ID: 916236343

View in Genome Browser
Species Human (GRCh38)
Location 1:162592593-162592615
Sequence CGTCCCAAGAGACCAAAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916236343 Original CRISPR CGTCCCAAGAGACCAAAAGG GGG (reversed) Intronic
900233551 1:1575026-1575048 CGTCCCAAGAGACGAAACGCCGG - Intergenic
904491058 1:30859318-30859340 CATCTCAAGAGAAAAAAAGGGGG - Intergenic
911733087 1:101309921-101309943 CAACACAAGAGATCAAAAGGTGG - Intergenic
912899393 1:113631290-113631312 CGTTACAAGAGACAAAAAGCAGG - Intronic
912972673 1:114298734-114298756 AGTCCAGAGAAACCAAAAGGAGG - Intergenic
913111833 1:115664074-115664096 GGTCCCGAGAGTCCAAAATGCGG - Exonic
915312442 1:155011335-155011357 AGCACCAAGAAACCAAAAGGTGG - Intronic
915785157 1:158602888-158602910 AGGCCCAAGAGTCCAAAAGCTGG + Intergenic
916236343 1:162592593-162592615 CGTCCCAAGAGACCAAAAGGGGG - Intronic
916566892 1:165988460-165988482 CATCCCAAGACTCCACAAGGGGG + Intergenic
917920624 1:179746766-179746788 CCTCTCAAGCAACCAAAAGGGGG - Intronic
919917955 1:202150671-202150693 TGTCCACAGGGACCAAAAGGTGG - Intronic
921334573 1:214073488-214073510 GATCTCAAGAGACCAAAAGGGGG + Intergenic
922748794 1:228061157-228061179 CGCCCCAAGAGCCCAAAAGAGGG + Exonic
923101515 1:230821410-230821432 CCTCCCAAGAGCCCAAGAGTCGG + Intergenic
923576581 1:235164025-235164047 CGTCTCAAAAAAACAAAAGGAGG + Intronic
1064611329 10:17105982-17106004 CCTCCCAAGAGCCCAATAGAGGG + Intronic
1067101612 10:43338557-43338579 GGTGCCAAGATACCAAAAGGAGG + Intergenic
1067684684 10:48459240-48459262 TGTCCCCAGAACCCAAAAGGAGG + Intronic
1067774009 10:49148500-49148522 TGTCCCAAGAGGCCACAGGGAGG - Intergenic
1072441420 10:95459514-95459536 AGTCCAAAGAGAAGAAAAGGAGG + Intronic
1076521270 10:131082762-131082784 TGTCCCAAGAGTGGAAAAGGGGG - Intergenic
1077087142 11:759159-759181 CATCCCAAGGGCCCAAGAGGAGG + Intronic
1080281708 11:30564777-30564799 CTAACCAAGAGACCAAAATGAGG + Intronic
1086882362 11:92163794-92163816 AGTCCCCAGAAACTAAAAGGTGG - Intergenic
1088159103 11:106846939-106846961 AGTCTCAAGGGACCAAAAAGAGG + Intronic
1094403234 12:30085449-30085471 AGTCCCAAAAGCTCAAAAGGAGG + Intergenic
1101927966 12:108989071-108989093 CGTCTCAAAAGAAAAAAAGGAGG - Intronic
1105590759 13:21790892-21790914 TGGCCTAAGAGACCAAATGGAGG - Intergenic
1106081453 13:26503891-26503913 TGTCCCAAGAGACCGACAGAAGG + Intergenic
1106724732 13:32472183-32472205 CATCACAAGTGACCAAGAGGAGG + Intronic
1106885979 13:34184474-34184496 CTTCCCAAGACAACAAAACGGGG - Intergenic
1108003795 13:45927702-45927724 GGCCTAAAGAGACCAAAAGGTGG + Intergenic
1108403537 13:50076384-50076406 AGTCCTAACAGACCAAAATGTGG + Intergenic
1123759803 15:23423396-23423418 CGGGCCAGGAGACCAGAAGGGGG + Intergenic
1124374249 15:29120635-29120657 CCTCCCCTGAGACCCAAAGGGGG - Exonic
1131159449 15:90095250-90095272 ATTCCCTAGAGAACAAAAGGTGG + Intronic
1133342542 16:5045968-5045990 CGTCCCCAGAGCCCAACACGAGG - Intronic
1133665773 16:7966352-7966374 CACCCCAAGAGTCCAAAAGCTGG - Intergenic
1136459183 16:30399127-30399149 AGGCCCAGGAGACCAAAGGGAGG + Exonic
1136582219 16:31159921-31159943 GGTCCCTGGAGACCAAGAGGTGG - Intergenic
1137869842 16:51939500-51939522 CGTCCCCAGAGATCCAAGGGAGG - Intergenic
1141740271 16:85887066-85887088 CGTCCCCAGAGACCACAAGTTGG - Intergenic
1143288648 17:5811642-5811664 TCTCCCAAAAGACAAAAAGGTGG - Intronic
1148894836 17:50833575-50833597 AGTCCCAAGAGACCATTAGAGGG - Intergenic
1149493221 17:57099930-57099952 CCTCCCAAGATCCCATAAGGGGG - Intronic
1150610675 17:66730811-66730833 CTCCCCAAGAGAGCACAAGGGGG + Intronic
1151388937 17:73772591-73772613 TGTTCCAAGGGACAAAAAGGAGG + Intergenic
