ID: 916236379

View in Genome Browser
Species Human (GRCh38)
Location 1:162592871-162592893
Sequence TTGGGGGTCTGGAGGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1189
Summary {0: 1, 1: 0, 2: 11, 3: 119, 4: 1058}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916236368_916236379 17 Left 916236368 1:162592831-162592853 CCTCCATACTAACTGGCATCGTA 0: 1
1: 1
2: 0
3: 1
4: 78
Right 916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG 0: 1
1: 0
2: 11
3: 119
4: 1058
916236369_916236379 14 Left 916236369 1:162592834-162592856 CCATACTAACTGGCATCGTAGTT 0: 1
1: 0
2: 0
3: 2
4: 43
Right 916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG 0: 1
1: 0
2: 11
3: 119
4: 1058
916236367_916236379 18 Left 916236367 1:162592830-162592852 CCCTCCATACTAACTGGCATCGT 0: 1
1: 0
2: 0
3: 3
4: 66
Right 916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG 0: 1
1: 0
2: 11
3: 119
4: 1058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916236379 Original CRISPR TTGGGGGTCTGGAGGGAGGA TGG Intronic
900790002 1:4673605-4673627 TTGGAGGTGTGGAGGGAGCAGGG + Intronic
900825271 1:4921158-4921180 GTGTGGGTCTCGGGGGAGGATGG + Intergenic
901018488 1:6244635-6244657 GGGGAGGGCTGGAGGGAGGAGGG + Intronic
901048606 1:6414474-6414496 TTGGGGGGCAGCAGGGAGCAGGG - Intronic
901638178 1:10679997-10680019 TAGGGGGTCTGGACTGAGAAGGG + Intronic
901924384 1:12556698-12556720 TTTGTGGGCTGGAGGGGGGAAGG + Intergenic
902252520 1:15163826-15163848 TTGGGGGGGGGGAGGGGGGAGGG + Intronic
902465824 1:16617926-16617948 TTGGGGATGGGGAGGGAGGGAGG + Intergenic
902497466 1:16883702-16883724 TTGGGGGGTGGGAGGGGGGAAGG + Intronic
902625532 1:17674047-17674069 TTTGCCATCTGGAGGGAGGATGG - Intronic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
902802977 1:18841845-18841867 ATAGGGATCTGGAGGGAGGAGGG + Exonic
902953852 1:19910820-19910842 TCGGGGGTGGGGTGGGAGGAGGG + Exonic
902976452 1:20092154-20092176 ATGGGGGTCAGGTGGGAGGCAGG + Intergenic
902988104 1:20167859-20167881 TTGGGGGTCAGGAGACAGAAGGG - Intronic
903331712 1:22600058-22600080 AAGGGGGGATGGAGGGAGGAAGG + Intronic
903421055 1:23217783-23217805 GTAGGGGTCTGCAGGGAGGTGGG + Intergenic
903466880 1:23558183-23558205 TTGGGGGTGGGGTGGGAGCAGGG + Exonic
903643582 1:24876700-24876722 CTGGGAGTCATGAGGGAGGATGG - Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
903931299 1:26863981-26864003 GTGGGGGACTGGAGGGGGCAGGG - Exonic
903968382 1:27103378-27103400 TTGGGGGCCTGGGGTGAGGGAGG - Intronic
903996208 1:27306880-27306902 TGGTGGCTCTGGAGGGAGGGTGG - Exonic
904311586 1:29632789-29632811 CTGGGGGGCTGGAGGGCTGAGGG - Intergenic
904597408 1:31655571-31655593 CTGGGGGCCTGGTGGGAGGGTGG - Intronic
904618406 1:31762058-31762080 TTGGGGGTGGGAAGGGAGGGAGG + Intronic
904722039 1:32517469-32517491 TTGGGGGGGTGGTGGGGGGACGG - Intronic
904768277 1:32867242-32867264 GTGGGGGTGTGGAAGCAGGAGGG + Intronic
904921513 1:34011856-34011878 TTGTGAGTGGGGAGGGAGGAGGG - Intronic
904941256 1:34166016-34166038 TTGGGGGTGGGGAGTGAGGTTGG + Intergenic
905013110 1:34760228-34760250 TTGGGGATGGGGAAGGAGGAGGG + Intronic
905357013 1:37391738-37391760 TTGGGGGGGTGGTTGGAGGAGGG - Intergenic
905375007 1:37514389-37514411 GAGGGGGCGTGGAGGGAGGACGG - Intronic
905878057 1:41445979-41446001 TTGGGGATCTTGAAGGGGGAAGG - Intergenic
906566327 1:46803758-46803780 TGGTGGGCCTGCAGGGAGGAGGG + Intronic
906567395 1:46810944-46810966 GTGGGGGTGAGGAGAGAGGATGG + Exonic
906681963 1:47733232-47733254 GTGGGAGTCAGGAGAGAGGATGG - Intergenic
906788136 1:48634257-48634279 TTGGAGGTCTGGAGGGTTAAAGG - Intronic
906860497 1:49353882-49353904 TTGGGGAGCTGGAAAGAGGATGG - Intronic
907186318 1:52612136-52612158 CAGTGGGTATGGAGGGAGGAAGG - Intergenic
907321084 1:53602721-53602743 TTGGGGGTCTGTAAGAAGCAGGG + Intronic
907468152 1:54653197-54653219 CTGGTGATCTGGAGGGAGGCTGG - Exonic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
908331478 1:63074970-63074992 TTGAGGATGGGGAGGGAGGAGGG - Intergenic
908511122 1:64850721-64850743 TTGGGGATCTGGGGGAAGGAAGG - Intronic
908548996 1:65190448-65190470 TTGGGGGGGGGGCGGGAGGAGGG + Intronic
909086447 1:71174281-71174303 GTGGGGAGCTGGAAGGAGGATGG + Intergenic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910030772 1:82719967-82719989 TAGGGGGTTGGGAGGGAGGTGGG - Intergenic
910738487 1:90489193-90489215 TTGGAGACTTGGAGGGAGGAGGG - Intergenic
910846797 1:91611922-91611944 ATGGGGGCAAGGAGGGAGGAGGG + Intergenic
911077205 1:93888143-93888165 TGTGGGCTCTGGAGAGAGGAGGG - Exonic
912149765 1:106843796-106843818 TTTTGGGTCAGGAGGGAGGCTGG + Intergenic
912458680 1:109817115-109817137 TTGGCTGGCTGGAGGAAGGATGG + Intergenic
912563925 1:110571610-110571632 ATGGGGGTCGGGAGGGGAGAGGG + Intergenic
912939985 1:114036336-114036358 TTGGAGATTTGGAGGAAGGAGGG + Intergenic
912952928 1:114133038-114133060 CTGAGGGTATGCAGGGAGGAAGG - Intronic
912956518 1:114157432-114157454 CTGGGGACTTGGAGGGAGGAGGG - Intergenic
913293288 1:117294996-117295018 TAGAGTGTCTGGAGGGAGCACGG + Intergenic
913367212 1:118052992-118053014 AAGGGTGTCTGGTGGGAGGAGGG - Intronic
913995756 1:143651147-143651169 TTGGGGGTGGGGAAGGAGGGAGG + Intergenic
914000365 1:143689559-143689581 ATGGGGAACTGGAGAGAGGAAGG + Intergenic
914276585 1:146130043-146130065 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914474509 1:148012273-148012295 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914492080 1:148158587-148158609 TTGGGGGTGGGGAGGGAGGGAGG + Intergenic
914537630 1:148580998-148581020 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
914586545 1:149067451-149067473 TAGGGTGTGGGGAGGGAGGAGGG - Intronic
915312306 1:155010809-155010831 GTGGGGGGGTGGAGGGAGAAAGG + Intronic
915615425 1:157034138-157034160 CTGGGGCTCTGAAGGGAAGAGGG + Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916236379 1:162592871-162592893 TTGGGGGTCTGGAGGGAGGATGG + Intronic
916372600 1:164116471-164116493 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
916415958 1:164592112-164592134 TTGGGAAGCTGGAGGGAGGTGGG + Intronic
916930715 1:169575716-169575738 TTGGGGAGCTGGGTGGAGGAGGG + Intronic
917089709 1:171340674-171340696 TTGGGGTTGGGGAGGGATGAAGG + Intronic
917512776 1:175681892-175681914 ATGGGGGTCTGAAGGGAGGAAGG + Intronic
917535734 1:175873072-175873094 GTGGGGGGCTGAAGGGAGGAGGG - Intergenic
917588735 1:176455428-176455450 TTGTGAGTTTGGAGTGAGGAAGG + Intergenic
917607364 1:176646540-176646562 GTGGGGGTCAGGTGGGGGGATGG - Intronic
917749493 1:178041215-178041237 ATGGGGGAATGGAGGGTGGAAGG - Intergenic
918122230 1:181550038-181550060 TTGGGGGTAATTAGGGAGGAAGG + Intronic
918125612 1:181580790-181580812 GTGGGGACCTGGAAGGAGGAGGG + Intronic
918143459 1:181736716-181736738 TAGGTAGTGTGGAGGGAGGAAGG + Intronic
918147739 1:181772342-181772364 GTGGGGGTGTGGAGAGAGGAGGG - Intronic
918319169 1:183348535-183348557 TTGGGGGTGTGGGGGAATGATGG + Intronic
918377417 1:183923135-183923157 TTTGGGGTCTGGCGGCAGAAAGG - Intronic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919691518 1:200532197-200532219 GGGGGAGTCTGGAGGGAGGCAGG + Intergenic
919901461 1:202046918-202046940 TTGGGTTTCTGGAAGGAGCAAGG + Intergenic
919927033 1:202196939-202196961 TTGGGGATCGGGAGGGAGAGTGG + Intronic
920074758 1:203327847-203327869 GAGGGACTCTGGAGGGAGGACGG - Intergenic
920245726 1:204585941-204585963 TTGGGGGTTCAGAGGGAGGGCGG + Intergenic
920353898 1:205356392-205356414 ATGGGGGTCAGGAGGGACAAGGG - Intronic
921065466 1:211619511-211619533 TTTGGGCTCTGGAGGTGGGAAGG - Intergenic
921158437 1:212455791-212455813 TTTGGGGTGAGGTGGGAGGAAGG + Intergenic
921217845 1:212951841-212951863 TTGGGGGGCTGGGGGTAGGTAGG + Intronic
921221727 1:212978458-212978480 TTTGGGGCGTGGAGGGAGGAGGG - Intronic
922212661 1:223497635-223497657 ATGGGGGTGTGCTGGGAGGAGGG + Intergenic
922461363 1:225816681-225816703 TGGAGGGTCTGGAGAGGGGAAGG - Intronic
922594450 1:226803214-226803236 ACGGGGGTCTGGAGGAAGAAGGG - Intergenic
922604905 1:226883925-226883947 TTGGGGGGCTGGGGGGAGCAGGG + Intronic
922616354 1:226963351-226963373 TTGAGGGGCTGGAGGGAGACAGG - Intronic
922712891 1:227846258-227846280 TTAGGGGTCTGGAGGCAGCTGGG - Exonic
922765999 1:228157081-228157103 GCCGGGGGCTGGAGGGAGGATGG + Intronic
923001851 1:230012662-230012684 TCAGGGGTCTGGAGGGTTGAAGG + Intergenic
923090358 1:230735821-230735843 TTGGGGGGCTGGAAGCAGCAGGG - Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
923433934 1:233950598-233950620 GTGGAGGGATGGAGGGAGGAGGG - Intronic
923469019 1:234273700-234273722 TTGAGGGTCTGGAGCAGGGAAGG + Intronic
923536652 1:234857769-234857791 GTCAGGGTCTGGAGGGAGTAGGG + Intergenic
924150756 1:241126671-241126693 ATGGGGGGCTGGAGGTAGGAGGG - Intronic
924594541 1:245433933-245433955 TTGGGGGTCTGTAGTGAAAAGGG + Intronic
924643583 1:245856822-245856844 TTGGGGGCCTGGAGAAAGAAGGG + Intronic
1062824538 10:557945-557967 CTGGAGGGCTGGAGGCAGGAGGG + Intronic
1062848246 10:724373-724395 TTGGGGGTCCAGAGGGACGGAGG - Intergenic
1062860303 10:805190-805212 TGGGGGGCCTGGAGGGTGCAGGG + Intergenic
1063099178 10:2934783-2934805 TTGGGGGGCTGGAGTGTAGAGGG + Intergenic
1063147546 10:3309533-3309555 TTGGGAGGCTGGGGGGAGGGGGG + Intergenic
1063455845 10:6182313-6182335 CTGGGGGTCTGGGTGCAGGAGGG + Intronic
1063522861 10:6757036-6757058 GTGGGGGTGTGGAGGGACAAGGG + Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064056709 10:12104007-12104029 TCCAGGGGCTGGAGGGAGGAAGG - Intronic
1064065840 10:12180861-12180883 TTGGTGAACTAGAGGGAGGAAGG - Intronic
1064615404 10:17149644-17149666 TTGGGGGCCGGGAGGTAGTAGGG - Intronic
