ID: 916229223

View in Genome Browser
Species Human (GRCh38)
Location 1:162522776-162522798
Sequence TGGGCAACCCTTTTTTGTGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 491}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916229217_916229223 16 Left 916229217 1:162522737-162522759 CCTCTCAGCTATACATTGAGGGG 0: 1
1: 0
2: 1
3: 6
4: 67
Right 916229223 1:162522776-162522798 TGGGCAACCCTTTTTTGTGCGGG 0: 1
1: 0
2: 1
3: 21
4: 491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916229223 Original CRISPR TGGGCAACCCTTTTTTGTGC GGG Exonic
900625468 1:3606559-3606581 TCGGGAGCCCTTTTCTGTGCAGG - Intronic
902299060 1:15488478-15488500 TGGGCTCCCCTTTCTTGTGACGG - Intronic
903624039 1:24718586-24718608 TGGGGATCGCTTTTTTGTGAGGG - Intergenic
903732919 1:25510637-25510659 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
904244886 1:29181120-29181142 TGTGCCACGCTTTTTTGGGCGGG - Intronic
906904705 1:49877216-49877238 AGGGCATCCCTGTCTTGTGCCGG + Intronic
906929684 1:50156795-50156817 TGGGAAACCCTCTCTTGTGAAGG - Intronic
908178040 1:61575441-61575463 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
908716963 1:67080952-67080974 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
908902028 1:68966570-68966592 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
909325715 1:74349054-74349076 AGGGCATCCCTGTCTTGTGCTGG + Intronic
909333914 1:74448520-74448542 AGGGCATCCCTGTCTTGTGCCGG + Intronic
910143647 1:84054437-84054459 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
910331360 1:86075977-86075999 AGGGCATCCTTGTTTTGTGCCGG - Intronic
910486367 1:87719197-87719219 TGAGCCAACCTTTTTTGTGATGG + Intergenic
910620383 1:89247232-89247254 TGGGCATCCTTGTATTGTGCTGG - Intergenic
910957224 1:92719630-92719652 AGGGCATCCCTGTCTTGTGCCGG - Intronic
911537157 1:99114219-99114241 AGGGCATCCCTTTCTCGTGCTGG + Intergenic
911891836 1:103381276-103381298 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
912066337 1:105748375-105748397 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
912599300 1:110911938-110911960 TGGGCATCCTTGTCTTGTGCTGG - Intergenic
912881019 1:113413936-113413958 AGGGCATCCCTGTCTTGTGCTGG + Intronic
914736353 1:150420921-150420943 GGGGCAACCCTTTTCTGTAAAGG + Intronic
916229223 1:162522776-162522798 TGGGCAACCCTTTTTTGTGCGGG + Exonic
917866537 1:179201067-179201089 TGGGCCACTCTTTTTGGTTCTGG + Intronic
918501077 1:185197010-185197032 AGGGCATCCTTGTTTTGTGCCGG + Intronic
919294093 1:195671769-195671791 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
919459252 1:197856936-197856958 TGAGCAACCATTTTTTTTTCTGG + Intergenic
919608273 1:199713359-199713381 GGGGCATCCTTGTTTTGTGCTGG - Intergenic
920589161 1:207199993-207200015 AGGGCATCCTTTTCTTGTGCCGG - Intergenic
920985962 1:210889488-210889510 AGGGCATCCCTGTTCTGTGCTGG - Intronic
922002181 1:221490695-221490717 TGGGCAATTCTTTTTTGTGTGGG - Intergenic
922621159 1:226989254-226989276 TTGGCAACCCTTTTCTGTCCAGG - Intergenic
924919729 1:248615629-248615651 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
1062985820 10:1767497-1767519 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1063730738 10:8694398-8694420 AGGGCAACCCTTTATTGGACTGG - Intergenic
1065463325 10:25992567-25992589 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1065464715 10:26007315-26007337 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1065779709 10:29155942-29155964 TGGTCAACAGTTTTTTGTTCTGG - Intergenic
1067127266 10:43529524-43529546 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1067369461 10:45669964-45669986 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1067579178 10:47429888-47429910 AGGGCAGCCTTTTCTTGTGCCGG + Intergenic
1068195091 10:53705888-53705910 AGGGCATCCCTGTCTTGTGCGGG + Intergenic
1069221509 10:65889184-65889206 TGGACAACACCTTTTTGTGTGGG + Intergenic
1070566043 10:77604691-77604713 TAGGCAACTCTTTTTTTTGGGGG - Intronic
1071001645 10:80837830-80837852 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1071388647 10:85147654-85147676 TGGCCCACCCTCTTTTCTGCAGG + Intergenic
1071525590 10:86356173-86356195 TGGGCAGCCCTTCCATGTGCTGG - Intronic
1073175003 10:101550125-101550147 TGGCCAACCCTTTTTGGCGTAGG - Intronic
1073652774 10:105379407-105379429 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1074424461 10:113338776-113338798 TGGCCAACCCTTTTTTGAGCTGG + Intergenic
1074668128 10:115755227-115755249 AGGGCATCCTTTTCTTGTGCTGG + Intronic
1076192328 10:128491589-128491611 TGGGCAAGCCTTGATTGAGCAGG - Intergenic
1076508013 10:130991196-130991218 TGGGCAACACTGATCTGTGCTGG - Intergenic
1078119665 11:8494031-8494053 AGGGCATCCCTGTCTTGTGCAGG - Intronic
1078166763 11:8893331-8893353 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1079649546 11:22909643-22909665 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1079761222 11:24331899-24331921 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1080033221 11:27684458-27684480 AGGGCATCCTTGTTTTGTGCCGG + Intronic
