536 5:6489707-6489729 CATTGCAGCTGCCTTCCCACTGG + Intronic
986451726 5:7871782-7871804 CCAGGAAGCTCCCTTTTCTCTGG - Intronic
986492918 5:8310471-8310493 TCTGGCAGCAGACTTTTCATTGG + Intergenic
986548516 5:8926103-8926125 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
987164163 5:15176010-15176032 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
987366976 5:17157611-17157633 CCAAGCAGCTGCCTCTCCACTGG + Intronic
988340301 5:29961891-29961913 TCTGGCAGCCACCTTTTCAGTGG + Intergenic
989083082 5:37646709-37646731 CCTGGCAGCAGACTTTTCAGTGG - Intronic
989576473 5:42992714-42992736 CCGGGCAGCTCCCCTGTCACCGG - Intergenic
989629476 5:43466292-43466314 TCTGGCAGCAGACTTTTCAGTGG + Intronic
990336629 5:54778925-54778947 CATGGCAGTTGCCTTCTCCCAGG - Intergenic
990685449 5:58295754-58295776 CCAGGAAGCTTCCATTTCACAGG + Intergenic
990739499 5:58897805-58897827 CCTGGCAGCTTTCTTTACTCTGG - Intergenic
990932946 5:61113880-61113902 CTTGGCAGCAGACTTTTCAGTGG - Intronic
991180406 5:63745132-63745154 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
991205435 5:64044068-64044090 TCTGGCAGCAGATTTTTCACTGG + Intergenic
991208909 5:64082380-64082402 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
991237951 5:64420669-64420691 TCTGGCAGCAGACTTTTCAGAGG + Intergenic
992345389 5:75870809-75870831 TCTGGCAGCAGTCTTTTCAGTGG + Intergenic
992352763 5:75948037-75948059 CCTGGAAGCTGCCTTCCCAGAGG + Intergenic
992678264 5:79127368-79127390 CATGGCAGCTGGCTTTCCCCAGG + Intronic
993138485 5:83999934-83999956 TCTGGCAGCAGACTTTTCAGTGG + Intronic
993206887 5:84893670-84893692 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
993582489 5:89679378-89679400 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
993623516 5:90194814-90194836 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
994226404 5:97256010-97256032 TCTGGCAGCAGCCTTTTCAGTGG + Intergenic
994627981 5:102244685-102244707 TCTGGCAGCAGACTTTTCAGTGG + Intronic
994660197 5:102643611-102643633 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
995146663 5:108794734-108794756 TGTGGCAGCAGCCTTTTCAGTGG - Intronic
996615285 5:125434020-125434042 CCAGGCAATTGCCTTTTGACTGG + Intergenic
996669961 5:126106258-126106280 CCTTATAGCTGCCTGTTCACTGG - Intergenic
996962350 5:129266236-129266258 GCTGGCAGCTGACTTTTCAGTGG + Intergenic
997060046 5:130489830-130489852 CCTGGCAGCAGACTTTTCAATGG + Intergenic
999710324 5:154312796-154312818 CCTGGCAGCTGGCAGCTCACTGG + Intronic
1001377731 5:171278706-171278728 CCTGCCAGCTGCCTTGTCCATGG + Intronic
1002495733 5:179610280-179610302 CCTGGCACGTGCCTTTTCACAGG - Intergenic
1005037202 6:21567817-21567839 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1005324885 6:24690360-24690382 CCTGTCAGCCCCCTTTTCCCAGG + Intronic
1005591918 6:27337541-27337563 CTTTGCAGTTGCATTTTCACTGG + Intergenic
1006415876 6:33903619-33903641 AGTGTCAGCTGCTTTTTCACCGG + Intergenic
1006462627 6:34171663-34171685 CCTGGCAGCAGACTTTTCAGTGG - Intergenic
1006802151 6:36766120-36766142 CCTGGCAGCTCCCCTGTCCCTGG - Intronic
1007111063 6:39313788-39313810 CCAGGCATCTGCCTCCTCACCGG + Intronic
1007312020 6:40954315-40954337 CCTGGCTGCTACGATTTCACTGG - Intergenic
1007705860 6:43790856-43790878 CCTGGCAGCTGCCTTACAAGAGG - Intergenic
1008647562 6:53530578-53530600 TCCTGCATCTGCCTTTTCACAGG + Intronic
1008707411 6:54180166-54180188 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1008731592 6:54489866-54489888 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1009390922 6:63142334-63142356 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1009738567 6:67712742-67712764 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1009771051 6:68143429-68143451 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1009802012 6:68550283-68550305 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1009964534 6:70564811-70564833 CATGGCAGCTGGCTTTCCACAGG - Intergenic
1010182102 6:73098545-73098567 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1010343408 6:74783298-74783320 CCTGGCAGCAGCCTTTTCAGTGG + Intergenic