1065001691 10:21343144-21343166 TAGAGGTTCTGGAGGGAGCACGG - Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1067349412 10:45462428-45462450 TTGGGGGTAGGTAGGGAGCAAGG + Intronic
1067684359 10:48457920-48457942 TTGGGGGTGGGTAGGGAGGGGGG + Intronic
1068723148 10:60269638-60269660 TTGGGGGGGGGGAGGGGGGATGG - Intronic
1068725339 10:60294502-60294524 TAGGGGGCTTGCAGGGAGGATGG + Intronic
1068803059 10:61163320-61163342 TTGGAGGTCTGCAGGGCAGAAGG + Intergenic
1068959820 10:62855340-62855362 TTGGGAGTCAGGGGGGAGAATGG + Intronic
1069289217 10:66756592-66756614 GTAGGGGTCAGGAGAGAGGAAGG - Intronic
1069311544 10:67044087-67044109 TTGGGGGGAAAGAGGGAGGAGGG - Intronic
1069589713 10:69634254-69634276 TTGGTTGTTTGCAGGGAGGAAGG + Intergenic
1069622536 10:69846680-69846702 TGGGAGCACTGGAGGGAGGAAGG - Intronic
1069646380 10:70001477-70001499 TTTAGGGTCTGGATGAAGGAAGG - Intergenic
1069746334 10:70717274-70717296 GTGGGGTTGTGGAGAGAGGAGGG + Intronic
1069754417 10:70764361-70764383 GTAGGGGTCTGGGGGGAGGAGGG + Intergenic
1069776090 10:70928098-70928120 CTGGGGGTTTAGAGAGAGGAGGG + Intergenic
1069902820 10:71715727-71715749 GAGGGGGTCTGCAGAGAGGAAGG + Exonic
1069932144 10:71890058-71890080 TTGGGGGGCTGGAGGATGGTAGG - Intergenic
1070321560 10:75358598-75358620 GTAGGGCTCGGGAGGGAGGAAGG - Intergenic
1070654564 10:78262482-78262504 TGAAGGGTCTGGAGGAAGGAGGG + Intergenic
1070700516 10:78598448-78598470 TTGGGTGTCAGGAGGTAGGCAGG - Intergenic
1071161322 10:82749093-82749115 TTGAGGGCTTGGAGAGAGGAGGG + Intronic
1071447433 10:85761798-85761820 TGGGGGGTGTGGGGGGAGCATGG - Intronic
1071505329 10:86228383-86228405 TGGGTGGTGTGGAGTGAGGATGG - Intronic
1071603498 10:86970266-86970288 TGGTGGGGCTGGAGGGAGGCGGG + Intronic
1071971415 10:90911501-90911523 TAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1072035576 10:91560468-91560490 GTAGGGGTCTGGAGGCAGGGAGG - Intergenic
1072881841 10:99235906-99235928 TTGGGGGGGTGGTGGGAGGAAGG - Intergenic
1073053429 10:100684023-100684045 CTGGGGGGCTGCAGGGGGGAGGG + Intergenic
1073359856 10:102889664-102889686 CGGGGGGGGTGGAGGGAGGAAGG - Intronic
1073388043 10:103143975-103143997 TTTGGGGGCTGGAGGTTGGAGGG - Intronic
1074168226 10:110905555-110905577 TTGGAGGGGTGGGGGGAGGACGG - Intronic
1074226272 10:111487622-111487644 GTGGGGGTTTGCAGGGAAGATGG - Intergenic
1074986491 10:118664379-118664401 CTGGGGTTCTGGGGGTAGGATGG + Intergenic
1075218760 10:120565173-120565195 TTGGTGGTTTGTTGGGAGGAAGG - Intronic
1075719468 10:124576452-124576474 TAGGGGTTCTGGAGGCAGGATGG - Intronic
1076215433 10:128689539-128689561 TGGGGGTACTGGAGGGTGGAGGG + Intergenic
1076420218 10:130326138-130326160 CTGTGGGGTTGGAGGGAGGAAGG + Intergenic
1076779471 10:132716221-132716243 ATGGGGTTCAGGATGGAGGACGG - Intronic
1076917675 10:133432725-133432747 TTGGGTGTCTGAGGGCAGGATGG + Intergenic
1076937671 10:133576800-133576822 TTGGGTGTCTGAGGGCAGGATGG + Intergenic
1077170932 11:1165427-1165449 TTGGTGGCCTGGAGGGGGGCTGG - Intronic
1077224801 11:1435250-1435272 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224813 11:1435279-1435301 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224825 11:1435308-1435330 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224837 11:1435337-1435359 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224849 11:1435366-1435388 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224861 11:1435395-1435417 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224873 11:1435424-1435446 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224885 11:1435453-1435475 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224897 11:1435482-1435504 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224909 11:1435511-1435533 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224921 11:1435540-1435562 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077224933 11:1435569-1435591 GTGGGGGTCTCGGCGGAGGAGGG + Intronic
1077350485 11:2090961-2090983 TTTGGGGTCTGGAGGATGGGAGG - Intergenic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1077472211 11:2769391-2769413 TTGGGAGGATGGAGGGAGGCTGG + Intronic
1077830271 11:5860748-5860770 GTGGGGGACTGGGGGGAGGTGGG - Intronic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1078197309 11:9146696-9146718 TTGTGGGTATGCAGGGAGGGAGG + Intronic
1078288062 11:9978162-9978184 TTGGGGGAAGGGAGGCAGGATGG - Intronic
1079071928 11:17354514-17354536 TTGGGGGGTCGGAGGGAGAAGGG - Intronic
1079135394 11:17773551-17773573 CTGGGGGCCGGGAGGGGGGAGGG + Intronic
1079908820 11:26284035-26284057 TGGGTGGTATGGCGGGAGGAGGG + Intergenic
1080383354 11:31796467-31796489 CTGGGGGGATGGAGGGTGGATGG + Intronic
1080571202 11:33558532-33558554 AGGAGGGTCTGGAGGGAGAAGGG + Intronic
1080953965 11:37071098-37071120 TGGGGGGTCTTGGGGGAAGAAGG - Intergenic
1081139104 11:39475734-39475756 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1081143304 11:39531437-39531459 TTGGGGGTTTAGTGGGAGGTGGG - Intergenic
1081926163 11:46830552-46830574 TAGGGGCTCTGGAGGGAGTGTGG + Intronic
1081968314 11:47182759-47182781 TTGGGGCTGTGGAGGGCAGAGGG + Exonic
1082921934 11:58505047-58505069 TTTGGGGTCTCGATGGGGGAAGG + Intergenic
1083139042 11:60706501-60706523 TGGGGGCTCTGGAGGGGAGAAGG - Intronic
1083173583 11:60936494-60936516 TTGTGGGGCTGGGGGGAGGTGGG - Exonic
1083243162 11:61404577-61404599 CTGGGTGTCTGGAGGGAGTTAGG + Exonic
1083306524 11:61764736-61764758 TTGGGCATCATGAGGGAGGACGG - Intronic
1083593249 11:63907314-63907336 CAGGGGGTCTGGAGAGAGCAGGG + Intronic
1083719699 11:64598208-64598230 TGTGGGGTCTGGAGGGAGGCAGG + Intronic
1083776000 11:64894638-64894660 TTCTGTGTCTGGGGGGAGGAGGG - Exonic
1083833335 11:65247611-65247633 CTGGGGCTGTGGAGGGAGAACGG + Intergenic
1083887842 11:65581438-65581460 TTGGGGCCCTGGAGGCAGGTTGG - Intronic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1085022545 11:73218439-73218461 TGGGGCGTCTGGAGGGAACAAGG + Intronic
1085299685 11:75450789-75450811 CTGGGGGTGTGGAGGGGGGTGGG - Intronic
1085411270 11:76292108-76292130 CTTGGGGACTGGAGGGAGCAGGG - Intergenic
1085445247 11:76597077-76597099 TGAGGGCTCTGGATGGAGGATGG - Intergenic
1085608134 11:77921622-77921644 TTGGGGGTGTGGGTGGAGTAGGG - Intronic
1085726483 11:78959494-78959516 TTGGGTTTCAGGAGAGAGGAAGG + Intronic
1086730716 11:90245616-90245638 TTGGGAGGCTGGATGGATGATGG - Intergenic
1086976941 11:93142943-93142965 TTGGGGGTGGGGTGGGAGGAGGG + Intergenic
1087058126 11:93953088-93953110 TGGAGGGTCTGGAGGGGGGGGGG + Intergenic
1087096104 11:94319788-94319810 TGGGGTGTCGGGAGGGGGGAGGG + Intergenic
1087491766 11:98837075-98837097 CTGAGGGTGTGGAGGGTGGAGGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1088356027 11:108944660-108944682 GTGGGGGGAAGGAGGGAGGATGG + Intergenic
1088814222 11:113410447-113410469 TAGGGGGACTGGAGGTGGGAGGG + Exonic
1088820662 11:113453931-113453953 ATGGGGGGCTGGGGGGAGGATGG + Intronic
1088912132 11:114199528-114199550 TTGGGGATGTGGAGGCAGCATGG + Intronic
1088919484 11:114250940-114250962 CTGGGGGTCTTGGTGGAGGAAGG - Intergenic
1089096589 11:115924912-115924934 TTGGGGGTGTGGAGGGTGGGAGG - Intergenic
1089179049 11:116568216-116568238 CAGGGGTTCTGGAGGGAGGGAGG + Intergenic
1089242983 11:117098013-117098035 TTGGGGGCCGGGAGGCGGGAGGG - Intronic
1089532110 11:119136907-119136929 GTGGGCTCCTGGAGGGAGGAGGG + Intergenic
1089613972 11:119684940-119684962 AGGGGAGTCTGGAGGCAGGAGGG - Intronic
1089756323 11:120690155-120690177 TTTAGGGTCTGGAGTGACGAGGG - Intronic
1089895929 11:121929902-121929924 GTGGGGGGCTTGAGGGAGGGTGG + Intergenic
1090396661 11:126423865-126423887 CTGGGGGGAGGGAGGGAGGAGGG - Exonic
1091216365 11:133904802-133904824 TTGGAGAACTGGAGGGTGGAGGG - Intergenic
1091610514 12:2004102-2004124 TCGGGGGTTTGGGGGAAGGAAGG - Intronic
1091823016 12:3490773-3490795 GTGGGTGTCTGGATGGGGGAGGG - Intronic
1092045530 12:5430034-5430056 CTGGCAGTCTGGAGGGAGGAGGG - Intergenic
1092166979 12:6348345-6348367 TCGGGGGTCTTCAGGGATGAAGG - Intronic
1092181130 12:6447774-6447796 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
1092879316 12:12875706-12875728 CTGGGGGCCTGGAGGGGGTAGGG - Intergenic
1093183258 12:15990597-15990619 TTTGGAGTTTGGAGGGTGGAAGG - Intronic
1093185865 12:16019539-16019561 TTGGAGGTGAGGTGGGAGGAGGG - Intronic
1093494812 12:19744099-19744121 TTGGTGGACTGGAGAGATGAAGG - Intergenic
1094092097 12:26661781-26661803 GTGGAGGTCTGGAGTGGGGAAGG - Intronic
1094112661 12:26878258-26878280 TTAGGCATCCGGAGGGAGGAGGG - Intergenic
1094166669 12:27450287-27450309 GTGGGGGCAGGGAGGGAGGAGGG - Intergenic
1095476019 12:42588674-42588696 TTGGGGGTTGGGAGAGAGGGAGG - Intronic
1095565113 12:43613839-43613861 GTGGGGGGCTGGAGGGGAGAAGG - Intergenic
1095968139 12:47883091-47883113 CAGGGTGTCAGGAGGGAGGAAGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096633653 12:52945296-52945318 GGGGTGGGCTGGAGGGAGGAAGG - Intronic
1096636091 12:52960562-52960584 TTGGGGATCAGCAGCGAGGATGG + Intergenic
1096670619 12:53196339-53196361 TTAGGGGGCTGGAGAGAGCAGGG - Intronic
1096743205 12:53709528-53709550 TTGGGGGGCTTCATGGAGGAGGG + Intronic
1096846825 12:54412012-54412034 ATTGGTGTCTGGAGGCAGGAAGG + Intronic
1097042418 12:56163734-56163756 TGTGGGGTCTGGAGGCAGGGGGG + Exonic
1097187315 12:57202783-57202805 GTGGGGGTATGGTGGGAGCACGG - Intronic
1097267261 12:57753374-57753396 GTGGTGGTCTGGAGGGTGCAGGG - Intronic
1097380840 12:58893965-58893987 TTGGGGGTGGGGAGGCAGGGAGG + Intronic
1098061943 12:66572414-66572436 TTGGGGGTGGGGTGGGAGGAAGG - Intronic
1098101413 12:67021288-67021310 TTGGGGGACAGGAAGAAGGAGGG - Intergenic
1099654327 12:85469487-85469509 ATGGGGGTCGGGCTGGAGGATGG + Intergenic