1081363655 11:42209451-42209473 AGGGCATCTCTTTCTTGTGCCGG - Intergenic
1081581731 11:44356764-44356786 TTGGCCACCCTTTTTTTTTCTGG + Intergenic
1081906663 11:46674639-46674661 TGGGCAAGCCTGTTTTGAGTCGG + Intronic
1084931226 11:72557630-72557652 TTGGCAACCCTTTATTCTGCTGG + Intergenic
1086085675 11:82952424-82952446 AGGGCATCCCTGTCTTGTGCTGG + Intronic
1086212898 11:84342282-84342304 TGGGCATTCCTTTCTGGTGCTGG - Intronic
1086976682 11:93140591-93140613 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1087001471 11:93424925-93424947 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1087210285 11:95440164-95440186 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1087466873 11:98519047-98519069 TGGGCATCCTTTTCTTGTTCTGG + Intergenic
1087712150 11:101566926-101566948 AGGGCCACCCAGTTTTGTGCTGG - Intronic
1087757400 11:102069282-102069304 TGGGGGACCCTTTTTAGTTCAGG - Intronic
1088179840 11:107096700-107096722 TGGGCATCCTTGTTTTGTTCCGG - Intergenic
1088211564 11:107462571-107462593 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1090029384 11:123194672-123194694 TGGGGAACCGTTTGATGTGCAGG - Intronic
1090072377 11:123555046-123555068 GGGGCTGCCCTTTTTTGTTCTGG - Intronic
1090103427 11:123826231-123826253 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1090897180 11:130988211-130988233 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1091755602 12:3049476-3049498 TGGGCAAACTTTTTCTGTGAAGG - Intergenic
1091810611 12:3394268-3394290 AGGGCATCCCTGTGTTGTGCCGG + Intronic
1092679371 12:10961026-10961048 TATGGAACCCTTTTTTGTTCTGG - Intronic
1095146851 12:38740451-38740473 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1095667242 12:44817086-44817108 AGGACAATCCTTCTTTGTGCAGG + Intronic
1095677403 12:44935776-44935798 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1097414763 12:59301433-59301455 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1097514376 12:60586130-60586152 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1097775363 12:63638292-63638314 AGGGCAACCCTGTCTTGTGCTGG - Intronic
1098053322 12:66476961-66476983 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1098347481 12:69521460-69521482 AGGGCATCCTTGTTTTGTGCTGG + Intronic
1098723201 12:73928216-73928238 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1098736242 12:74109641-74109663 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
1098776830 12:74631111-74631133 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1099008303 12:77261053-77261075 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1099239771 12:80125095-80125117 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1099340328 12:81423679-81423701 TGGGCATCCTTTTCTTGTGCTGG - Intronic
1099808106 12:87545550-87545572 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1100135569 12:91549132-91549154 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
1101423916 12:104571771-104571793 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1101472287 12:105009521-105009543 AGGGCATCCTTGTTTTGTGCTGG + Intronic
1103168784 12:118795173-118795195 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1103254016 12:119524631-119524653 GGGGCATCCCTTTTGTGTTCAGG - Intronic
1104173042 12:126301071-126301093 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1106427273 13:29643767-29643789 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1108136489 13:47368257-47368279 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1108615415 13:52128047-52128069 GGGGTAATCCTTTATTGTGCGGG - Intronic
1110418455 13:75278049-75278071 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1110890652 13:80693682-80693704 AGGGCAACCTTGTCTTGTGCCGG - Intergenic
1111312621 13:86509173-86509195 AGGGCATCCCTGTTTTGTGCCGG - Intergenic
1111622053 13:90736843-90736865 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
1111747144 13:92284825-92284847 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1112130727 13:96520904-96520926 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1114335910 14:21689885-21689907 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1114971452 14:28034797-28034819 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1115624514 14:35176799-35176821 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1116177792 14:41495176-41495198 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
1116319378 14:43440713-43440735 TGGGCAACCTTGTCTTGTGCTGG - Intergenic
1116353851 14:43902223-43902245 TGGGCAACATTTTTTTCTGTAGG - Intergenic
1116570773 14:46512657-46512679 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1116691607 14:48114287-48114309 TGTGCAACCCTTTTCTGAGTTGG + Intergenic
1119271056 14:73305099-73305121 TTAGCAACCGTTTTTTGTGAAGG + Intronic
1120567348 14:86076550-86076572 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1123025690 14:105422685-105422707 TGGGCAACCCGTATTTTAGCTGG + Intronic
