ID: 916228971

View in Genome Browser
Species Human (GRCh38)
Location 1:162520138-162520160
Sequence GCACTTAGGGAGACTGAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91510
Summary {0: 1, 1: 0, 2: 269, 3: 6747, 4: 84493}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916228971 Original CRISPR GCACTTAGGGAGACTGAATC GGG (reversed) Intronic
Too many off-targets to display for this crispr