1010626460 6:78141384-78141406 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1010676838 6:78755292-78755314 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1011033401 6:82946300-82946322 CCTAGCAGCAGACTTTTCAGTGG + Intronic
1011102734 6:83742488-83742510 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1011290986 6:85777122-85777144 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1011590727 6:88968178-88968200 CCTGACACCTGGCTTTTCAGAGG + Intergenic
1011624176 6:89270110-89270132 CCTGGCAGCTGCTGATGCACTGG - Intronic
1012028804 6:94031664-94031686 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1012439598 6:99251138-99251160 CCTGGCAGCTGCAATGACACAGG - Intergenic
1012512416 6:100018428-100018450 TCTGGCAGCAGGCTTTTCAGTGG + Intergenic
1012679127 6:102155790-102155812 CCTGACAGCAGACTTTTCAGTGG + Intergenic
1013925434 6:115466644-115466666 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1014865062 6:126519599-126519621 CTTGGCAGCAGACTTTTCAGTGG - Intergenic
1015030498 6:128588428-128588450 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1015257466 6:131195791-131195813 TCTGGCAGCAGACTTTTCAGAGG - Intronic
1015323256 6:131899558-131899580 CCAGGCAGCAGACTTTCCACAGG - Intergenic
1015460920 6:133489545-133489567 CATGGCAGCAGACTTTTCAGTGG + Intronic
1015578581 6:134699749-134699771 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1016612146 6:146002082-146002104 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1016623627 6:146141228-146141250 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1016686299 6:146886068-146886090 CCTGGCACCAGCCCGTTCACAGG - Intergenic
1017387552 6:153903300-153903322 CCTGCCAGCAGGCTTTTCAGAGG + Intergenic
1017924572 6:158899783-158899805 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1018035587 6:159878587-159878609 CCTGGCAGCTGCTTTACCAGAGG - Intergenic
1018231995 6:161683852-161683874 CATGGCAGCTGTCTTCTCGCTGG - Intronic
1018316843 6:162564645-162564667 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1019215879 6:170443535-170443557 CCTGGCAGCTACCCCTTCCCAGG - Intergenic
1019746302 7:2702072-2702094 CCTGGCAGCTGATTTCTCACTGG + Intronic
1020515196 7:9108691-9108713 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1020573203 7:9891992-9892014 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1021353908 7:19629877-19629899 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1022061293 7:26798227-26798249 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1022223396 7:28338467-28338489 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1024180205 7:46885127-46885149 CCTGGCTGGTGGCTTTTCAGAGG + Intergenic
1024246267 7:47472576-47472598 CCTGGCAGCTCCCTACACACAGG + Intronic
1024498510 7:50073695-50073717 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1024620150 7:51150001-51150023 CCTGGCAGCTGGCATTTTCCAGG + Intronic
1024621730 7:51164410-51164432 TCTGGCAGCAGACTTTTCAAGGG + Intronic
1025007155 7:55363684-55363706 CCTGGCAACTGACCTTTCAAAGG - Intergenic
1025138216 7:56438540-56438562 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1025806515 7:64838505-64838527 CCTGGCAGCTGCCCTGCAACCGG - Intergenic
1026311236 7:69186396-69186418 CCTTGCAGTTGCCTTTCCCCAGG + Intergenic
1027996290 7:85428847-85428869 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1028929294 7:96395645-96395667 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1029279136 7:99425441-99425463 CTTGGCCGCTGCCTGCTCACTGG + Exonic
1029613452 7:101640907-101640929 TCTAGAAGTTGCCTTTTCACTGG + Intergenic
1029614818 7:101649681-101649703 GCTGGCCGCTGACTTTTCCCTGG - Intergenic
1029825494 7:103188415-103188437 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1030431418 7:109453878-109453900 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1030599252 7:111573743-111573765 TCTGGCAGCAGACTTTTCAATGG + Intergenic