1202932415 14_KI270725v1_random:50518-50540 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1126070194 15:44859212-44859234 AGGACAACTCTTTGTTGTGCAGG + Intergenic
1126476694 15:49072628-49072650 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1126863071 15:52906121-52906143 TGGGCATCCTTGTCTTGTGCTGG - Intergenic
1127398774 15:58564790-58564812 TGGGCAGCCCTTTCTTTTGCTGG - Intronic
1127570977 15:60241243-60241265 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1130653691 15:85777099-85777121 TGGGCAGCCCATTCCTGTGCAGG - Intronic
1131265777 15:90914380-90914402 TGTGCAACCCTCTTCTGGGCGGG + Intronic
1136662447 16:31775741-31775763 AGGGCAACCTTGTCTTGTGCTGG - Intronic
1136889087 16:33954638-33954660 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1137387793 16:48057159-48057181 TTGGCAACACTTTTCTGTGAAGG + Intergenic
1138416537 16:56874817-56874839 TGTGCATTCCTTTTTTTTGCGGG - Intronic
1141260828 16:82452265-82452287 TGGGCATTGCTTTTGTGTGCAGG - Intergenic
1143863788 17:9909502-9909524 TGGGCAACCCTCTTTCCTGGAGG - Intergenic
1146659889 17:34658763-34658785 TGGACAACTCTTTTTTCAGCAGG - Intergenic
1147527874 17:41243941-41243963 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1148980506 17:51570307-51570329 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1149072177 17:52556326-52556348 TGGGTTCCCCTTCTTTGTGCAGG + Intergenic
1149721403 17:58848331-58848353 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1151008294 17:70462905-70462927 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1153511795 18:5862746-5862768 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1155395595 18:25383560-25383582 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
1157102780 18:44745011-44745033 TGGGCCTCCCTTTGTTGTGGGGG + Intronic
1159105228 18:63996829-63996851 TGGGCATCCTTTTTATTTGCTGG - Intronic
1159145865 18:64453238-64453260 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1159337491 18:67088926-67088948 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1159486338 18:69063042-69063064 TAGGCATCCCTGTTTTGTTCTGG - Intergenic
1159682916 18:71377328-71377350 TGGGAAAGCCCTTTGTGTGCAGG + Intergenic
1159902142 18:74057307-74057329 AGGGCATCCTTTTCTTGTGCGGG - Intergenic
1160432479 18:78821351-78821373 TGAGCAACCCTTTTACTTGCGGG + Intergenic
1167702530 19:51058550-51058572 TTTGCCACCCTCTTTTGTGCCGG + Exonic
925520436 2:4737678-4737700 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
925855960 2:8129876-8129898 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
926513102 2:13807178-13807200 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
926736804 2:16079645-16079667 TTGGCAAACCTTTTTTGTAAAGG + Intergenic
927221587 2:20715464-20715486 AGGGCATCCCTGTCTTGTGCCGG - Intronic
928604450 2:32932562-32932584 TGGGCAAACTTTTTCTGTGAAGG + Intergenic
928760288 2:34573641-34573663 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
930137021 2:47912626-47912648 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
930222928 2:48763631-48763653 AGGGCATCCTTTTCTTGTGCCGG + Intronic
930803415 2:55466230-55466252 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
930867801 2:56139193-56139215 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
930894062 2:56425117-56425139 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
931204293 2:60132250-60132272 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
931423843 2:62152710-62152732 TGGGCAACCATATCTTGTGGTGG - Intergenic
931484970 2:62681599-62681621 TAGCCAACCCTGTTTTGTTCAGG + Intronic
931502024 2:62879224-62879246 TGGGCATCCTTGTTTTGTTCTGG - Intronic
931538897 2:63306825-63306847 AGGGCATCCCTGTCTTGTGCTGG - Intronic
931648756 2:64450030-64450052 TAGGAAACCCTTTTTTGTGGGGG - Intergenic
932114183 2:69031123-69031145 TGGGCAAGCTTTTTCTGTGAAGG - Intronic
932179409 2:69632437-69632459 TGGGTAACTCTTTGTTGTGGAGG - Intronic
932523061 2:72433961-72433983 AGGGCAACCTTGTCTTGTGCCGG + Intronic
932643948 2:73482135-73482157 AGGGCATCCCTGTCTTGTGCCGG + Intronic
933069922 2:77844370-77844392 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
933696864 2:85225834-85225856 AGGGCATCCCTGTCTTGTGCCGG + Intronic
934109687 2:88730659-88730681 AGGGCATCCCTGTCTTGTGCCGG - Intronic
935021624 2:99237801-99237823 TGGGGAACACTTTTTTGAGATGG + Intronic
935458730 2:103302200-103302222 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
935923247 2:108037933-108037955 TGGGCATCCTTGTCTTGTGCTGG + Intergenic
936649509 2:114410056-114410078 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
936862644 2:117036001-117036023 TGGGCATCCTTGTCTTGTGCTGG - Intergenic
937030091 2:118731767-118731789 TGGGGAACCCTGGTGTGTGCAGG - Intergenic
938951897 2:136262486-136262508 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
939000033 2:136724012-136724034 TGGGCATCCCTGTCTTGTTCCGG + Intergenic
939298812 2:140305710-140305732 AGGGCATCCCTGTCTTGTGCCGG + Intronic
939640472 2:144634717-144634739 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