1100209030 12:92381941-92381963 GAGGGGGGATGGAGGGAGGAAGG + Intergenic
1100388926 12:94130046-94130068 GTGGGGTTGGGGAGGGAGGAGGG - Intergenic
1100726736 12:97416880-97416902 TGGGGGGTGTGGGGGGAGGGGGG + Intergenic
1100860431 12:98799850-98799872 TTTGGGGGCTGGTGGGGGGAGGG - Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101638305 12:106565878-106565900 AAGGGGGTAGGGAGGGAGGAAGG + Intronic
1101676581 12:106922422-106922444 GTGGGGGGCTGGAGTGAGGGAGG - Intergenic
1102200646 12:111055622-111055644 TTGGGGGCCAGGCGGGAGGCAGG - Intronic
1102212627 12:111138361-111138383 GTGGGGGTGGGGAGAGAGGAGGG + Intronic
1102519281 12:113468757-113468779 ATTGAGGTCTGGAGAGAGGAGGG - Intronic
1102561044 12:113762530-113762552 CTGGGGGTGGGGAGGGAGGGGGG - Intergenic
1102569778 12:113820434-113820456 GTGGGAGCCTGCAGGGAGGAAGG + Intronic
1102573670 12:113842909-113842931 TGGGAGGTGTGGTGGGAGGAAGG + Intronic
1102930794 12:116860601-116860623 TTGGGGTCTAGGAGGGAGGATGG - Exonic
1103649355 12:122421664-122421686 GTGGGGCTGTGCAGGGAGGAGGG + Intronic
1103913611 12:124364891-124364913 TTGGGGGTATGGAGGCAGCCCGG + Intronic
1103930246 12:124446297-124446319 TTTGGTGGCTGCAGGGAGGAAGG - Intronic
1103943243 12:124512278-124512300 TTGAGCTTCTGGAGGGAGTAGGG - Intronic
1104460718 12:128953661-128953683 TTGTGTGTGTGGAGTGAGGAAGG + Intronic
1104602244 12:130162017-130162039 TTCGGGGACTGGCGGGAGAAGGG - Intergenic
1105209122 13:18247515-18247537 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1105441202 13:20416425-20416447 CAGGAGGTCTGGAGGCAGGAAGG + Intronic
1105511338 13:21054206-21054228 TTTGGGAGCTGGAGGCAGGAAGG + Intronic
1105852439 13:24347820-24347842 TTGGGGGGGTGGAGGGGGGAGGG + Intergenic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106099205 13:26679989-26680011 TTGGGGGTGCTGAGGGAGCAGGG - Intronic
1106670795 13:31903046-31903068 ATGTGGCTCTAGAGGGAGGAAGG + Intergenic
1107358603 13:39594967-39594989 TGGGGTGGGTGGAGGGAGGAGGG + Intronic
1108362599 13:49680920-49680942 TTGGGAGTCAGGAGGGAGAGAGG - Intronic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108962449 13:56251679-56251701 TTGGGGATGGGTAGGGAGGATGG - Intergenic
1109226963 13:59708612-59708634 TTGGGGCTCAGGAGGAAGGGCGG - Intronic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1109993846 13:70095816-70095838 TGGGGGGGGTGGAGGGAGAAGGG - Intronic
1110443540 13:75550617-75550639 TGGGGGTTGGGGAGGGAGGAGGG + Intronic
1110474000 13:75891941-75891963 TGGTGGGTTTGGAGAGAGGAGGG - Intergenic
1110628056 13:77673966-77673988 TTGGGGATTTGGGGGAAGGACGG + Intergenic
1111006347 13:82254846-82254868 CGGGAGGTGTGGAGGGAGGAAGG + Intergenic
1111580803 13:90220658-90220680 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
1112442924 13:99437793-99437815 TTGGCAGAGTGGAGGGAGGAAGG - Intergenic
1112739021 13:102453345-102453367 TTGGGAGACTGAAGGGAGGAAGG + Intergenic
1113040623 13:106100605-106100627 TGGGGGGTGGGGAGGCAGGAAGG + Intergenic
1113294015 13:108938390-108938412 CTGGGGGTCAGGAGCCAGGAAGG + Intronic
1113604337 13:111594824-111594846 GGGGTGGTCTGGAGGGTGGATGG - Intronic
1113614673 13:111671701-111671723 ATGGGGGTTTGGCAGGAGGAGGG + Intronic
1113620142 13:111756615-111756637 ATGGGGGTTTGGCAGGAGGAGGG + Intergenic
1113637513 13:111929707-111929729 GGGGGGGCATGGAGGGAGGAAGG + Intergenic
1113767656 13:112891042-112891064 CTGGGTGGCTGGAGGGAGCAGGG - Intergenic
1113804833 13:113106690-113106712 TAGGGGGTGTGGCGTGAGGATGG + Intronic
1113867364 13:113535837-113535859 GTGGGGGTCTGGGGAGGGGATGG + Intronic
1114318198 14:21525840-21525862 AGGGGGGTGGGGAGGGAGGAGGG + Intronic
1114455303 14:22849864-22849886 TTTGGGGTCTGGAGGGGTGTGGG - Intergenic
1114459681 14:22878480-22878502 TGGTGGGTGTGGAGGGTGGAGGG - Exonic
1114669612 14:24402059-24402081 GTTGGGGTCTGAGGGGAGGAGGG + Intronic
1114712760 14:24795048-24795070 GTGGGGGGTTGGAGGGAGGAGGG - Intergenic
1114731773 14:25000590-25000612 TTGGGTGGCTGTAGGGAAGAAGG - Intronic
1116489564 14:45490057-45490079 TTGGGGCTGGGGTGGGAGGAGGG + Intergenic
1117435972 14:55715582-55715604 TTGGACGTCTGGAGGGAAGTGGG - Intergenic
1118096759 14:62546153-62546175 GTGGGGGTGGGGAGGGGGGAGGG - Intergenic
1118099385 14:62579071-62579093 TGGGGGGCTTGGAGGGAGGTGGG + Intergenic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1118779409 14:68996965-68996987 TTGGGAGGCTGGGGGGAGGCAGG + Intergenic
1119314732 14:73683602-73683624 GTGGGGGGCTGAGGGGAGGATGG - Intronic
1119348464 14:73944933-73944955 GAGGAGGTCTGGAGGGAGCAGGG - Intronic
1119412141 14:74439295-74439317 TTGAGGGTCTGGGAGGAGGCTGG + Intergenic
1119430844 14:74567253-74567275 TGAGGGGGCTGGAGGGTGGAGGG - Intronic
1120128189 14:80772418-80772440 ATGGGGAGCTGGAGGGGGGATGG - Intronic
1120509801 14:85399372-85399394 GTGGGGCTCTGGGGAGAGGAGGG + Intergenic
1120602147 14:86523986-86524008 TTTGGGGTGTGGGGGGAGGAGGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1121023634 14:90598460-90598482 ATGGGGGTAAGGAGGGGGGAAGG + Intronic
1121091303 14:91184576-91184598 TTGGGGGGGGGGAGGGAGGGAGG + Intronic
1121253113 14:92513996-92514018 GTGGGGATCGCGAGGGAGGAGGG - Intronic
1121458130 14:94052199-94052221 TTGGTGGTGTGGAAGGAGCATGG + Intronic
1121570696 14:94944587-94944609 TTGGGGGTTCCCAGGGAGGAGGG + Intergenic
1121765010 14:96478735-96478757 TTGTGGGGCTGGGGGGAGGGTGG + Intronic
1121975092 14:98396098-98396120 TTGGGGGTGGGGAGTGAAGAGGG - Intergenic
1122084032 14:99287178-99287200 GTGGGGCGCTGGGGGGAGGAGGG - Intergenic
1122099249 14:99394252-99394274 TTGAGGGTAAGGAGGGAGGCAGG - Intergenic
1122137734 14:99644682-99644704 GTAGGGGTGGGGAGGGAGGACGG - Intergenic
1122268503 14:100557792-100557814 TTGGGAGTTGGGAGGCAGGAGGG - Intronic
1122316498 14:100828523-100828545 GGAGGGGTATGGAGGGAGGAAGG - Intergenic
1122481141 14:102048278-102048300 TCGGGGCTCTCTAGGGAGGAAGG - Intronic
1122773030 14:104105602-104105624 TTTGGGGTCTGCAGCAAGGAAGG + Intronic
1122787286 14:104169531-104169553 TGGGGGGTGTGCAGGGTGGAGGG - Intronic
1122903174 14:104790343-104790365 CTGGGGGTGGGGAGGGAGGGAGG - Intronic
1123468172 15:20531234-20531256 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123649943 15:22469830-22469852 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123696067 15:22880069-22880091 TTGGGGGACTGGAGGGGGCCGGG + Intronic
1123728488 15:23126444-23126466 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1123740346 15:23278649-23278671 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1123746652 15:23323909-23323931 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124071084 15:26393653-26393675 TAGGGGCACTGCAGGGAGGAGGG + Intergenic
1124278920 15:28347225-28347247 GTGGGGGTGCTGAGGGAGGAGGG + Intergenic
1124303779 15:28564383-28564405 GTGGGGGTGCTGAGGGAGGAGGG - Intergenic
1124342998 15:28901945-28901967 TTGGGGGTCTGGGGTGGGGGAGG + Intronic
1124343065 15:28902244-28902266 TGGGTGCTGTGGAGGGAGGAGGG + Intronic
1124856132 15:33391129-33391151 TGGTGGGGCTGGAGGGATGAGGG - Intronic
1125117593 15:36113456-36113478 TTGGGGGTGGGGAGGGAGCGAGG - Intergenic
1125301194 15:38254352-38254374 TTTGGGGTGGGGAGGGAGTAAGG - Intronic
1125507187 15:40273686-40273708 TGGGAGGTCTGGGGGGTGGAGGG - Intronic
1125557508 15:40598568-40598590 TTGGGGGGCCGGAGGGGGCAGGG - Intronic
1126354132 15:47776795-47776817 TTGGGGGGATGGAGGGTGCAAGG + Intergenic
1126676231 15:51161251-51161273 CTGGGGGTCTGGATCTAGGATGG + Intergenic
1126752351 15:51889757-51889779 TTGGGAGGCTGAGGGGAGGATGG + Intronic
1126850370 15:52793071-52793093 TTGCATGTGTGGAGGGAGGACGG + Intergenic
1127236616 15:57059732-57059754 GTGGGGGGCTGGGGGGAGGGTGG + Intronic
1127435033 15:58949011-58949033 TTGGGAGGCTGGTGGGAGGGTGG - Intronic
1127854340 15:62942413-62942435 TTGGAGGTTAGGAAGGAGGATGG - Intergenic
1128241962 15:66107394-66107416 TTAGTGGCCAGGAGGGAGGAAGG + Intronic
1128250002 15:66157237-66157259 TTGGGAGTGAGGAGGGAGGCTGG - Intronic
1128611741 15:69079359-69079381 TGAGAGGTCTGGAGGGAAGAGGG + Intergenic
1128726290 15:69990810-69990832 GTAGGGGGCTGGGGGGAGGAGGG + Intergenic
1129083895 15:73068075-73068097 TTGGTGGTTTGCAGGGAGTAGGG + Intronic
1129108440 15:73324036-73324058 TGGGGGGTGTTGGGGGAGGAGGG - Intronic
1129461134 15:75700558-75700580 TTGGAGGTCTGGGAGGAGGGTGG + Intronic
1129571766 15:76693814-76693836 ACCAGGGTCTGGAGGGAGGAGGG + Intronic
1129716950 15:77857741-77857763 TCGGGGGGCAGGAGGGAGGCAGG + Intergenic
1129723696 15:77891184-77891206 TTGGAGGTCTGGGAGGAGGGTGG - Intergenic
1129843769 15:78758941-78758963 GTGGGGTTCTGGGGGCAGGAAGG - Intergenic
1130042878 15:80419497-80419519 TGGGTGATCTGGAGGGAGAAGGG + Intronic
1130064778 15:80594586-80594608 TTGGGGCTCCTGTGGGAGGAAGG - Exonic
1130098950 15:80877434-80877456 TTGGGGGTGAGGAGGTGGGAAGG - Intronic
1130109796 15:80954612-80954634 TTGGGGGAGGGGATGGAGGAAGG + Intronic
1130258038 15:82334859-82334881 GTGGGGTTCTGGGGGCAGGAAGG + Intergenic
1130596894 15:85255104-85255126 GTGGGGTTCTGGGGGCAGGAAGG - Intergenic
1130643936 15:85706939-85706961 GTGGGGGACTGGAGTGATGATGG - Intronic
1130921306 15:88347362-88347384 TTGTGAGTCTGGAGGGAACAAGG + Intergenic
1131065658 15:89433569-89433591 TTCAGAGTCTGGAGGGAGCAGGG + Intergenic
1131097138 15:89663329-89663351 TGGGGGGTGGGGAGGGAAGATGG - Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131520285 15:93109405-93109427 TTGGAGGCGGGGAGGGAGGACGG - Intergenic
1132191122 15:99861788-99861810 GTGGCGGTGTGGAGGGAGGTGGG - Intergenic
1132345127 15:101103442-101103464 GTTGGGTTCTGGAGGGTGGAGGG - Intergenic
1132484830 16:185402-185424 TTGGGAGGAGGGAGGGAGGAGGG + Intergenic
1132655691 16:1040908-1040930 CTGGGGGTCTGGGCAGAGGAGGG - Intergenic