1155215811 18:23642055-23642077 CCTCCCAGGAGACCCAAAGTGGG - Intronic
1162962768 19:14137487-14137509 CCTCCCAAGAGCCCTCAAGGGGG - Intergenic
1167382886 19:49148899-49148921 GGCCCGAAGAGACCAAATGGAGG + Intronic
1167618842 19:50550357-50550379 ATTCCCAAGAGACCAGGAGGAGG + Intronic
928242588 2:29599767-29599789 CATCTCATGAGACCAAAATGGGG + Intronic
941138328 2:161745568-161745590 CTTACCAAGAGAACAAAAGAAGG - Intronic
1170773065 20:19351106-19351128 CCTCCCAAGAGACCCTATGGAGG - Intronic
1173694011 20:44991771-44991793 CTACCCAAGAGGCCAAAAGTGGG - Intronic
1184829520 22:46975310-46975332 CGACCCCAAAGACCCAAAGGTGG + Intronic
950123853 3:10499652-10499674 GGTCCCAGGAGACCAACATGTGG - Intronic
951707859 3:25561604-25561626 AGTCCCAAGAGACCATAAAGAGG - Intronic
954375011 3:50189482-50189504 AGACTCAAGAGACCACAAGGGGG - Intergenic
954795656 3:53160352-53160374 CTTCCCAGGAGACAAAAAAGAGG - Intronic
955643475 3:61111408-61111430 TGTCCTAAGATACCAAAAGGTGG - Intronic
955995470 3:64676235-64676257 GATCCTAAGAGACCAAAATGTGG + Intronic
958170445 3:89933217-89933239 CGACCCCAGAGCCCCAAAGGAGG + Intergenic
958943308 3:100337357-100337379 CGTCCCACCAGACCATAAGCAGG + Intronic
961363384 3:126382316-126382338 CTTCCCAAGAGAACACCAGGAGG + Intergenic
963774783 3:149427587-149427609 CTTCCCTACAAACCAAAAGGCGG - Intergenic
966537449 3:181050677-181050699 TTTCCCAGGATACCAAAAGGAGG - Intergenic
967749834 3:193101295-193101317 AGTCCCAAGACAGCACAAGGCGG - Intergenic
972385040 4:38557426-38557448 CATCCCAAGAGACCCAGTGGAGG - Intergenic
977123279 4:93131090-93131112 AGTCCCAAAATACCAAAAGTAGG - Intronic
984305767 4:177988491-177988513 CTTGCCAAGAGACCAAGGGGAGG + Intronic
986000051 5:3623287-3623309 CTTCACAATAGACCAAACGGTGG + Intergenic
989093361 5:37757390-37757412 TGTCCCAAGAGAAAGAAAGGAGG - Intergenic
995286275 5:110392220-110392242 CCTCCCAAAAGAGCACAAGGAGG + Intronic
995912500 5:117204316-117204338 CCTCCCAAGAGACCGCAATGCGG + Intergenic
996283926 5:121766609-121766631 CATGCCAAAAGCCCAAAAGGGGG + Intergenic
1004518530 6:16341103-16341125 CATCCCAACAGACCAAATGGAGG + Intronic
1007317670 6:41002637-41002659 TGTCCCTAGAGCCCAAATGGTGG + Intergenic
1011095738 6:83659971-83659993 CTTCCTAAGAGACCTGAAGGTGG - Intronic
1012604799 6:101144755-101144777 CCTAGCAAGAAACCAAAAGGAGG - Intergenic
1020355010 7:7266269-7266291 GGTCTCAATAGAACAAAAGGTGG + Intergenic
1020686423 7:11301410-11301432 CGTCCAAAGTGACCAAGATGTGG - Intergenic
1024674701 7:51627802-51627824 TGTCCCAAGAGGTCAAAAGGAGG - Intergenic
1027265407 7:76492429-76492451 CGTACCCAGAGAGCAAAAGGAGG - Intronic
1027316778 7:76990546-76990568 CGTACCCAGAGAGCAAAAGGAGG - Intergenic
1031754371 7:125619082-125619104 GATCCCAGGAGACCAAAAGATGG - Intergenic
1037152522 8:15655282-15655304 CGCACCAAGAGACAAAATGGCGG + Intronic
1038578995 8:28730899-28730921 TCTCCCAAGAGAACACAAGGTGG - Intronic
1047542843 8:125787111-125787133 GGTCCCAAGAAAGCAAAAGCAGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1052027486 9:23589695-23589717 ATTCACATGAGACCAAAAGGGGG + Intergenic
1056658959 9:88530923-88530945 TGGCCCAGGACACCAAAAGGAGG + Intergenic
1060683907 9:125590645-125590667 CGTCTCAAGAAAAAAAAAGGGGG + Intronic
1061478844 9:130886422-130886444 CGTCACAAGAGAGCAAGAGCTGG - Intronic
1187737939 X:22323470-22323492 GGTGCCAAGAGAGCAAAAGAAGG - Intergenic
1190470621 X:50775556-50775578 CCACCCAAGTGACCAAGAGGTGG + Intronic
1196862270 X:120039543-120039565 AGACCCAAGAGACCACCAGGAGG + Intergenic
1196880832 X:120196801-120196823 AGACCCAAGAGACCACCAGGAGG - Intergenic
1198518507 X:137430302-137430324 CGTCCCAAGCTACTAAGAGGTGG - Intergenic