939686889 2:145211372-145211394 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
939912754 2:148003694-148003716 AGGGCATCCTTTTCTTGTGCCGG - Intronic
940430061 2:153579219-153579241 TGGGCAACCCTTTGATGTCCTGG - Intergenic
940953475 2:159703490-159703512 TGGGAAAGCTTTTTTTTTGCGGG - Intergenic
941276339 2:163495497-163495519 AGGGCAACCTTGTTTTGTGCTGG - Intergenic
941726770 2:168869290-168869312 AGGGCATCCCTGTCTTGTGCCGG - Intronic
941761858 2:169252574-169252596 AGGGCATCCCTGTCTTGTGCCGG - Intronic
942390137 2:175484026-175484048 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
942391433 2:175498007-175498029 TGGGCATCCTTGTTTTGTTCTGG + Intergenic
943001576 2:182334709-182334731 AGGACATCCTTTTTTTGTGCTGG - Intronic
943054532 2:182959671-182959693 AGGGCATCCCTGTCTTGTGCTGG - Intronic
943087888 2:183335245-183335267 TGGGCATCCTTGTTTTGTCCCGG + Intergenic
943866184 2:192927225-192927247 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
944297603 2:198084688-198084710 TGGGCAACCTTCTTTTGCTCAGG - Exonic
944327825 2:198427678-198427700 TGGGCATACTTTTCTTGTGCCGG + Intronic
944334233 2:198510544-198510566 CGGGCATCCTTTTCTTGTGCCGG + Intronic
944774488 2:202948904-202948926 AGGGCATCCTTTTCTTGTGCTGG + Intronic
945490533 2:210449436-210449458 AGGGCATCCTTGTTTTGTGCTGG - Intronic
945678668 2:212886536-212886558 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
945733447 2:213569292-213569314 AGGGCATCCCTGTCTTGTGCCGG + Intronic
946217361 2:218194935-218194957 TGGGCAGTCCTTTTTTGTGTTGG + Intergenic
946553457 2:220828627-220828649 TGGGCATTCTTGTTTTGTGCTGG - Intergenic
947040602 2:225914836-225914858 TGGGCAAAGATTTTTTGTGTAGG - Intergenic
1170070552 20:12361622-12361644 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1170469919 20:16658404-16658426 AGGGCACCCCTGTCTTGTGCAGG + Intergenic
1173377641 20:42502591-42502613 TGGGTAACTCATTTTTGTGCTGG + Intronic
1173913856 20:46691791-46691813 TGAGCAACGATTTTTTGTGTAGG - Intergenic
1174091555 20:48052675-48052697 TTAGAAACCCTTTTGTGTGCTGG - Intergenic
1176420746 21:6512932-6512954 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1177241595 21:18465344-18465366 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1178209036 21:30506760-30506782 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1179183924 21:39068822-39068844 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
1179696237 21:43121251-43121273 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1180047296 21:45314099-45314121 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1182261703 22:29077171-29077193 TGGGCAAGCATTTTTTGTAGAGG + Intronic
949246661 3:1932793-1932815 AGGGCAACCTTGTCTTGTGCCGG - Intergenic
949435694 3:4026876-4026898 AGGGCATCCCTGTCTTGTGCCGG - Intronic
949633570 3:5957112-5957134 GGGGCATCCTTGTTTTGTGCTGG - Intergenic
949683453 3:6541576-6541598 TTGGCCACCCAGTTTTGTGCCGG + Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950425738 3:12923907-12923929 TTGGGAACCCATTTTTCTGCAGG + Intronic
950619310 3:14190844-14190866 AGGGCATCCCTGTCTTGTGCCGG + Intronic
951084827 3:18499527-18499549 TGGGCAACCCATCTCTGTGTGGG - Intergenic
951254104 3:20429178-20429200 TGGGCATCCTTGTCTTGTGCCGG + Intergenic
951352035 3:21618058-21618080 TGGACAAATCTTTTTTTTGCAGG - Intronic
951386922 3:22054205-22054227 AGGGCATCCCTGTCTTGTGCCGG - Intronic
951433263 3:22632789-22632811 TGAGCAACCTCTTTTTGTGTGGG - Intergenic
951784226 3:26400078-26400100 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
951827026 3:26879932-26879954 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
953255017 3:41281734-41281756 AGGGCATCCTTGTTTTGTGCTGG - Intronic
954463137 3:50638956-50638978 TGAGCAACCCTTTTTGGGGGTGG + Intronic
955039487 3:55301360-55301382 TGAGCATCCCTTCCTTGTGCTGG - Intergenic
956243362 3:67154327-67154349 AGGGCCACACATTTTTGTGCTGG - Intergenic
956255624 3:67280336-67280358 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
956317254 3:67951875-67951897 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
956549959 3:70447072-70447094 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
956854768 3:73265052-73265074 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
957426469 3:80045924-80045946 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
957594611 3:82246541-82246563 TAGGCAGCCCTTTTATCTGCTGG - Intergenic
957598559 3:82301365-82301387 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
957707374 3:83806045-83806067 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
958133816 3:89462886-89462908 AGGGCATCCCTGTCTTGTGCCGG + Intronic
958202496 3:90338021-90338043 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
958460590 3:94389816-94389838 TGGGCATCCTTTTCTTGTTCTGG - Intergenic
959691597 3:109203821-109203843 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
959694896 3:109238704-109238726 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
960012946 3:112853276-112853298 AGGGCATCCTTATTTTGTGCCGG - Intergenic