1132655727 16:1041011-1041033 CTGGGGGTCTGGGAGGAGGTGGG - Intergenic
1132655843 16:1041370-1041392 CTGGGGGTCTGGCAGGAGGTGGG - Intergenic
1132703540 16:1231695-1231717 TTGGGGGTCGGGGGGCAGGCAGG - Intergenic
1132704971 16:1239666-1239688 TTGGGGGTCGGGGGGCAGGCAGG + Intergenic
1132707978 16:1254700-1254722 TTGGGGGTCGGGGGGCAGGCAGG + Intergenic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1132958011 16:2606641-2606663 GTGGGGGTCTGGAGAGGGGTTGG + Intergenic
1132978424 16:2721586-2721608 CTGGGGGTCTGGAGGGAAGGAGG + Intergenic
1133084028 16:3347523-3347545 GTGGAGGTGTGGACGGAGGAGGG - Intergenic
1133332549 16:4984162-4984184 GTGGGGGTGTTGAGGGATGAGGG - Intronic
1133421437 16:5650343-5650365 GTGGTGGTGTGGAGGGAGGGAGG + Intergenic
1133635010 16:7656949-7656971 CTGGGGGTGTGGGTGGAGGAGGG - Intronic
1133895887 16:9928547-9928569 TTTGGGGTCTGGAGAGATGAGGG - Intronic
1133920618 16:10149740-10149762 TAGGAGTTCTGGAGTGAGGAGGG - Intronic
1133989680 16:10694870-10694892 GTGGGGCTCATGAGGGAGGATGG - Exonic
1134026271 16:10956412-10956434 CTGGGGGTCTGGTGAGAGCAAGG - Intronic
1134112502 16:11524152-11524174 TTGGGGGGTTGGGGGGTGGATGG - Intergenic
1134112643 16:11524745-11524767 CTGGGTGGCTGGAGGGAGGGAGG - Intergenic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1134694608 16:16214330-16214352 CTGGGGGTCTTCAGGGAAGAAGG + Exonic
1134977228 16:18580307-18580329 CTGGGGGTCTTCAGGGAAGAAGG - Intergenic
1135227476 16:20674443-20674465 TTGGGGGTGGAGAGGGGGGAGGG - Intronic
1135230098 16:20698403-20698425 CTGGAGGTCTGGAGGCAGAAAGG + Intronic
1135829121 16:25758006-25758028 TGGGGGCTCTGGAGAGAGGCAGG - Intronic
1135892693 16:26371685-26371707 GTGGGGGAGGGGAGGGAGGAAGG + Intergenic
1135985762 16:27182825-27182847 ATGGGGGTAGGGAGGGAGAAAGG + Intergenic
1136063496 16:27743002-27743024 TGGGGGGTGTAGTGGGAGGAGGG - Intronic
1136088774 16:27903644-27903666 TTGGGGCCCTGGAGGGAGAGTGG + Intronic
1136240045 16:28937985-28938007 TTGGGGGTCAGGATGGGGGATGG - Intronic
1137631894 16:49952447-49952469 TTGGGTGCCTGGAGGGGAGAAGG - Intergenic
1137826044 16:51496191-51496213 TTTGGTGTGGGGAGGGAGGACGG + Intergenic
1138291532 16:55852034-55852056 ATTGGGGTCTGGGGGAAGGAAGG + Intronic
1138547379 16:57727872-57727894 TTGGGGGTCGTGAGGCAGGATGG + Intronic
1138656194 16:58492909-58492931 TGGTGGCTCTGCAGGGAGGAGGG - Intronic
1138707704 16:58934568-58934590 GTGGGGGTGGGGAGGAAGGAAGG - Intergenic
1139028403 16:62848381-62848403 TTTGGGGGATGGAGGGAAGAGGG - Intergenic
1139337858 16:66245660-66245682 GTGGGGGTGAGGAGGGAGCAAGG - Intergenic
1139616463 16:68097179-68097201 TTGGAGGTGGGGAGGGAGAAAGG + Intronic
1140315797 16:73895491-73895513 TTGGGGGACTGGATGGCTGAGGG - Intergenic
1140354771 16:74296545-74296567 TTGGGGGGGTGGCGGGGGGAGGG + Intergenic
1140449761 16:75061284-75061306 CTGGGGGTGTGGGGGGAGGTGGG - Intronic
1140890226 16:79278794-79278816 TTGGGGGCCAGCAGGCAGGAAGG - Intergenic
1141392073 16:83673384-83673406 TTATAGGTCTGGAGCGAGGAGGG - Intronic
1141421452 16:83920521-83920543 TTCGAGGGCAGGAGGGAGGAAGG - Exonic
1141458868 16:84164418-84164440 TTGGGGCTGAGGAGGTAGGAGGG - Intronic
1141642383 16:85348866-85348888 CTCGGGGGCTGGAGGGAGGGAGG - Intergenic
1141693009 16:85607066-85607088 GGGGGGGGCGGGAGGGAGGAGGG + Intergenic
1141695548 16:85617417-85617439 TTGGGGGTTTCTAGGGAGGCAGG + Intronic
1141696852 16:85624265-85624287 CAGGGCCTCTGGAGGGAGGAAGG + Intronic
1141852029 16:86652990-86653012 CAGAGGGTCTGGAGGGAAGAAGG - Intergenic
1141923687 16:87153311-87153333 TTGGGAGCCTTGAGGGTGGAAGG + Intronic
1142262104 16:89047905-89047927 TTGGGGGCCTGGTGGGGTGATGG + Intergenic
1142375143 16:89702619-89702641 TTGGTGGCCTGGAGAGATGAGGG - Intergenic
1142399708 16:89852516-89852538 TCCGGGGGGTGGAGGGAGGATGG - Intronic
1142399740 16:89852594-89852616 TCTGGGGGGTGGAGGGAGGATGG - Intronic
1203029528 16_KI270728v1_random:562951-562973 TGGGGTGGCGGGAGGGAGGAGGG + Intergenic
1203042193 16_KI270728v1_random:771480-771502 TGGGGTGGCGGGAGGGAGGAGGG - Intergenic
1142521454 17:507667-507689 TTGGGGCTGTGGAGGGAGGGAGG + Intergenic
1142719469 17:1766744-1766766 CTGGGGGCCTGGAGGGGTGAGGG + Intronic
1142748738 17:1974712-1974734 GTGGGGGTGGGGAGGGGGGAGGG + Intronic
1143020924 17:3916842-3916864 CTGGGGGTCTGCAGCGAGCAAGG + Intergenic
1143084773 17:4407364-4407386 TTGGAGGCCTAGTGGGAGGATGG + Intergenic
1143124366 17:4632130-4632152 TTTGGGGCCTGGAGTGAGGGAGG - Intronic
1143362726 17:6384697-6384719 TGTGGGATGTGGAGGGAGGAAGG - Intergenic
1143431967 17:6894270-6894292 TTTGGGGTCTTCAGGGAGGACGG - Intronic
1143480717 17:7226122-7226144 TTGAGCCTCTGGATGGAGGAGGG + Exonic
1143636023 17:8164029-8164051 TTTGGGGTCCAGAGAGAGGAGGG - Intergenic
1144170022 17:12650249-12650271 TGGGGGGTCCGCAGGGAGGCTGG - Intergenic
1144297364 17:13888884-13888906 TTGTGGAGATGGAGGGAGGAGGG + Intergenic
1144346778 17:14356545-14356567 TAGGGGGTAAGGAGGCAGGAAGG + Intergenic
1144665458 17:17099025-17099047 GAGGGGCTTTGGAGGGAGGAGGG + Intronic
1144737043 17:17561042-17561064 TGTGGGGTCTGGAGGAAGGGAGG - Intronic
1145014084 17:19385574-19385596 TTGGGGGTGGGGAGGGTGGTGGG + Intronic
1145144133 17:20466853-20466875 TTGGGAGTCTGGGGGCAGCAGGG - Intronic
1145304965 17:21668960-21668982 CTGGGGGTCTGCAGGGAGGTCGG + Intergenic
1145958790 17:28873350-28873372 GTGGGGGTAGGGAGTGAGGAGGG - Intergenic
1146147649 17:30435481-30435503 TTTGGGGTGTGGTGTGAGGAAGG - Intronic
1146263908 17:31438566-31438588 ATGGGGGTGTGGAGAGAGGAAGG - Intronic
1146634066 17:34491185-34491207 TCTGGGGTCTGGGAGGAGGAAGG + Intergenic
1146941589 17:36847346-36847368 TTGGGTGTGGGGAGGGAGGTGGG + Intergenic
1146942786 17:36855323-36855345 TTTGAGGTCTGAAGGGAGGGAGG + Intergenic
1147184367 17:38705560-38705582 TCGGGGGTCAGGGGGGAGGGAGG - Exonic
1147191322 17:38739684-38739706 TTGGGGGTGTGGAGAGAGAGAGG + Intronic
1147244450 17:39110910-39110932 TGGGCTGTCTGGAGGCAGGAAGG - Intronic
1147558909 17:41497085-41497107 GTCGGGTTCTGGAGGGAGGAGGG - Intergenic
1147646654 17:42038325-42038347 CTGGGGATCTGGAGGGAGGGAGG - Intronic
1148196419 17:45716460-45716482 TGGGGGGTGGGGTGGGAGGAGGG + Intergenic
1148456283 17:47813215-47813237 TTGGGTGTCTGGGGCAAGGAGGG - Intronic
1148829603 17:50422756-50422778 TTGGGGGTGTGGTGGGGGAATGG - Intergenic
1148862660 17:50612726-50612748 TTCGGGGCAGGGAGGGAGGAAGG - Intronic
1148969822 17:51470066-51470088 TTTGGGGGGTGGGGGGAGGAAGG - Intergenic
1149217399 17:54373608-54373630 ATGGGGCTGAGGAGGGAGGATGG + Intergenic
1149553279 17:57555589-57555611 AGGGGGTTCAGGAGGGAGGAAGG - Intronic
1149595323 17:57861808-57861830 CTGGGGCCCTGGAGGGAGGGGGG - Exonic
1149612673 17:57968999-57969021 TTAGGGGTTGGGAGGGAGGTGGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149949253 17:60967738-60967760 TTGGGGGTGTGGGGGGTGGTGGG - Intronic
1150005069 17:61464140-61464162 GTGCGTGCCTGGAGGGAGGAGGG - Intronic
1150133475 17:62681507-62681529 CTGGGGGGCTTGAGGCAGGAAGG + Intronic
1150176703 17:63065051-63065073 TTAGGGGCTTGGAGGGAGCAGGG - Intronic
1150242599 17:63647244-63647266 TTCCAGGCCTGGAGGGAGGAAGG + Intronic
1151201016 17:72468082-72468104 GTGCGTGTCTGGAGGGCGGAGGG - Intergenic
1151368149 17:73630465-73630487 TGGGGGTTGAGGAGGGAGGAGGG - Intronic
1151426424 17:74033767-74033789 GTGGGGGTCTGGGGTGTGGAAGG - Intergenic
1151451465 17:74200674-74200696 TGGGGCTGCTGGAGGGAGGAGGG + Intergenic
1151508097 17:74542409-74542431 TCTGGGGTCTGGAGGAAGAAGGG - Intronic
1151779691 17:76236958-76236980 TGGGAGGTTTAGAGGGAGGAAGG + Intronic
1152040793 17:77901358-77901380 TTGCAGTTCTGGAGGGTGGAAGG - Intergenic
1152210786 17:79001958-79001980 GTGGGGCTGGGGAGGGAGGAGGG - Intronic
1152401477 17:80069071-80069093 ATGGGTGTCAGGAGGGAGGAGGG - Intronic
1152552414 17:81036175-81036197 GTGGGGGTCTGGACCGAGAACGG - Intronic
1152554858 17:81047966-81047988 TTGAGGGGCTGGAGGGAGGTGGG + Intronic
1152568426 17:81110715-81110737 TTGCGGGCCTGGAGGGAGCCAGG - Intronic
1152610819 17:81314332-81314354 GTTATGGTCTGGAGGGAGGAGGG - Intronic
1152699238 17:81810987-81811009 CTGGGGGTGTGGGGGGAGGCTGG - Intronic
1153565189 18:6412283-6412305 TTGGTGGGCTGGAGGCAGGGTGG - Intronic
1153631299 18:7072865-7072887 CTGGAGGGCTGGAGGGAGGCAGG + Intronic
1154280367 18:12996861-12996883 TTGGTGGTGTGGTGGGATGAAGG + Intronic
1154344804 18:13532849-13532871 TTGGGAGCCTGGAGGACGGAAGG - Intronic
1155302475 18:24443410-24443432 TGGGAGGGCTGGAGGCAGGAGGG - Intronic
1157475284 18:48020142-48020164 GTGGAAGTCTGGATGGAGGAGGG - Intergenic
1157519039 18:48332447-48332469 TTGGGGGTTTGGATGGCGGGAGG + Intronic
1157614695 18:48979508-48979530 CTGGGCACCTGGAGGGAGGAAGG + Intergenic
1157689412 18:49668835-49668857 GTGGGTGGGTGGAGGGAGGAGGG + Intergenic
1157749106 18:50162284-50162306 TTGTGGGTAGGGAGGGAGGGAGG - Intronic
1157979322 18:52362793-52362815 TTTGGTTTATGGAGGGAGGAGGG - Intronic
1159037687 18:63293328-63293350 TTGGGGCTGTGAAGGGAGGGTGG + Intronic
1159206971 18:65265434-65265456 TTGGGGGTCTAGGGGAGGGAGGG + Intergenic
1159590763 18:70332721-70332743 TTGGGGGTGGGGAGGGTAGAGGG - Intergenic
1160357919 18:78244394-78244416 TTGGGGGTTTGGTTGGAGGAGGG - Intergenic
1160387539 18:78505619-78505641 TTGGGGGCCAGGAGGGAGGAAGG - Intergenic
1160679009 19:404625-404647 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679068 19:404755-404777 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160679083 19:404788-404810 TGAGGGGTGTGGAGGGGGGACGG + Intergenic
1160679173 19:404982-405004 TGAGGGGTGTGGAGGGGGGATGG + Intergenic
1160739396 19:679086-679108 AGGGGGGTCTGGAGGGAGCAGGG - Intronic
1160812615 19:1019490-1019512 CTGGGGGGCTGCAGGGAGGAAGG + Intronic