1031472589 7:122184120-122184142 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1031746346 7:125503925-125503947 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1032817403 7:135490865-135490887 AATGGCAGCAGCCTTTTAACAGG - Intronic
1033262143 7:139853213-139853235 GATGGCATCTGCCTTTTCACAGG + Intronic
1033489032 7:141823466-141823488 CCTGGCAGCAGACTTTTCAGTGG - Intergenic
1033882279 7:145900910-145900932 CCTGGAAGCAGACTTTTCACTGG - Intergenic
1034734044 7:153412499-153412521 CCTGGCAGCTGCCCTGCAACCGG - Intergenic
1035139278 7:156740538-156740560 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1035347127 7:158208448-158208470 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1035551001 8:525109-525131 TCTGGCAGCAGGCTTTTCAGTGG + Intronic
1037414074 8:18630039-18630061 CCTGTCAGTTGCTTTATCACTGG - Intronic
1037934436 8:22905751-22905773 CCTGGCAGGTTCCTCTCCACGGG + Intronic
1038532350 8:28328676-28328698 AGTGGCACCTGCCTTATCACAGG - Intronic
1038743161 8:30233261-30233283 CCTGGAAGCTGTCATCTCACTGG - Intergenic
1038871729 8:31502558-31502580 CCTAGCAGCAGACTTTTCAGTGG - Intergenic
1040742925 8:50602852-50602874 TCTGGCAGCTGACTTTTCAGTGG - Intronic
1041394772 8:57379159-57379181 TCAGGCAGCTGCCTTCTCATGGG + Intergenic
1041569879 8:59325837-59325859 CCTGGAATCTGCATTTTAACTGG - Intergenic
1041883166 8:62777047-62777069 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1042428387 8:68674947-68674969 CCTGGCAGTAGACTTTTCAGTGG + Intronic
1042913809 8:73854354-73854376 TCTGGAAGCTGCCTTTTGATTGG - Intronic
1043455288 8:80406536-80406558 CATAGCAGCCGCCTCTTCACTGG - Intergenic
1043760377 8:84061322-84061344 TCTGGCAGCTGCCTTTTCAGTGG - Intergenic
1044066791 8:87708013-87708035 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1045147795 8:99367345-99367367 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1045159720 8:99524832-99524854 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1045425255 8:102059880-102059902 CCTGGCAGCTGTGTTTTACCAGG - Intronic
1045507740 8:102790634-102790656 CCTAGCAGCTTCCTTTTCCAGGG - Intergenic
1045540495 8:103079906-103079928 CCTGCCTGATGCCTTTGCACTGG - Intergenic
1045590151 8:103584132-103584154 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1045592257 8:103611619-103611641 TCTGGTGGCTGACTTTTCACAGG - Intronic
1046772851 8:118134174-118134196 CCCGGAAGCTGCCATTTCATTGG - Intergenic
1047001211 8:120574601-120574623 CCTGGCAGCCACCCTTCCACAGG + Intronic
1047751469 8:127883905-127883927 CCTGGAAGCTGCCGATTCCCAGG + Intergenic
1047933820 8:129755259-129755281 TCTGGCAGCAGACTTTTCACTGG + Intronic
1047937143 8:129793422-129793444 TCTGGCAGCAGACTTTTCACTGG - Intergenic
1049358304 8:142199516-142199538 CCTGGCATCTGCCCTCTCATGGG + Intergenic
1049463926 8:142742512-142742534 CCTGCCAGCTGCCTCCCCACTGG - Intergenic
1049621219 8:143599112-143599134 CCCGGCTGCTGCCTTTGGACAGG - Exonic
1049803381 8:144528377-144528399 ACATGCAGCTGCCTTTTGACAGG + Intronic
1049856554 8:144865587-144865609 GCTGGCAGCTGCCATTCAACAGG - Intergenic
1049892910 9:87534-87556 CCTGGCAGGCTCCTCTTCACAGG - Intergenic
1050045000 9:1533836-1533858 CCTGCCAGCTCCCCTTTCCCAGG + Intergenic
1050145400 9:2561802-2561824 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
1051095876 9:13464544-13464566 CATAGCAGCTGCCTTCTCTCAGG - Intergenic
1051465375 9:17370347-17370369 GCTGGCAGCAGACTTTTCAGTGG + Intronic
1052063507 9:23988779-23988801 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1052420426 9:28236126-28236148 TCTGGCAGCTGACGTTTCAGTGG + Intronic
1053040274 9:34864440-34864462 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1053734136 9:41087597-41087619 CCTGGCAGGCTCCTCTTCACAGG - Intergenic
1054694264 9:68343956-68343978 CCTGGCAGGCTCCTCTTCACAGG + Intronic
1054831931 9:69634767-69634789 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1055227547 9:74017025-74017047 TCTGGCAGCTGACTTTTCAGTGG + Intergenic
1056087969 9:83173093-83173115 CCTGGCAGCAGACTTCTCAGTGG - Intergenic