960331343 3:116363945-116363967 AGGGCATCCCTGTCTTGTGCCGG - Intronic
960642882 3:119845250-119845272 AGGGCACCCTTGTTTTGTGCTGG - Intronic
960779355 3:121301603-121301625 AGGGCATCCCTGTCTTGTGCCGG + Intronic
962999088 3:140660027-140660049 TGGGCATCCTTTTCTTGTGCCGG - Intergenic
963048191 3:141119548-141119570 AGGGCATCCCTGTCTTGTGCCGG + Intronic
963622632 3:147631430-147631452 TGGGCTACCTTATTTTGTTCTGG + Intergenic
964564816 3:158038213-158038235 AGGGCATCCCTGTCTTGTGCAGG - Intergenic
964639223 3:158890775-158890797 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
964658792 3:159097424-159097446 AGGGCATCCCTGTCTTGTGCCGG + Intronic
965181279 3:165406444-165406466 TGGGAAACCCTTTATTTTGTTGG - Intergenic
965958669 3:174402872-174402894 AGGGCAACCTTATGTTGTGCTGG - Intergenic
966291551 3:178365216-178365238 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
966637545 3:182152756-182152778 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
967341621 3:188405099-188405121 TGGGCATTTCTTTGTTGTGCGGG + Intronic
969782080 4:9413415-9413437 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
970527484 4:16947032-16947054 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
970621998 4:17831925-17831947 TTGGCAAACCTTTTGTGTACAGG + Intronic
970901358 4:21163339-21163361 AGGGCATCCCTGTCTTGTGCCGG - Intronic
970975330 4:22036904-22036926 AGGGCACCCCTGTGTTGTGCCGG + Intergenic
971200677 4:24507030-24507052 TGCATAACCCTATTTTGTGCTGG + Intergenic
973143418 4:46796258-46796280 AGGGCATCCCTGTCTTGTGCCGG + Intronic
973654686 4:53034407-53034429 TGGGCATCCTTGTTTTGTGCTGG - Intronic
974321502 4:60355686-60355708 AGGGCATCCCTCTTTTGTGCCGG - Intergenic
974427198 4:61756677-61756699 AGGGCATCCCTGTCTTGTGCCGG + Intronic
974997950 4:69185397-69185419 AGGGCATCCCTGTCTTGTGCCGG + Intronic
975219107 4:71793713-71793735 AGGGCATCCTTTTCTTGTGCTGG + Intronic
975963560 4:79941666-79941688 AGGGCATCCCTGTCTTGTGCCGG - Intronic
975965774 4:79970851-79970873 AGGGCATCCCTGTCTTGTGCCGG - Intronic
976481432 4:85551086-85551108 AGGGCATCCCTGTCTTGTGCTGG + Intronic
976642011 4:87349176-87349198 AGGGCATCCCTGTCTTGTGCCGG + Intronic
977047261 4:92083046-92083068 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
977161397 4:93640368-93640390 AGGGCATCCCTGTCTTGTGCCGG + Intronic
977949518 4:102954029-102954051 AGGGCATCCCTGTCTTGTGCTGG + Intronic
978039329 4:104040029-104040051 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
978236533 4:106467612-106467634 AGGGCATCCTTTTCTTGTGCAGG + Intergenic
978664672 4:111168120-111168142 AGGGCAACCTTGTCTTGTGCCGG - Intergenic
979022490 4:115521128-115521150 AGGGCACCCCTGTCTTGTGCCGG + Intergenic
979398531 4:120219117-120219139 TGGGCATCCTTGTTTTGTTCTGG + Intergenic
979629599 4:122885484-122885506 TGAGAAATCCTTTTTTGTGATGG + Intronic
980690978 4:136295578-136295600 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
980865541 4:138549972-138549994 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
981206397 4:142045991-142046013 TGGGAAAGCCTTTTTTGAGGGGG + Intronic
981573438 4:146177706-146177728 TGGGCAGTCCTTTGTTGTGGAGG + Intronic
981605067 4:146531576-146531598 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
982295034 4:153819312-153819334 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
982479313 4:155889990-155890012 TTTTCAACCCTTTTTTATGCTGG - Intronic
982683932 4:158465255-158465277 AGGGCATCCCTGTCTTGTGCCGG + Intronic
982815068 4:159874464-159874486 AGGGCATCCTTGTTTTGTGCCGG + Intergenic
983005460 4:162479016-162479038 AGGGCATCCTTGTTTTGTGCCGG + Intergenic
983101955 4:163636178-163636200 AGGGCATCCCTGTCTTGTGCCGG - Intronic
983108591 4:163721086-163721108 AGGGCATCCCTGTATTGTGCCGG + Intronic
983363707 4:166759827-166759849 AGGGCATCCCTGTCTTGTGCCGG - Intronic
983828703 4:172298411-172298433 AGGGCATCCCTGTCTTGTGCCGG + Intronic
983841238 4:172459297-172459319 AGGGCAACCTTGTCTTGTGCTGG - Intronic
985439271 4:189967768-189967790 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
985442372 4:189992137-189992159 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
985796902 5:1969371-1969393 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
986356303 5:6930613-6930635 AGGGCATTCTTTTTTTGTGCCGG + Intergenic
986423329 5:7605869-7605891 AGGGCATCCCTGTCTTGTGCCGG + Intronic
986878145 5:12136261-12136283 AGGGCATACCTATTTTGTGCTGG - Intergenic
987260783 5:16200502-16200524 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
987528387 5:19082056-19082078 AGGGCACCCTTTTCTTGTGCCGG - Intergenic
987669534 5:20989358-20989380 AGGGCAACCTTGTCTTGTGCCGG - Intergenic
987809874 5:22821318-22821340 AGGGCATCCCTGTCTTGTGCCGG - Intronic
987928487 5:24372051-24372073 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
988305992 5:29494767-29494789 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
988747187 5:34151787-34151809 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
988846810 5:35135783-35135805 TGGGCAGCCATGTTTTGTTCTGG + Intronic