1160895524 19:1400293-1400315 CTGGGGGTCTGCTTGGAGGAGGG + Intronic
1160941407 19:1621972-1621994 TGGGGGGTCAGGCAGGAGGAGGG + Intronic
1161089661 19:2353493-2353515 TTGAGGGTCTGCAGAGAGGCCGG - Exonic
1161233769 19:3188180-3188202 CCGGGGGGCTGGAGGGAGGCCGG - Intronic
1161241352 19:3225368-3225390 GTGGGGGTCTGGGGGATGGAAGG - Intronic
1161297220 19:3526198-3526220 GTGGGGGCCTGCAGGGCGGATGG - Intronic
1161392492 19:4028638-4028660 TGGGGGGCGTGGAGGGAGGGTGG + Intronic
1161494502 19:4580167-4580189 TTGGGTTTAAGGAGGGAGGAGGG - Intergenic
1161611966 19:5248075-5248097 GTGGGGGTGTGGGGGGAGAATGG + Intronic
1162110367 19:8396712-8396734 GGGGGGGGCGGGAGGGAGGAGGG + Intronic
1162126461 19:8502186-8502208 TTGGGTGACTGGACGGGGGAGGG + Intronic
1162185255 19:8899974-8899996 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162186055 19:8905986-8906008 GTGGGGCTGGGGAGGGAGGATGG + Exonic
1162789982 19:13057815-13057837 TTGCGGGGAGGGAGGGAGGAAGG - Intronic
1163102747 19:15107808-15107830 CTGAGGGCCTGGAGGGTGGAGGG + Intronic
1163189787 19:15669344-15669366 TTGGGTTTCTGGAAAGAGGATGG + Intergenic
1163221211 19:15922518-15922540 TTGGGTTTCTGGAAGGAGGATGG - Intronic
1163302955 19:16459279-16459301 ATGGGAGTGTGGAGGCAGGAGGG - Intronic
1163401278 19:17094488-17094510 TTGGGGATGTGGAGTGGGGAGGG - Intronic
1163639138 19:18451584-18451606 CTGGGGGGCTGGAGGCAGCAGGG + Exonic
1163680049 19:18676046-18676068 ATGGGGGTCTGGATGTAGGGAGG + Intergenic
1163691101 19:18738963-18738985 TTGGGCGGCTGGAGGGAGTGAGG + Intronic
1163748011 19:19059427-19059449 CTGGGAGTCTCCAGGGAGGAGGG - Intronic
1164536188 19:29087949-29087971 TGGGGGGCCTGGAGGGAGGGAGG + Intergenic
1164577285 19:29412997-29413019 TTGGGGGCCTGGAGGCAGGGAGG - Intergenic
1164862749 19:31575495-31575517 TGGGTGGTCTGGAAGGAGGAGGG + Intergenic
1164926847 19:32137379-32137401 CTAGAGGACTGGAGGGAGGAAGG + Intergenic
1165149863 19:33753976-33753998 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165149881 19:33754016-33754038 GTGGGGGGATGGAGGGGGGATGG - Intronic
1165160964 19:33816013-33816035 TTGGGGGTCTGGAGAGGTAAAGG - Intergenic
1165771077 19:38380657-38380679 TTGGGGGGAGGGAGGGAGGGAGG + Intronic
1165775118 19:38399668-38399690 TTGAGGGTCTGATGGGAGAAGGG - Intergenic
1165797401 19:38526932-38526954 TTGTGGGTCAGGAAGGAGGATGG + Intronic
1165806359 19:38583526-38583548 GTGGGGGTGGGGAGGGAGCATGG - Intronic
1165891911 19:39117728-39117750 CTGAAGATCTGGAGGGAGGAAGG - Intergenic
1165922122 19:39305661-39305683 TTGGGGGGATGGAGGGACTACGG + Intergenic
1166151757 19:40880245-40880267 CTGCGGGTGTGGAGGGAGAAGGG + Intronic
1166198909 19:41223603-41223625 CTGGGGGTCTCCAGGGTGGAGGG + Intronic
1166230368 19:41422931-41422953 GTGGGGGTCAGGAGGGAGGATGG - Intronic
1166297894 19:41897596-41897618 TGGGGGGTCTTGGGGGAGGGGGG - Intronic
1166332666 19:42088007-42088029 CTGGGGGGCTGGAGGGAGCCAGG - Intronic
1166347983 19:42178143-42178165 TGGGGGGAGAGGAGGGAGGAGGG + Intronic
1167010366 19:46803118-46803140 TTGGGGGTCTGAGGGGACGTAGG + Intergenic
1167265591 19:48481437-48481459 TTGGGGGTCCTGGGCGAGGAGGG - Intronic
1167368135 19:49065257-49065279 TCCTGGGTCTGAAGGGAGGAGGG - Intergenic
1167369889 19:49074146-49074168 CTGGGGGTGTGGAGAGAGGTAGG + Intergenic
1167477515 19:49709468-49709490 TTGGGGATGGGGATGGAGGAGGG - Intronic
1167524178 19:49973331-49973353 TTTGGGATCTGGAGGAGGGAGGG - Intergenic
1167569253 19:50276729-50276751 TTGGGGGAAAGGAGAGAGGATGG - Intronic
1167643527 19:50694557-50694579 TAGGGGGCCTGCTGGGAGGAAGG + Intronic
1167743958 19:51340292-51340314 CGGGCCGTCTGGAGGGAGGAGGG + Exonic
1168114105 19:54211382-54211404 TAGGGGGCCAGGAGGGAGGTTGG + Intronic
1168137618 19:54361698-54361720 TTGAGGGTCTGGTGGGGTGAGGG + Intronic
1168160451 19:54507380-54507402 TTGAGGGTCTGGTGGGGTGAGGG - Intronic
1168346693 19:55653258-55653280 TGGGTGGTCAGGCGGGAGGACGG + Intergenic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
1202676819 1_KI270711v1_random:14728-14750 TAGGGTGTGGGGAGGGAGGAGGG - Intergenic
925068952 2:951141-951163 GAGGGGGCGTGGAGGGAGGAGGG - Intronic
925082165 2:1078843-1078865 CTGAGGGTCAGGAGGGAGGAAGG + Intronic
925242851 2:2347737-2347759 TTGAGAGACTGGCGGGAGGATGG - Intergenic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925366606 2:3315638-3315660 TAGGGGGTGTGGATGGGGGATGG - Intronic
925439300 2:3870045-3870067 TTGTGGGTCTGGAGGGTGTTTGG + Intergenic
925601186 2:5610234-5610256 TTGTGGGGCTGGAGGCAGGGAGG + Intergenic
925978083 2:9155093-9155115 GTGGGAGATTGGAGGGAGGAAGG + Intergenic
926112400 2:10191720-10191742 TGCGGGGTCTGGAGGGAACACGG + Intronic
926631337 2:15139022-15139044 TTGGAGGGCAGGAGGTAGGAAGG + Intergenic
927506385 2:23617622-23617644 TTGGGAGTGTGGAGGGTGGGTGG + Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927715235 2:25347598-25347620 CTGGAAGTCAGGAGGGAGGATGG - Intergenic
927799324 2:26083423-26083445 TTGGGGGAGGGGAGGGAAGAGGG - Intronic
928393480 2:30926847-30926869 TTGGGGGCCAGGAGAAAGGAGGG + Intronic
928942699 2:36742605-36742627 TATGGGGCCTGGTGGGAGGATGG - Intronic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929434648 2:41919232-41919254 TTTGGGGGGTGGAGGGAAGATGG - Intergenic
929765362 2:44839601-44839623 TTTGGAGACTGGGGGGAGGAAGG - Intergenic
929968589 2:46553907-46553929 TTGGGGGTTTGGCGGGAGGTAGG - Intronic
930989312 2:57631579-57631601 GTGGGGGGCGGGAGGCAGGAAGG + Intergenic
931037406 2:58258940-58258962 TGGGGTGGCTGGAGTGAGGAAGG + Intergenic
932048636 2:68376901-68376923 GTGGGGGACTGCAGGGAGGTGGG - Intronic
932128876 2:69169464-69169486 GTTGGGGTCAAGAGGGAGGAGGG + Intronic
932231786 2:70089243-70089265 TGAGGTGTTTGGAGGGAGGAGGG + Intergenic
932411342 2:71549696-71549718 ATGGGGGTCTGGAGTGGGGCAGG + Intronic
932465590 2:71922153-71922175 TGGGGGGACTGGAGAGAAGAGGG - Intergenic
932577937 2:72972933-72972955 TTGGGGAGCTGGAGGGTGGCGGG + Intronic
932618433 2:73251098-73251120 TTGGGGCTTGGGATGGAGGAAGG + Intronic
932688104 2:73890796-73890818 TGGGGATTCTGGAGGGAAGAGGG - Intergenic
932791547 2:74658006-74658028 TTGGGGTGGTGGTGGGAGGATGG + Intronic
933343528 2:81052589-81052611 TTGGGTGTCTGTGGTGAGGACGG + Intergenic
933901505 2:86853620-86853642 TTGGTGTCCTGGAGAGAGGAAGG + Intronic
934040524 2:88124378-88124400 TTTGGGGGTTGGAGGGTGGAGGG + Intronic
934562684 2:95321104-95321126 TTGGGGGACTGGGGAGGGGAGGG - Intronic
934609099 2:95721519-95721541 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934902097 2:98167576-98167598 CTGAGGGTCTGGAGGGACCAAGG + Intronic
935033862 2:99348771-99348793 TTGGGGATGGGGACGGAGGAAGG + Intronic
935278461 2:101496497-101496519 TTGGGCCTCTGCAGGGTGGAGGG - Intergenic
935639239 2:105275072-105275094 TTGTGGGCCTGGAGGAGGGAGGG - Intronic
935782282 2:106518872-106518894 TTGGAGGGCTGAAGGGAGGACGG - Intergenic
936133805 2:109871534-109871556 GTGGGGGACTGGAGTAAGGAAGG - Intergenic
936210892 2:110499951-110499973 GTGGGGGACTGGAGTAAGGAAGG + Intergenic
936285565 2:111178736-111178758 TCAGGGGTCTGGAGGGAGATGGG - Intergenic
936435420 2:112501054-112501076 GTGGGGGACTGGAGTAAGGAAGG + Intronic
936542420 2:113363100-113363122 TGGGAGGTCAGGTGGGAGGATGG - Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
937341682 2:121095414-121095436 TGGAGAGGCTGGAGGGAGGACGG - Intergenic
938539210 2:132272765-132272787 TTGGGGGGAGGGGGGGAGGAGGG - Intergenic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
939683521 2:145169214-145169236 TTGGGGGGCTGAAGGCAGCAGGG - Intergenic
940207037 2:151214260-151214282 TTGGGAGGCTGGTGGGAGGCAGG + Intergenic
940864408 2:158803729-158803751 TTTGGGGTCTGGATGGAAGGTGG + Intronic
941211966 2:162651357-162651379 TTGGGGGTGGGGTGGGAGGAGGG - Intronic
942227734 2:173831743-173831765 TCAGGGGTCGGGAGGGAGGTGGG + Intergenic
942255521 2:174093205-174093227 TTGGGGATTTGGTGGGAAGATGG + Intronic
942609674 2:177730217-177730239 TGGGGTGTGGGGAGGGAGGAAGG - Intronic
942855793 2:180545976-180545998 TTGAAGGTATGGAGTGAGGAAGG + Intergenic
942998203 2:182291150-182291172 TGGAGGGTCTAGAAGGAGGATGG - Intronic
943116334 2:183676298-183676320 ATGGGGGTTTGGGGGCAGGAGGG + Intergenic
943794959 2:191980693-191980715 CTGGAGGTCTGGAGAGAAGAGGG - Intronic
944163350 2:196690225-196690247 TGGGGAGGCGGGAGGGAGGAGGG + Intronic
944384300 2:199147628-199147650 TTAGTGGTCTGCAGGGAGGTGGG - Intergenic
944666975 2:201966988-201967010 TTGGGGGTGGGGAGGGAGGTTGG - Intergenic
944866783 2:203870432-203870454 CTGGGGGTGTGGAGAGGGGAAGG + Intronic
944912246 2:204322300-204322322 TTGGGGGGATAGAGGGAGAAGGG - Intergenic
945027017 2:205629427-205629449 TAGGGGGTCGGGAGGCAAGATGG - Intergenic
945158106 2:206860362-206860384 TTGGGGGGGTGGGGGGAGGGAGG - Intergenic
945326791 2:208491663-208491685 TTGGGGGGCGGGGGGTAGGAGGG - Intronic
946077832 2:217090076-217090098 TGGAGGGTAGGGAGGGAGGACGG + Intergenic
946154986 2:217801377-217801399 CTGGGTGTCTGGAGGGAAGAGGG - Exonic
946174836 2:217916285-217916307 TGGGGGGTCTGGAGGGGAGGAGG - Intronic
946190062 2:218003284-218003306 GCGGGGGTCTGCAGTGAGGAGGG - Intergenic
946357182 2:219195247-219195269 TGGGGGGTGGGGAGGTAGGAGGG - Intronic
946391161 2:219417867-219417889 GTGGGGGTCTCTAGGCAGGAAGG - Intergenic
947184868 2:227445811-227445833 TTGGGGTTCTGGAGTGGTGACGG + Intergenic
947275672 2:228389465-228389487 TTGGGAATCGGGAGGGAAGAAGG - Intergenic
947466330 2:230350732-230350754 TTGGGAGTATGGGGGCAGGATGG + Intronic
947546217 2:231012086-231012108 TTGGGAGTCTGGAGGAAAGGAGG + Intronic
947587052 2:231362858-231362880 TTTGGGGTCAGGCAGGAGGAAGG - Intronic
947590228 2:231381167-231381189 ATGGGGTTCAGGATGGAGGATGG - Intergenic
947751670 2:232535785-232535807 TCTGGGGTCTGGAGGGAGGGAGG - Exonic