1056957552 9:91094527-91094549 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1058016496 9:100037879-100037901 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1058285036 9:103167303-103167325 TCTGGCAGCAGGCTTCTCACTGG - Intergenic
1058767993 9:108200496-108200518 TCTGGCAGCAGACTTTTCAGGGG + Intergenic
1059283961 9:113157073-113157095 CCTGTCAGATGCCTTTTCAGAGG - Intronic
1060236708 9:121868883-121868905 CATGGGAGCTGCTTTTTCAGTGG - Intronic
1060921630 9:127424511-127424533 GCTGGCAGCGGCTTTTTCACCGG + Exonic
1061871398 9:133522588-133522610 CCCCGCAGCTGCCTCTGCACTGG - Intronic
1062106669 9:134758637-134758659 CCAAGCAGCTGCCATTTCAGGGG + Intronic
1062528485 9:136988565-136988587 ACTGGCAGCAGCTTTTCCACTGG - Intergenic
1062612836 9:137382782-137382804 CTTGGCAGCTTCCTGTGCACAGG + Intronic
1185625892 X:1481783-1481805 CCTGCCAGCTGCCAGTTCACTGG - Intronic
1186989871 X:15055766-15055788 CATGGCATTTGCATTTTCACTGG + Intergenic
1187846366 X:23541761-23541783 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1188071573 X:25724882-25724904 CCTGGCAGCAGACTTCTCATTGG - Intergenic
1188159280 X:26780668-26780690 CCTGACACCTGGCTTTTCAGAGG - Intergenic
1188265279 X:28065947-28065969 GCTGGGAGCTGCCTTGTCAGAGG - Intergenic
1189019773 X:37322129-37322151 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1189769879 X:44415063-44415085 TCTGGCAGCTGACTTTTCATTGG - Intergenic
1189868614 X:45358852-45358874 TCTGGCAGCAGGCTTTTCAGTGG - Intergenic
1189870220 X:45373370-45373392 TCTGGCAGCAGCCTGTTCAGTGG + Intergenic
1190374134 X:49773011-49773033 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1190578035 X:51860967-51860989 CCTGGCAGCTCCATTCTCCCAGG - Intronic
1190899240 X:54652764-54652786 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1190960247 X:55240075-55240097 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1191049017 X:56170976-56170998 TCTGGCAGCAGACTTTTCAGCGG + Intergenic
1191746319 X:64492037-64492059 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1191827105 X:65377562-65377584 CCTGGCAGCAGACTTTTCAGTGG + Intronic
1191967404 X:66775236-66775258 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1192001955 X:67160746-67160768 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1192045819 X:67673110-67673132 TCTGGCAGCAGACTTTTCAGTGG - Intronic
1192119273 X:68439568-68439590 CGTAGCAGCTGTCTTTACACTGG - Intergenic
1192135240 X:68590919-68590941 TCTGGCAGCAGCCTTTTCAGTGG + Intergenic
1192406235 X:70888875-70888897 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1192908372 X:75577425-75577447 CCTTGCAGCAGACTTTTCAGTGG - Intergenic
1192998193 X:76534898-76534920 TCTGGTTGCTGACTTTTCACTGG - Intergenic
1193016563 X:76740359-76740381 CCTGGCAGCAGACTTTTCAATGG + Intergenic
1193098526 X:77580454-77580476 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1193204668 X:78734718-78734740 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1193246384 X:79235617-79235639 CCTGGTAGCAGACTTTTCAGTGG - Intergenic
1193504801 X:82329042-82329064 CCTGGCAGCAGACATTTCAGTGG - Intergenic
1193650500 X:84124948-84124970 CCTGGCAGCATACTTTTCAGTGG + Intronic
1193665602 X:84311769-84311791 CCTGGCAGCAGACTTTTCAATGG + Intergenic
1193670466 X:84378048-84378070 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1193676260 X:84455866-84455888 TCTGGCAGAAGCCTTTTCAGTGG + Intronic
1193756593 X:85417094-85417116 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1193830777 X:86287232-86287254 TCTGGCAGCAGACTTTTCAATGG - Intronic
1193894978 X:87102122-87102144 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1194016787 X:88631501-88631523 TCTGGCAGCAGACTTTTCACTGG + Intergenic
1194136745 X:90152972-90152994 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1194157702 X:90413918-90413940 ACTGGCAGCAGACTTTTCAGTGG - Intergenic
1194264818 X:91741446-91741468 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1194285503 X:92005952-92005974 TCTGGCAGTTGACTTTTCAGTGG - Intronic
1194457361 X:94121819-94121841 TCTGGCAGCAGACTTTTCAATGG - Intergenic