989461622 5:41705969-41705991 TGGGCATCCTTTTCTTGTTCAGG + Intergenic
989950942 5:50296659-50296681 AGGGCATCCCTGTGTTGTGCCGG - Intergenic
990705097 5:58519327-58519349 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
991242186 5:64473146-64473168 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
992183209 5:74218526-74218548 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
992265503 5:75014225-75014247 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
992502450 5:77356045-77356067 TCAGCAACCTTTTTCTGTGCAGG - Intronic
992536588 5:77711328-77711350 TCAGCAACCCTTTTTTGTAAAGG - Intronic
993043747 5:82844122-82844144 AGGGCATCCCTCTCTTGTGCCGG + Intergenic
993114731 5:83706664-83706686 AGGGCATCCTTGTTTTGTGCTGG - Intronic
993357967 5:86938398-86938420 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
994036981 5:95212947-95212969 AGGGCATCCCTGTCTTGTGCCGG - Intronic
994602348 5:101922740-101922762 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
994811300 5:104522535-104522557 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
994835798 5:104850543-104850565 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
995043746 5:107620246-107620268 TGGGCAACTCCTAATTGTGCTGG + Intronic
995108688 5:108403633-108403655 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
995185095 5:109263336-109263358 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
995231833 5:109773366-109773388 TAGTAAACCCTTTTTTATGCTGG + Intronic
995416371 5:111917792-111917814 AGGGCATCCCTGTCTTGTGCCGG - Intronic
996100764 5:119443118-119443140 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
996150511 5:120028971-120028993 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
996181789 5:120428458-120428480 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
996271160 5:121606235-121606257 GGGGCATCCTTTTCTTGTGCTGG - Intergenic
996462836 5:123766810-123766832 AGGGCAACCTTGTCTTGTGCTGG + Intergenic
998309518 5:141113395-141113417 AGGGCATCCCTGTCTTGTGCCGG + Intronic
999501986 5:152156353-152156375 AGGGCATCCTTGTTTTGTGCCGG + Intergenic
999963846 5:156786878-156786900 AGGGCATCCTTGTTTTGTGCAGG - Intergenic
1000657989 5:163905304-163905326 AGGGGATCCCATTTTTGTGCAGG + Intergenic
1001503643 5:172259003-172259025 TGGGCATCCTTGTTTTGTTCTGG + Intronic
1001838783 5:174855381-174855403 TGGAGAACCCTCTTTTGTTCTGG - Intergenic
1003971370 6:11302949-11302971 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1004032237 6:11881946-11881968 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1005671158 6:28107656-28107678 TGGGCTACTCCTTTTTGGGCTGG - Intergenic
1007133447 6:39498496-39498518 AGGGCAAACTTTTTTTGTGAAGG + Intronic
1008576476 6:52865192-52865214 AGGGCATCCCTGTCTTGTGCAGG - Intronic
1008819362 6:55611888-55611910 GGGGCATCCTTTTCTTGTGCTGG - Intergenic
1009241158 6:61187542-61187564 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
1009264477 6:61535847-61535869 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
1009384516 6:63072326-63072348 AGGGCATCCCTGTCTTGTGCAGG + Intergenic
1009449215 6:63781807-63781829 AGGGCATCCCTATCTTGTGCCGG + Intronic
1009517197 6:64635380-64635402 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1009917510 6:70014296-70014318 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1010182017 6:73097525-73097547 TGGGCATCCTTATTTTGTTCTGG - Intronic
1010441628 6:75901782-75901804 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1010747596 6:79581723-79581745 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
1010812078 6:80312483-80312505 AGGGCAACCTTGTCTTGTGCTGG + Intronic
1010956773 6:82099185-82099207 AGGGCATCCTTTTCTTGTGCAGG - Intergenic
1011291755 6:85784140-85784162 AGGGCATCCCTCTCTTGTGCTGG + Intergenic
1011313004 6:86001103-86001125 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1012302850 6:97611737-97611759 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1013440258 6:110157613-110157635 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1014024138 6:116625226-116625248 TGGGCAAGGCTTTTTAGTGGAGG + Intronic
1014065839 6:117124405-117124427 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1014357037 6:120425379-120425401 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
1015213921 6:130728124-130728146 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1015422101 6:133022776-133022798 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1015437061 6:133201877-133201899 TGGGCAAGCATCTTCTGTGCAGG - Intergenic
1016855819 6:148669841-148669863 AGGGCAACCTTGTCTTGTGCTGG + Intergenic
1017258949 6:152364862-152364884 TGGGCATCCCTTTTGTCTGCAGG - Exonic
1017939212 6:159036459-159036481 TGGTCAGCACTTTTTTGTGAGGG + Exonic
1018037145 6:159891216-159891238 TGGATAACTCTTTTCTGTGCTGG + Intergenic
1020619492 7:10500861-10500883 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
1020773785 7:12428396-12428418 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1020818430 7:12936128-12936150 AGGGCATCCCTATCTTGTGCCGG + Intergenic