947933826 2:233985991-233986013 TTGGTGGACTGGAGGGAGTGGGG + Intronic
948127727 2:235576989-235577011 TTTGGGGTATGGAGGGAAGATGG - Intronic
948274396 2:236697008-236697030 GTGGGGGACTGGATGGATGATGG + Intergenic
948540236 2:238686082-238686104 ATGGGGCTGTGGAGGGAGAAAGG - Intergenic
948795492 2:240400262-240400284 TTGCGGGGCTAGAGAGAGGAGGG + Intergenic
948884320 2:240875304-240875326 TTGGGGTTCTTGAGGCATGAAGG - Intronic
1168869826 20:1118738-1118760 TTCGGCGTCTGGAGGAAAGAAGG - Exonic
1168876099 20:1173341-1173363 TTGGGGATCAGGGAGGAGGAGGG - Intronic
1169307726 20:4507542-4507564 TTGAGGGGGTGGAGGGAGGGCGG + Intergenic
1169361887 20:4957211-4957233 TTGGGGGGCTTGAGTCAGGAGGG + Intronic
1169731021 20:8785634-8785656 TGGGGAGTCTGGAGGGAGTGTGG + Intronic
1169840339 20:9928839-9928861 TTGGGAGTGTGGATGGAGGATGG + Intergenic
1169958486 20:11132114-11132136 TCAGGGGTTTGGAAGGAGGAGGG + Intergenic
1170579613 20:17687893-17687915 AAGGGGGTCTGCAGGCAGGAAGG + Intergenic
1170883606 20:20318792-20318814 TTGGGGGTCAGGAGGGATCCTGG + Intronic
1170907244 20:20527591-20527613 TTGGGGGTGTGGGGGGAGGGCGG - Intronic
1171239369 20:23552419-23552441 GTGGGGCTCTGGAGAGAGCACGG - Intergenic
1171290295 20:23979230-23979252 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1171522482 20:25786431-25786453 CTGGGGGCCTGCAGGGAGGTCGG + Intronic
1171554345 20:26069452-26069474 CTGGGGGCCTGCAGGGAGGTCGG - Intergenic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1172321250 20:33996789-33996811 TTCAGGGGCTGGAGGGAGGAGGG - Intronic
1172587355 20:36093840-36093862 GTGGGGGGCTGGGGGGAGGCCGG - Intronic
1172613625 20:36268925-36268947 ATGGAGGCCTGGAGGAAGGAAGG + Intronic
1172614684 20:36275347-36275369 CTGGGGCTCTGGAAGGAGGCAGG + Intergenic
1172807688 20:37624376-37624398 TTGGGGGTGGGGAGGGAGGCTGG - Intergenic
1172850547 20:37959852-37959874 TTTGGGGGGTGGAGGGTGGAGGG + Intergenic
1172940428 20:38650170-38650192 CTGGAGGGCTGGAGGGTGGAGGG - Exonic
1172946447 20:38693177-38693199 CTGGGGGCCTGCTGGGAGGAGGG - Intergenic
1172951006 20:38723650-38723672 TTGGGGGTCTGGAAGAAGGCAGG - Intergenic
1173176968 20:40771856-40771878 TGGGGGTCCTGGAGGGAGGAGGG - Intergenic
1173219914 20:41124009-41124031 TTGGGGTTGGGGAGGGATGAAGG + Exonic
1173311922 20:41904407-41904429 TCAGAGGTTTGGAGGGAGGAGGG + Intergenic
1173336440 20:42115849-42115871 TTGGGGGTCTGGAAGGAGAAAGG + Intronic
1173581768 20:44152030-44152052 TTGGTGGTGGAGAGGGAGGAAGG - Intronic
1173796487 20:45864396-45864418 TTGGGGGACTGGAGGGTTGGTGG + Intronic
1173837658 20:46136345-46136367 TTGGGGGTCAGGAGGAGGAAGGG + Intergenic
1174112282 20:48205034-48205056 CTGGGGGTCTGGCAGCAGGAGGG + Intergenic
1174199445 20:48797330-48797352 GGGGGGGTCTGGGGGGAGCAGGG - Intronic
1174404581 20:50294965-50294987 ATGGGGGGCAGGAGGGCGGAGGG + Intergenic
1174467391 20:50728793-50728815 TTGGGGGTGGGGAGGGATGATGG + Intergenic
1174582906 20:51585286-51585308 TTGGGGGTTGGGAGTGGGGAGGG - Intergenic
1174743626 20:53040331-53040353 TGGCTGGTGTGGAGGGAGGAGGG + Intronic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174899050 20:54479374-54479396 TTGAGGGGCTGGGGGAAGGAGGG + Intronic
1174937057 20:54882308-54882330 TTGGGTGCGGGGAGGGAGGAGGG - Intergenic
1175303749 20:57961474-57961496 TTGGAGATCAGCAGGGAGGAGGG - Intergenic
1175327606 20:58140624-58140646 TGGAGGCTCTGGAGGGAGCACGG - Intergenic
1175385380 20:58591655-58591677 CTGGGGGTCTGGAGGGCTGCAGG - Intergenic
1175424877 20:58856920-58856942 TTGGGGGGCTGGGGGGAGGGTGG - Intronic
1175660041 20:60804522-60804544 TTGTGGGTCAGGAAGGAAGAGGG + Intergenic
1175934585 20:62509159-62509181 TTGGAGGGGTGGAGGGTGGAAGG - Intergenic
1176039154 20:63055238-63055260 TGGGGGGTGTGGAGTGAGGCTGG + Intergenic
1176123876 20:63466489-63466511 GTGGAGGCCAGGAGGGAGGATGG - Intronic
1176139982 20:63540753-63540775 TTGGCGCTCTGCAGGGAGGAGGG + Intergenic
1176166284 20:63675745-63675767 TTGGGGGACTGTGGAGAGGAGGG - Intronic
1176656285 21:9591409-9591431 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1179030693 21:37717377-37717399 GTGGGTGTGTGGAGGGAGGCAGG + Intronic
1179336493 21:40461537-40461559 TCTGGGGTCTGGGGGGAGGCAGG + Intronic
1179603908 21:42499648-42499670 GTGCGGCTCTGCAGGGAGGAGGG + Intronic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179832439 21:44005832-44005854 TGTGGGGTAAGGAGGGAGGAGGG - Intergenic
1180049308 21:45324120-45324142 CTGAGGGTTGGGAGGGAGGAGGG - Intergenic
1180713980 22:17859056-17859078 CTGGGGGGCTGAGGGGAGGAAGG + Intronic
1180767133 22:18351782-18351804 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1180779178 22:18510597-18510619 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180811897 22:18767917-18767939 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1180991623 22:19940835-19940857 TTGGGGGTCTCCAGGACGGAGGG - Intronic
1181054312 22:20252901-20252923 TTGGGGTCCTGGGGGGAGGTAGG - Intronic
1181114336 22:20621669-20621691 TTGGTGGCCTTGAGGTAGGAAGG - Intergenic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181198052 22:21202161-21202183 ATGGGGGAATGGAGGGAAGAAGG + Intergenic
1181387834 22:22558178-22558200 TGGGGGGTCGGGATGGGGGAAGG + Intronic
1181401693 22:22653643-22653665 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1181536778 22:23550376-23550398 TTGGGAGGATGGATGGAGGATGG - Intergenic
1181647857 22:24243457-24243479 ATGGGGGAATGGAGGGAAGAAGG + Intronic
1181703651 22:24634736-24634758 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182090895 22:27594137-27594159 GGGAGGGACTGGAGGGAGGAAGG + Intergenic
1182188161 22:28429325-28429347 TTGAGGCCCTGGAGGGAGAAAGG - Intronic
1183263324 22:36810418-36810440 TAGGGGGTTGGGAGTGAGGAAGG + Intronic
1183310680 22:37107999-37108021 TTGGACTTCTGTAGGGAGGAAGG - Intronic
1183590349 22:38776197-38776219 ATGGGGGTGGGGAGAGAGGACGG - Intronic
1184236863 22:43187344-43187366 GCGGGGGGCTGGGGGGAGGACGG - Intergenic
1184324738 22:43774622-43774644 TTAGGTGTCTGCAGGGAGCACGG + Intronic
1184729122 22:46363553-46363575 TTGTGAGTTTGGAGGGAGGGAGG + Intronic
1184730102 22:46367111-46367133 AAGGGGCCCTGGAGGGAGGAAGG + Exonic
1184852312 22:47127986-47128008 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852326 22:47128014-47128036 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852365 22:47128108-47128130 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852378 22:47128135-47128157 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184852391 22:47128162-47128184 TGGGTGGGGTGGAGGGAGGATGG - Intronic
1184946963 22:47810699-47810721 TTGGGGTTCTGAAGGGACGGGGG + Intergenic
1185272598 22:49935847-49935869 CTGGGGGTCTGGGAGAAGGAGGG + Intergenic
1203228755 22_KI270731v1_random:92676-92698 ATGGGGGAATGGAGGGAAGAAGG - Intergenic
949444637 3:4120758-4120780 TTGGGGGTCTTGTTGAAGGAGGG - Intronic
950100648 3:10354686-10354708 TTGGGCTTCTCGTGGGAGGAAGG + Intronic
950149623 3:10676495-10676517 ATGGGGATGGGGAGGGAGGAGGG + Intronic
950628652 3:14267017-14267039 TTTGAGGAGTGGAGGGAGGAAGG + Intergenic
950894853 3:16439676-16439698 GTGGGTGGCTGGAGTGAGGAAGG + Intronic
951093990 3:18607300-18607322 TTGGGGATCTGGAGAAAGGTAGG + Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
952282508 3:31937588-31937610 TCGGGGGTCTGGGGGCAGGAAGG - Intronic
952314789 3:32223333-32223355 TTGGGGATCTGAAGGGAGTATGG + Intergenic
952459567 3:33510207-33510229 TGGGGGGGATGAAGGGAGGAAGG + Intronic
952943849 3:38462955-38462977 GTTGGGGTGTGGAGGTAGGAAGG - Intronic
953216599 3:40924183-40924205 TTGGAGGGTGGGAGGGAGGAGGG + Intergenic
954389454 3:50260995-50261017 ATGGGGGGCTGCAGGCAGGAAGG + Intergenic
955059830 3:55485150-55485172 CTGGTGGTCGGGAGGGATGAAGG + Intronic
955389790 3:58513118-58513140 CTGGGGGTCAGTAGGGAGGAGGG - Intronic
955826339 3:62951630-62951652 TCTGGGGTCTGGAGGATGGATGG - Intergenic
956066372 3:65401369-65401391 GTGGGGGGCTGGAGGTGGGAGGG - Intronic
956518746 3:70080589-70080611 ATAGGGTTTTGGAGGGAGGAGGG - Intergenic
956560731 3:70571370-70571392 TTGGGGGCATGGAGAGAGGAGGG - Intergenic
956860218 3:73315867-73315889 GCAGGGGGCTGGAGGGAGGAGGG - Intergenic
957153416 3:76516286-76516308 GTGTGGGTATGGAGGTAGGATGG - Intronic
957228003 3:77473917-77473939 ATGGGGGTTTGGAGGAAGGAAGG - Intronic
957322715 3:78653227-78653249 TTGAGGAACTGGAGGGAGGCAGG - Intronic
957355701 3:79082856-79082878 TTGATGGTGTGGAGGGAGGCAGG + Intronic
957646765 3:82939971-82939993 TTGGGGGGGTGGGGGGAGGTTGG - Intergenic
957893207 3:86386685-86386707 GTGGGGGTCGGGAGGAAGGTCGG + Intergenic
957960812 3:87248752-87248774 TTGGGGGTGGGGAGGGATGGGGG + Intronic
959507430 3:107171548-107171570 TCTGGGGTCTGGAGGGTGGTGGG - Intergenic
960384619 3:117007163-117007185 TTGTGGGGGTGGAGGGAGGGAGG - Intronic
960523066 3:118678261-118678283 TTTGGGGTTTGGAGGGTGTAGGG - Intergenic
961182486 3:124887387-124887409 CTGGCGGGCCGGAGGGAGGAAGG - Intronic
961214268 3:125147552-125147574 GAGGGGATCCGGAGGGAGGAGGG - Intronic
961480187 3:127174547-127174569 TGAGGGGTCTGGAGGCAGGCAGG - Intergenic
961628755 3:128281377-128281399 TTTGGGGTCTTGAGAGAGAAGGG + Intronic
961872634 3:129999902-129999924 TTGGGGGGGTGGAGGGTGGAGGG - Intergenic
962371379 3:134823452-134823474 CTGGGGGTCTTGGGGAAGGAAGG + Intronic
963263711 3:143218137-143218159 TTAGGGGTGGGGAGGGAGGAGGG + Intergenic
963600200 3:147371984-147372006 TTGGGGGTATGGTGGGAGCGGGG + Intergenic
963613715 3:147507493-147507515 TTGGGGGGAGGGAGGGAAGAAGG - Intronic
963638320 3:147826888-147826910 TTGGTGGTATGGAGTAAGGATGG - Intergenic
964028116 3:152102968-152102990 TTGGAGGAAGGGAGGGAGGAAGG - Intergenic
964131962 3:153299266-153299288 GTGGGGGGCTGGTGGGAGGAGGG + Intergenic