1194920963 X:99763089-99763111 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1195172061 X:102279505-102279527 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1195186799 X:102407588-102407610 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1195199542 X:102534453-102534475 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1195229572 X:102832381-102832403 ACTGCAAGCTGCCTTTTCAAAGG + Intergenic
1195595653 X:106685142-106685164 CCTGGCAGCAAACTTTTCAGTGG + Intergenic
1195985305 X:110622952-110622974 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196096534 X:111806916-111806938 CCTGGCAGCAGACTTGTCAGTGG - Intronic
1196154215 X:112408808-112408830 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196214337 X:113033546-113033568 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196247569 X:113417420-113417442 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1196253179 X:113485922-113485944 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196485438 X:116201910-116201932 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1196576407 X:117324095-117324117 TCTGGCAGCCGACTTTTCAGTGG - Intergenic
1196660721 X:118265960-118265982 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197054091 X:122095931-122095953 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197139438 X:123099833-123099855 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197440206 X:126478017-126478039 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197458156 X:126703289-126703311 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197470173 X:126857416-126857438 CTTGGCAGCAGACTTTTCAGTGG + Intergenic
1197502797 X:127262078-127262100 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197623352 X:128777429-128777451 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1197677231 X:129343208-129343230 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1197677835 X:129349095-129349117 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198190667 X:134301244-134301266 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198695067 X:139326752-139326774 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198770338 X:140124174-140124196 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1198785277 X:140281696-140281718 CCTGGCAGGAGACTTTTCAGTGG - Intergenic
1198855953 X:141016785-141016807 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1198876178 X:141229326-141229348 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198906740 X:141570582-141570604 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1198917034 X:141684254-141684276 TCTGGCAGCAGACTTTTCAGTGG + Intronic
1198982142 X:142410142-142410164 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199032423 X:143015660-143015682 TCTGGCAGCGGACTTTTCAGTGG + Intergenic
1199034133 X:143031651-143031673 GCTGGCAGCTGCCATTCAACAGG - Intronic
1199145748 X:144364187-144364209 GCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199441200 X:147869270-147869292 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1199737934 X:150702283-150702305 CCGGGAAGCTGCATTTTTACAGG - Intronic
1199908952 X:152263872-152263894 TCTGGCAGCAGACTTTTCAATGG + Intronic
1200059480 X:153477896-153477918 CCTGGCAACTGGGTCTTCACTGG - Intronic
1200062947 X:153491697-153491719 CCTGGCAGTTGCCCCTGCACAGG - Intronic
1200369824 X:155713548-155713570 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200370735 X:155721595-155721617 CCTGGCAGCAGACTTTTCAGTGG + Intergenic
1200427108 Y:3033532-3033554 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200482491 Y:3722922-3722944 TCTGGCAGCAGACTTTTCAGTGG + Intergenic
1200504034 Y:3990894-3990916 ACTGGCAGCAGACTTTTCAGTGG - Intergenic
1200581965 Y:4961892-4961914 TCTGGCAGCAGACTTTTCAGTGG - Intergenic
1200603070 Y:5230491-5230513 TCTGGCAGTTGACTTTTCAGTGG - Intronic
1201503984 Y:14677516-14677538 CCTGGGAGCTGCCTTCTAATAGG + Intronic
1201770173 Y:17611351-17611373 CCTGGCAGCTGCCCTGCAACCGG + Intergenic
1201831381 Y:18294636-18294658 CCTGGCAGCTGCCCTGCAACCGG - Intergenic