1022659419 7:32352655-32352677 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1022999220 7:35790335-35790357 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1023610574 7:41966709-41966731 TGAGCAACCCTTTTCTGTAAAGG + Intronic
1024463309 7:49682331-49682353 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1024679719 7:51672921-51672943 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1025524127 7:61783260-61783282 AGGGCATCCCTCTCTTGTGCCGG + Intergenic
1027786189 7:82581719-82581741 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1028211652 7:88081424-88081446 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1028395162 7:90361191-90361213 AGGGCATCCCTGTGTTGTGCTGG + Intronic
1028507593 7:91587219-91587241 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1028786330 7:94798457-94798479 AGGGCATCCCTCTCTTGTGCTGG - Intergenic
1028836780 7:95383286-95383308 AGGGCATCCCTGTCTTGTGCTGG - Intronic
1028970009 7:96848711-96848733 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1029333349 7:99878639-99878661 TTGGCAACACGTTTTGGTGCTGG + Intronic
1029830205 7:103248666-103248688 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1029844775 7:103401618-103401640 AGGGCATCCTTTTCTTGTGCTGG + Intronic
1029944713 7:104520004-104520026 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1030530748 7:110709065-110709087 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1030572516 7:111245576-111245598 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1030736158 7:113051125-113051147 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1030795124 7:113778183-113778205 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1031254649 7:119432216-119432238 AGGGCATCCTTTTCTTGTGCAGG - Intergenic
1031684378 7:124715038-124715060 TGGGCATCCTTGTCTTGTGCCGG - Intergenic
1032721710 7:134555430-134555452 TGGGGACCCATTTTTTTTGCTGG - Intronic
1032726878 7:134598027-134598049 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1032785398 7:135196190-135196212 CGAGCAGCCCTTTATTGTGCTGG - Exonic
1033417492 7:141176015-141176037 AGGGCATCCTTGTTTTGTGCTGG + Intronic
1033498365 7:141922742-141922764 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1034109126 7:148519429-148519451 AGGGCATCCTTTTTTTGTGCTGG + Intergenic
1034208559 7:149341464-149341486 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1034244381 7:149633588-149633610 TGGGCAAGCCTCTTTTGTGATGG - Intergenic
1034779744 7:153867708-153867730 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1039812085 8:41058080-41058102 GTGTCAACCCTTTATTGTGCAGG + Intergenic
1040053067 8:43034354-43034376 TGGGGAACACTTCTTTTTGCAGG - Intronic
1040451369 8:47550826-47550848 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1040771952 8:50988542-50988564 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1040942655 8:52848738-52848760 AGGGCATCCCTGTTTTGTGCCGG + Intergenic
1041344600 8:56883704-56883726 TGGGCATTTCTTTTTTTTGCTGG - Intergenic
1041747234 8:61221241-61221263 AGGGCATCCTTTTCTTGTGCCGG + Intronic
1042296187 8:67220804-67220826 TGGGCAATCCTGTTTTTTCCAGG + Intronic
1042452857 8:68969325-68969347 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
1042636364 8:70880207-70880229 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1042815895 8:72877617-72877639 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1044128068 8:88483204-88483226 AGGGCATCCTTGTTTTGTGCCGG - Intergenic
1044312147 8:90706249-90706271 AGGGCATCCTTGTTTTGTGCAGG + Intronic
1044643650 8:94414384-94414406 AGGGCATCCCTGTCTTGTGCTGG + Intronic
1045123640 8:99065588-99065610 AGGGCATCCCTGTGTTGTGCCGG - Intronic
1045143175 8:99310240-99310262 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1045647377 8:104312652-104312674 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
1046134911 8:110013032-110013054 AGGGAAACCTTGTTTTGTGCTGG + Intergenic
1047519808 8:125586784-125586806 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1047815126 8:128455050-128455072 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1048401211 8:134072804-134072826 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1048449411 8:134520265-134520287 TGGACAATCCTTTGTTGTGGAGG - Intronic
1048944268 8:139429754-139429776 TGGGCAAGGCTTTTCTGTGGAGG - Intergenic
1049504258 8:142986541-142986563 TGGGCATCCCTGTCTTCTGCAGG + Intergenic
1050353226 9:4760078-4760100 TTGACAACCCTGTTTTATGCTGG - Intergenic
1050623853 9:7482679-7482701 AGGGCAACCTTGTCTTGTGCTGG - Intergenic
1051022369 9:12559526-12559548 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1051914776 9:22195340-22195362 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1052358474 9:27529300-27529322 TGGGCGACCCTTGTTCCTGCCGG + Intronic