964284819 3:155106656-155106678 TTGGGGGGATGGTGGGAGGAGGG + Intronic
965355620 3:167669493-167669515 TTGGGAGGATGGAGGGAGGAGGG + Intergenic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965558778 3:170042582-170042604 TTGGGAGGCTGAGGGGAGGAAGG + Intronic
965960421 3:174422723-174422745 TTGGGGCTGAGGAGGGAGGAAGG + Intergenic
968479551 4:827138-827160 GTGGGGGTGGGGAGGGGGGAGGG + Intergenic
968534043 4:1112873-1112895 GTGGGGGGCTGCAGGGAGGAAGG - Intronic
968539130 4:1154175-1154197 TTGGGTGTCTGGGGGGAGTCTGG + Intergenic
968719631 4:2191681-2191703 TTGGGGGTGGGGAGAGATGATGG + Intronic
968887298 4:3341528-3341550 ATGGGGGTGTGGGGGGAGGGAGG + Intronic
968890341 4:3365342-3365364 CAGGGAGTCTGGAGGGAGGAGGG + Intronic
969021573 4:4143131-4143153 TGGGGGGTCTGGAGCGGGGCCGG + Intergenic
969091197 4:4695266-4695288 TTGGGGGTCTGGGGTAGGGAAGG - Intergenic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969180738 4:5438743-5438765 TGGGGTGTGGGGAGGGAGGAGGG - Intronic
969421860 4:7102209-7102231 CTAGGCGTCTGGAGAGAGGAAGG - Intergenic
969433937 4:7173162-7173184 TAGGGGGTCAGGAGTGTGGACGG + Intergenic
969738001 4:9003948-9003970 GTGGGGGGGTGGAGGGTGGAGGG + Intergenic
970191975 4:13525983-13526005 TTGGGGGTCTGGGGGATGGTTGG - Intergenic
971354478 4:25882668-25882690 TTGGGGGTGGGGTGGGACGAGGG + Intronic
971470312 4:27018026-27018048 TTGGGGGTAAGGTGTGAGGAGGG + Intronic
971558282 4:28040838-28040860 TTGGGGATGTGGGAGGAGGATGG + Intergenic
971664331 4:29462184-29462206 GAGGGGGGATGGAGGGAGGAGGG + Intergenic
971787505 4:31123812-31123834 ATGGGGGTCTGGAAAGAGGATGG + Intronic
972221370 4:36959527-36959549 TTGGGGCTCTGCCAGGAGGAAGG - Intergenic
972330492 4:38059869-38059891 TTGGGGGGCGGCAGGGAGCAGGG - Intronic
972726048 4:41746995-41747017 TTGGGGGGCGGGAGGGGAGAAGG + Intronic
972741689 4:41893220-41893242 CTTGGTGTCTGGAGGGAGGGAGG - Intergenic
973532144 4:51844295-51844317 TTCGGGGTGCGGAGAGAGGAGGG + Intronic
973532435 4:51846145-51846167 TTTGGGGAATGGAGGGAGGTGGG - Intronic
974104939 4:57459065-57459087 TTGGGAGGGTGGTGGGAGGAGGG + Intergenic
975035681 4:69677320-69677342 GTGAGGGGCTGGAGGGAGGAAGG + Intergenic
975685172 4:76913558-76913580 TTGGGGGGTTGGAGGAAGAAAGG - Intergenic
975765764 4:77666217-77666239 TTGAGGGGCGGGAGGGTGGAGGG + Intergenic
975985402 4:80197560-80197582 TTGGGGGGGTGGAGGGAGGGAGG - Intronic
976167146 4:82268238-82268260 TGGGGTTTCTGGAGAGAGGAAGG - Intergenic
976205452 4:82619521-82619543 TTGGCAGGATGGAGGGAGGAGGG - Intergenic
976613400 4:87052418-87052440 GTGGTGGTGTGGGGGGAGGAGGG - Intronic
977027445 4:91836802-91836824 TTTGGGGAAGGGAGGGAGGATGG + Intergenic
977260411 4:94790434-94790456 TTGGGGTTCTGGAGGCAGGAAGG + Intronic
977873092 4:102116977-102116999 TGGGGGGTGGGGAGTGAGGATGG - Intergenic
978829387 4:113066179-113066201 TTGTGGGGCTGGGGGGAGGAGGG - Intronic
979168244 4:117564415-117564437 TTTGGGGACTGGAGGGGGAAGGG - Intergenic
979362197 4:119777859-119777881 TTTGGAGGCTGGAGGGTGGAAGG - Intergenic
979537608 4:121841311-121841333 TTGGGAGGCTGGAAGGTGGAAGG + Intronic
979689654 4:123547152-123547174 GTTGGGGGCTGGAGGGGGGAGGG - Intergenic
981346862 4:143685867-143685889 GTGGGGGCCTGGAGGAGGGATGG + Intronic
981705442 4:147654635-147654657 ATGGGGGGCTAGATGGAGGATGG - Intronic
982200674 4:152957058-152957080 TTGGGTCTCTGGATGGAGGTTGG + Intronic
982360297 4:154512232-154512254 CTGGAGGGCTGGAGGGAGGATGG + Intergenic
982452604 4:155570796-155570818 CTGGAGGTGGGGAGGGAGGATGG + Intergenic
983060076 4:163149871-163149893 TTGGGGGACTGCAGAGAAGAGGG + Intronic
983144467 4:164196810-164196832 TGGGGGTTGTGGAGGGAGGGAGG - Intronic
984364945 4:178786299-178786321 TAGGGGGTGTGGTGGGGGGAGGG + Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984624873 4:181995968-181995990 CTGGGGCTCTTGAGGGAGGAAGG - Intergenic
984787372 4:183580795-183580817 TAGGGGGTTGGGAGGGAGCAGGG - Intergenic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985139429 4:186823742-186823764 TTGGTGCTCTGAAGGGTGGAGGG - Intergenic
985691448 5:1314920-1314942 CCAGGGGTCTGGAGGAAGGATGG - Intergenic
985836335 5:2274828-2274850 CCGGGGGTCAGCAGGGAGGAGGG + Intergenic
986548580 5:8926835-8926857 TGGGGGGTCAGGAGGAAGTAGGG + Intergenic
986952959 5:13113381-13113403 AAGGGGGCCTGGAAGGAGGAAGG + Intergenic
988062488 5:26190398-26190420 TTGGGGGATTGGAGGGTGGAGGG + Intergenic
988802924 5:34713640-34713662 TTGGGAGTCAAGAGGAAGGAAGG - Intronic
989156195 5:38347074-38347096 TGGGGTGGCTGGAGGGAGGTGGG + Intronic
989622804 5:43401323-43401345 TTGGGGGCATGGAGAGTGGATGG + Intronic
989719123 5:44504014-44504036 TTGGGGAGCTGGAAGGGGGATGG - Intergenic
990088613 5:52011556-52011578 TTGTGGGTCTGGATGAAGGTTGG - Exonic
990497533 5:56363487-56363509 TTGTGTGTGTGCAGGGAGGAGGG - Intergenic
991644996 5:68792664-68792686 TTGGGGATCTGGAAAGGGGATGG + Intergenic
992759959 5:79942851-79942873 TAGAGGTTCTGGAGGGAGCATGG - Intergenic
992784432 5:80156038-80156060 TGGGGGCTCTGGAGGGCGAAGGG + Intronic
993188989 5:84656930-84656952 CTGGGGGTGGGGAGGGAGGATGG + Intergenic
993521234 5:88904264-88904286 TAGGGGGTCGGGAGGGGGGAGGG - Intergenic
993754495 5:91711065-91711087 TTGGGGGCCTGGGAGGAGGAAGG + Intergenic
993971341 5:94423178-94423200 CTGGGGGGTTGGAGGGATGAAGG + Intronic
995587148 5:113659889-113659911 TAGAGGCTCTGGAGGGAGTACGG + Intergenic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
996032456 5:118721226-118721248 TTGGGGGGAAGGAGGGAGGGGGG + Intergenic
996619631 5:125484366-125484388 TTGGTGGTTTGGAGGGAGGGAGG + Intergenic
996728371 5:126692853-126692875 TTGGGGCTGAGGTGGGAGGATGG - Intergenic
996928050 5:128852413-128852435 GTGGGGGATTGGAGGGAGGGAGG + Intronic
997291505 5:132739232-132739254 TTGGGAGTGGGGTGGGAGGAGGG - Intergenic
997898395 5:137740689-137740711 TGGGGGGTCAGGGGGGATGATGG + Intergenic
998167703 5:139853781-139853803 TGGGGGGTTGGGAGGGAGGTGGG + Intronic
998375517 5:141688100-141688122 TTGGTGGTTTGCAGGGAGGTAGG - Intergenic
998416185 5:141947835-141947857 TTGGGGGTAAGGAAAGAGGAGGG - Intronic
999233795 5:150078526-150078548 TGGGGGGCTTGGAGGGAGGCAGG - Intronic
999254235 5:150200929-150200951 CTGGGTGTGTGAAGGGAGGAGGG + Intronic
999493430 5:152073670-152073692 TAGGGGGTCTGGAGAGAGGAGGG + Intergenic
999782271 5:154858828-154858850 TTGGGGGTCTGTAGGGGGAAGGG + Intronic
1000593385 5:163185556-163185578 TAGCGGGTCAGGAGGAAGGAAGG + Intergenic
1000634241 5:163625530-163625552 TTGGGTGTATGGTGAGAGGAAGG - Intergenic
1001082820 5:168679557-168679579 TTAAGGGACTTGAGGGAGGAAGG + Intronic
1001552199 5:172611106-172611128 TTGGGGGTGAGCAGGCAGGATGG + Intergenic
1001602844 5:172940109-172940131 TGGGTGGGCTGGAGGGAGGGAGG + Intronic
1001635041 5:173203793-173203815 TCCAGGGGCTGGAGGGAGGAGGG - Intergenic
1001707708 5:173753722-173753744 TGGGGGCACTGGAGGGAGCAGGG + Intergenic
1001933145 5:175687180-175687202 TTGAGGGCATGGAGGGCGGAGGG + Intergenic
1001948226 5:175797488-175797510 GTGGGGGTCTGGAGGGAAGACGG - Intronic
1002063045 5:176637738-176637760 GAGGAGGGCTGGAGGGAGGAGGG + Intronic
1002584332 5:180232571-180232593 GTGGGGGTTTTCAGGGAGGAGGG - Intergenic
1002762648 6:214046-214068 ATGGGGAGCTGGAAGGAGGAGGG - Intergenic
1002813498 6:657037-657059 CTGGGGGGCCGGAGGGAGGGCGG - Intronic
1003085194 6:3054781-3054803 TTGGGGGTTGGGAGGGCGGTGGG + Intergenic
1004001487 6:11600841-11600863 AGGGAGGTCTGGAAGGAGGACGG - Intergenic
1004031596 6:11875488-11875510 TTGTGGGCTTGGAGGGAGGGCGG - Intergenic
1004210643 6:13638852-13638874 TTGGGGGTGGGGGGAGAGGAGGG + Intronic
1004515365 6:16317810-16317832 TTAGGGGGATGGATGGAGGAAGG - Intronic
1004749031 6:18541618-18541640 TTGGGGGTCTGGAGGGGGTGGGG - Intergenic
1004923978 6:20402025-20402047 TCGGGGCTCTGGAGAGAGGAGGG - Intronic
1005111359 6:22285352-22285374 TTGGGGGGGTGGGGGGAGGTTGG + Intergenic
1005161557 6:22870293-22870315 TTGGGTGTGGGGAGGGGGGAGGG + Intergenic
1005200883 6:23342791-23342813 TTGGGGGGCTGGAAAGGGGATGG - Intergenic
1005681872 6:28216458-28216480 TTGGGGGTGAGAAGGGAGCAGGG - Intergenic
1005926619 6:30450625-30450647 TTGGGGGTGTGGAGTTGGGAGGG - Intergenic
1006058861 6:31404683-31404705 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006071346 6:31499568-31499590 TTGGGGGTCTGGAGGGGAGTGGG - Intronic
1006124909 6:31831298-31831320 TTGGGGGGGTGGTGGGTGGAGGG + Intergenic
1006276580 6:33009187-33009209 TTGGGTCTCAGGAAGGAGGAAGG + Intronic
1006299469 6:33185934-33185956 TTGAGGGTCAGGAGGGAGGTGGG + Intronic
1006907685 6:37544144-37544166 ATGGGAGACTGGAGGGAGGAAGG + Intergenic
1006913464 6:37579210-37579232 TGGGGGGTCTGGAGAGGGGCAGG - Intergenic
1007246993 6:40470132-40470154 GTGGGGTTCTGCAGGCAGGATGG - Intronic
1007303273 6:40884733-40884755 TTGGGGAGCTGGAGAGGGGATGG + Intergenic
1007395497 6:41575541-41575563 TAGGGGGTGTAGGGGGAGGAAGG + Intronic
1007742384 6:44020807-44020829 GTGGGGCTCTGAAGGAAGGAAGG + Intergenic
1007776009 6:44224736-44224758 TTGGGAGTCTGGAGGCAGGGAGG + Intronic
1007845732 6:44754279-44754301 TTCGTGGTGTGGGGGGAGGAGGG + Intergenic
1007957400 6:45929990-45930012 CTGGGGGCTGGGAGGGAGGAAGG + Intronic
1008485726 6:52033341-52033363 TTGTGGGTGTGGGGGCAGGATGG - Intronic
1008668968 6:53747199-53747221 TTGGATGGCTGGAGGGAGTAAGG - Intergenic
1009047285 6:58247064-58247086 TTGGGGGTGGGGGGAGAGGAGGG + Intergenic
1009702629 6:67202707-67202729 TTGGGGGTGTGGAAGGTGGGTGG + Intergenic
1009892028 6:69696494-69696516 TTTAGGGGTTGGAGGGAGGAAGG - Intronic
1011268197 6:85548082-85548104 AGGGGGGGCTGGAGGGAGGAAGG + Intronic
1011682021 6:89792507-89792529 TGGGGGGTAAAGAGGGAGGAGGG + Intronic
1013078722 6:106793828-106793850 TCAAGGCTCTGGAGGGAGGAAGG - Intergenic