1052479796 9:29009117-29009139 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1052499781 9:29274271-29274293 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1052632027 9:31053481-31053503 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1053041215 9:34874253-34874275 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1053173161 9:35905170-35905192 TGGGCAACCCTTTCTGCTGTGGG - Intergenic
1054335970 9:63809724-63809746 AGGGCATCCCTGTCTTGTGCGGG - Intergenic
1055324392 9:75113662-75113684 TGGGCAACCCTTTTTGTTAATGG + Intronic
1056176187 9:84038495-84038517 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1056229861 9:84532194-84532216 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1057326149 9:94066046-94066068 GGGACAACTCTTTGTTGTGCTGG + Intronic
1057718268 9:97512977-97512999 TGGGCCACACTCTTTTGTGGGGG - Intronic
1058266354 9:102903817-102903839 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1058548607 9:106088390-106088412 AGGGCATCCTTGTTTTGTGCCGG + Intergenic
1059240439 9:112800188-112800210 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1060278766 9:122201837-122201859 TGAGCAACTCATTTCTGTGCAGG + Intergenic
1060415715 9:123428485-123428507 AGGGCATCCCTGTCTTGTGCTGG - Intronic
1186066066 X:5766065-5766087 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1186070547 X:5814916-5814938 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1186242958 X:7589652-7589674 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1186347883 X:8713229-8713251 TGGGCAGCCCTTTTTGATTCAGG - Intronic
1186652360 X:11574659-11574681 AGGGCATCCCTGTCTTGTGCCGG - Intronic
1186775471 X:12860356-12860378 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1186964066 X:14768718-14768740 AGGGCATCCTTGTTTTGTGCCGG + Intergenic
1188806623 X:34598505-34598527 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1189498617 X:41532391-41532413 TGGGCAAGCCTTTTCTGTAAAGG - Intronic
1189618713 X:42812730-42812752 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1190052470 X:47160809-47160831 TGGGCAACACTTTTCTGTGAAGG + Intronic
1190271961 X:48872061-48872083 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1190599372 X:52073895-52073917 AGGGCAACCTTGTCTTGTGCCGG + Intergenic
1190609452 X:52180178-52180200 AGGGCAACCTTGTCTTGTGCCGG - Intergenic
1190836462 X:54105492-54105514 AGGGCATCCCTGTCTTGTGCTGG - Intronic
1191122150 X:56917318-56917340 AGTGCATCCCTGTTTTGTGCTGG + Intergenic
1191196339 X:57727535-57727557 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1191968820 X:66791096-66791118 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1192389671 X:70712848-70712870 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1192755465 X:74042639-74042661 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1192797032 X:74432387-74432409 TTGGCAATCCTTCTTTGTGAAGG - Intronic
1193061008 X:77207167-77207189 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1193190020 X:78559855-78559877 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1193465710 X:81845102-81845124 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1193578002 X:83227518-83227540 TGGGCATCCTTTTCTTGTTCTGG + Intergenic
1193583245 X:83290364-83290386 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1193623540 X:83788150-83788172 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
1193746804 X:85291993-85292015 AGGGCATCCTTTTCTTGTGCTGG + Intronic
1193755513 X:85404403-85404425 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1195148180 X:102039281-102039303 TGGGCATCCTTGTCTTGTGCCGG - Intergenic
1195830833 X:109056712-109056734 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1195882522 X:109607476-109607498 AGGGCATCCCTGTCTTGTGCCGG - Intergenic
1195886941 X:109648608-109648630 AGGGCATCCCTGTCTTGTGCTGG - Intronic
1196787922 X:119437525-119437547 AGGGCATCCCTGTCTTGTGCCGG + Intronic
1196982162 X:121227029-121227051 AGGGCATCCTTTTCTTGTGCTGG + Intergenic
1197191469 X:123652365-123652387 AGGGCATCCCTGTGTTGTGCTGG - Intronic
1197512128 X:127382643-127382665 TGGGCATCCTTTTCTTGTTCTGG + Intergenic
1198138412 X:133778069-133778091 TGTGCAACCCTTTTTAAAGCAGG - Intronic
1198484835 X:137076781-137076803 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1198781161 X:140237219-140237241 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1198893249 X:141423276-141423298 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1199302544 X:146230011-146230033 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1199801592 X:151256798-151256820 AGGGCATCCTTTTCTTGTGCTGG - Intergenic
1199887528 X:152035549-152035571 AGGGCATCCCTGTCTTGTGCCGG + Intergenic
1199946807 X:152676542-152676564 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1200382512 X:155853703-155853725 AGGGCATCCCTGTCTTGTGCTGG + Intergenic
1200532040 Y:4351134-4351156 AGGGCATCCCTGTCTTGTGCTGG - Intergenic
1201783666 Y:17749865-17749887 AGGGCATCCTTGTTTTGTGCTGG - Intergenic
1201817887 Y:18156122-18156144 AGGGCATCCTTGTTTTGTGCTGG + Intergenic
1202059934 Y:20876165-20876187 AGGGCATCCCTGTCTTGTGCCGG + Intergenic