1013512371 6:110856766-110856788 TTCAGGCTCTGGAGGGAAGAAGG + Intronic
1013718694 6:112995738-112995760 GTCAGGGACTGGAGGGAGGAAGG - Intergenic
1014150203 6:118045652-118045674 ATGAGGTTCTGGAAGGAGGATGG + Intronic
1014561485 6:122896240-122896262 TTGTGGGGCTGGAGTGGGGAAGG + Intergenic
1014877560 6:126679406-126679428 TTTGGGGTTTGGGGGGGGGAGGG + Intergenic
1015276584 6:131388639-131388661 TTTGGAGTCAGGAGGAAGGAAGG - Intergenic
1015503033 6:133953032-133953054 TTGGGGACCAGGAAGGAGGAAGG + Intronic
1015522755 6:134147795-134147817 TTGGAGGACTGGAGTAAGGAAGG + Intergenic
1015667932 6:135652492-135652514 GTGGGGGGCTGGGGGGAGGGGGG - Intergenic
1016179045 6:141121063-141121085 TTAGGGGCCTGGAGCTAGGAGGG + Intergenic
1016400545 6:143675533-143675555 CTGGGGGTGAGGAGGCAGGAGGG - Intronic
1016631093 6:146232659-146232681 TTGGGGGGCTGGAGGGCAGGTGG - Intronic
1016995574 6:149960573-149960595 TGGGGGGTCAGGAGGAAGGGAGG - Intergenic
1017039590 6:150296913-150296935 TTGGGGGTCTGGTGGGTGCCTGG - Intergenic
1017065754 6:150527757-150527779 GTCGGGGGCTGGAGGGAGGCTGG - Intergenic
1017149537 6:151265976-151265998 TTGGGGGACTGGACTGATGATGG + Intronic
1017163913 6:151390767-151390789 TTGGGGGAGGGGAGGGAGGAGGG - Intronic
1017816694 6:158021538-158021560 TGGGAGGGCTGGAGGGAGGAGGG + Intronic
1018040373 6:159916327-159916349 GCCGGGGGCTGGAGGGAGGAGGG + Exonic
1018303264 6:162426553-162426575 TTGGGGATGAGGTGGGAGGATGG - Intronic
1018476061 6:164142934-164142956 GGGAGGGTCTGGAGGAAGGAAGG + Intergenic
1019040040 6:169096157-169096179 TGGGGGGTGAGGAGGGAGGAGGG - Intergenic
1019286976 7:228527-228549 TGGGGGCTGTGGAGGGTGGAAGG + Exonic
1019374381 7:681577-681599 CTGGAGGTCTGCTGGGAGGAGGG + Intronic
1019407973 7:893824-893846 TTGGGGCTGGGGAGGGAGGAGGG + Intronic
1019455417 7:1124309-1124331 GTGGGGATCTGGCTGGAGGAGGG + Intronic
1019486035 7:1289576-1289598 CTGTGGGTTTGGAGGGTGGAAGG - Intergenic
1019538594 7:1541353-1541375 TTGGGGGCCTGGCGAGGGGAAGG + Exonic
1019571827 7:1716434-1716456 CTAAGGCTCTGGAGGGAGGATGG - Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1019772935 7:2895051-2895073 ATCTGGGTCTGCAGGGAGGAGGG + Intergenic
1019890290 7:3941021-3941043 TGGTGGGTCAGGAGGGAGAAGGG - Intronic
1020278062 7:6636840-6636862 TTGTGGGTGGGGAGGGAGGAGGG - Intergenic
1020732041 7:11892618-11892640 TCTGGTGTCTGGAGGGAGGCAGG - Intergenic
1020985988 7:15134753-15134775 TTGGGGTTTTTGAGGAAGGAAGG + Intergenic
1021196464 7:17679713-17679735 TTGGGGCGCAGGAGGGAGGAGGG + Intergenic
1021545815 7:21812050-21812072 TTGGGGGAATTGGGGGAGGAAGG - Intronic
1021617728 7:22520158-22520180 TCTGGGGTCTGGAGGATGGATGG - Intronic
1021673950 7:23061694-23061716 TTGGGGGGGGGGTGGGAGGAGGG + Intergenic
1021820435 7:24492775-24492797 TTGGGGGTGGGGAGAGAGGTTGG - Intergenic
1021841117 7:24722755-24722777 TGGGGGTTCTGGAGGGAGGTGGG - Intronic
1022091146 7:27108794-27108816 TTTGGGGCCTGGTGGAAGGAGGG - Intronic
1022103191 7:27181081-27181103 TTGGGGGGGTGGGGGGAGGGGGG + Intergenic
1022253891 7:28636273-28636295 CTGGGGGGTGGGAGGGAGGAGGG + Intronic
1022393014 7:29959951-29959973 GTGGGGGGAGGGAGGGAGGAGGG + Intronic
1022472627 7:30691085-30691107 TTGGGGGGCTGGGGAGGGGAGGG + Intronic
1022505875 7:30908417-30908439 TTGGGGGTGGGGAGGGAGGGAGG - Intergenic
1022510287 7:30930971-30930993 CTGGGGGTCTGGTGGGAGGCTGG + Intergenic
1022704219 7:32787727-32787749 TTGGGGGTCTGGGAAGGGGATGG + Intergenic
1022908402 7:34877469-34877491 TTGGGGGTCTGGGAAGGGGATGG + Intronic
1023736697 7:43241914-43241936 TGGGGGGTGTGGAGGAAGAAGGG + Intronic
1024254292 7:47528288-47528310 CTGGGGGTCTGCAGGGAAGGAGG + Intronic
1024636229 7:51292710-51292732 TCTGGAGTGTGGAGGGAGGAGGG - Intronic
1024843352 7:53613749-53613771 ATGGGGGTGTGGAGGGAGTGAGG + Intergenic
1025029862 7:55548330-55548352 ATTGGGGTCTGCTGGGAGGAGGG - Intronic
1025581771 7:62728740-62728762 TTGGGGGGGTGGGGGGAGGGGGG - Intergenic
1025844769 7:65186219-65186241 TTGGGGGTGTGGGTGGAGTAGGG + Intergenic
1025895097 7:65692552-65692574 TTGGGGGTGTGGGTGGAGTAGGG + Intergenic
1026094720 7:67335742-67335764 TAGGGGGTCGGGAGGGGGGAGGG + Intergenic
1026361067 7:69600591-69600613 TTGGGAGAAAGGAGGGAGGAGGG + Intronic
1027971264 7:85084757-85084779 TTTGGAGTGTGGAGGGTGGAAGG - Intronic
1028399625 7:90410703-90410725 TTGTGGGGGTGGAAGGAGGAGGG + Intronic
1028504664 7:91557857-91557879 TTGGGGGTGGGTGGGGAGGAGGG - Intergenic
1028606574 7:92662312-92662334 TTGGGGGTGTGGAAGTAGGTTGG + Intronic
1029200039 7:98833321-98833343 TGGGGAGGATGGAGGGAGGAGGG + Intergenic
1029797649 7:102911924-102911946 TGGGTGGTCTGGAGGGAGTTGGG - Intronic
1029854075 7:103495659-103495681 TTTGGGGCCTCGAGGGAGAATGG - Intronic
1029870982 7:103692494-103692516 TTGGGGGTGGTGAGTGAGGAGGG + Intronic
1029998298 7:105031361-105031383 TTGGGGGGGTGGTGGGAGGGTGG + Intronic
1030709761 7:112736455-112736477 TTGGGTGTGGGGAGGGGGGAAGG - Intergenic
1031945589 7:127836327-127836349 TTTGGGGTTTGGGGGTAGGATGG + Intronic
1032068821 7:128791605-128791627 CTGGGGGTCTGGAAGGAGGAGGG - Intronic
1032502230 7:132408849-132408871 GTGGGGGGCGGGAGGGAGGCAGG - Intronic
1032540124 7:132695883-132695905 TGGGGTGTGGGGAGGGAGGAGGG + Intronic
1033036323 7:137879330-137879352 GTGGAAGTGTGGAGGGAGGAGGG + Exonic
1033116824 7:138632710-138632732 AGGGGGTTGTGGAGGGAGGATGG + Intronic
1033174783 7:139113964-139113986 CTGAGGCTCTGCAGGGAGGAAGG + Intergenic
1033345123 7:140520433-140520455 GTGGAGGTGTGGAGGGAGGATGG + Intronic
1033480581 7:141736341-141736363 GTGGGGGGCTGGAGGGAAGGTGG - Intergenic
1033928913 7:146499587-146499609 TTCGGGGTGTGGGGGGAGGAAGG - Intronic
1034203081 7:149294525-149294547 CGGGGGGCCTGGAGGGAGGGAGG - Intronic
1034366680 7:150555753-150555775 TTGAGGGGCTTGATGGAGGATGG - Intergenic
1034426416 7:151016562-151016584 TCTGGGGTGTGGCGGGAGGAGGG - Intronic
1034429385 7:151033673-151033695 TAGGGGGGCTCGAGGGAGGTGGG - Exonic
1034436357 7:151064511-151064533 GCGGTGGTCTGCAGGGAGGAGGG - Exonic
1034584422 7:152076552-152076574 CTGGGGGTTTGGAGGGAGGCTGG + Intronic
1034708807 7:153172384-153172406 TTGGGGGGCTGGGGTGAGGCTGG + Intergenic
1034994837 7:155571037-155571059 GTGGGGGTGGGGAGGGAGGTGGG - Intergenic
1036048797 8:5172969-5172991 ATGAGTGTCTGGAGGGAGAAGGG - Intergenic
1036051093 8:5197701-5197723 GTGGTGGGGTGGAGGGAGGACGG + Intergenic
1036401627 8:8413837-8413859 CTGGGTGCCTGGGGGGAGGAGGG + Intergenic
1036776681 8:11617666-11617688 TTGGGGGTGTGGGAGGAAGAGGG - Intergenic
1037292176 8:17362655-17362677 TTAGGGGCCTGGAACGAGGAAGG - Intronic
1037521054 8:19681176-19681198 TGGGGGCTCTGCAGGGAGGTGGG - Intronic
1037674668 8:21043194-21043216 TTGGAGGTCGGGGGGGAGGTGGG - Intergenic
1037767850 8:21782851-21782873 TCGGGGCCCTGCAGGGAGGAAGG + Exonic
1037768967 8:21788025-21788047 GTGGGGGGCTGGCGGGAGGTCGG - Intronic
1038067074 8:23974369-23974391 GTGGGGGAGGGGAGGGAGGAGGG + Intergenic
1038164229 8:25069268-25069290 TGGAGGGTCAGGAGGGAGGAAGG - Intergenic
1038271766 8:26081403-26081425 TTTGGGGACTGGAGGGAGGAGGG - Intergenic
1038319636 8:26514693-26514715 TTGGGGGTGGAGACGGAGGACGG + Intronic
1038426437 8:27467195-27467217 TTGGGGTCCTGGGGGGATGAGGG - Intronic
1038491929 8:27977628-27977650 CTGGGGGTTTTTAGGGAGGAAGG - Intronic
1038836798 8:31135003-31135025 TGGGGGGGCTTGGGGGAGGACGG - Intronic
1039870350 8:41540490-41540512 TGGAGGGTGTGGAGAGAGGAGGG + Intronic
1040090234 8:43391216-43391238 TGGGGTGTGGGGAGGGAGGAGGG - Intergenic
1041916139 8:63141031-63141053 TTGGGAGGGTGGAGGGTGGAAGG + Intergenic
1041987613 8:63944272-63944294 TTGGGGTTCTTGAAGAAGGAAGG - Intergenic
1042040347 8:64582127-64582149 TTTGGGGTGGGGAGGGAGGGAGG + Exonic
1043130611 8:76456144-76456166 TTGGGGGTGTGGGGTGAGGAAGG + Intergenic
1043162358 8:76861917-76861939 ATGGAGGTCTGGTGGGCGGAAGG - Intronic
1043287402 8:78550818-78550840 TTTGGGGTCTTGAGGGAGAAAGG - Intronic
1043471276 8:80565804-80565826 TTGGGGGGCGGGAGCGGGGACGG - Intergenic
1044392562 8:91669143-91669165 CTGGGCGTGTGGAGGGAGGAAGG - Intergenic
1044396356 8:91717522-91717544 TCTGGGAGCTGGAGGGAGGAAGG + Intergenic
1044768509 8:95603853-95603875 TTAGGGATGGGGAGGGAGGAAGG - Intergenic
1045035490 8:98173445-98173467 ATGGCTGACTGGAGGGAGGAAGG + Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046165692 8:110431979-110432001 TAGAGCCTCTGGAGGGAGGATGG - Intergenic
1046791449 8:118326601-118326623 TTGGGGGGCTAGAGGGAGGATGG - Intronic
1046832973 8:118767028-118767050 TCTGGGGTTTTGAGGGAGGAAGG - Intergenic
1047032168 8:120894163-120894185 TTGGGGGCAGGGAGGAAGGAGGG - Intergenic
1047204097 8:122789553-122789575 GTGGTGGTCCGGAGGGAGTAGGG + Intronic
1047521816 8:125600758-125600780 TTGGGGAGCAGAAGGGAGGAGGG + Intergenic
1047676823 8:127211844-127211866 TTGGGGGAGTTGAGTGAGGAGGG - Intergenic
1048060359 8:130913320-130913342 TGGGGGGTTAGGAGGGAGGTGGG - Intronic
1048148303 8:131867491-131867513 CTGTGGGCTTGGAGGGAGGAAGG - Intergenic
1048336086 8:133503516-133503538 GTGGGGGGCTGGACGGAGGGAGG - Intronic
1048440903 8:134458380-134458402 CTGGGAGGCTGGAGGGAGGAGGG + Intergenic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1049254125 8:141604908-141604930 CAGAGGGTCTGGAGTGAGGAGGG + Intergenic
1049392995 8:142381604-142381626 TGAGGGGTCTGGAGTGAGGCAGG + Intronic
1049427061 8:142542411-142542433 CTGGGGGGCTGGCGGGAGGGCGG - Exonic
1049482749 8:142834727-142834749 TTGAGGGTCCGGAAGGAGGGCGG + Intronic
1049640171 8:143711791-143711813 CTGGGGGGCAGGAGGGAGGCTGG - Intronic
1049850078 8:144826328-144826350 CTGGGGGTCTGGAGGGCGGCTGG + Intergenic
1049850830 8:144829262-144829284 TTGAGGCTCTTGAGGGGGGAGGG + Intronic
1050061963 9:1718852-1718874 TGGGAAGTCTGGAGGGAGAAAGG - Intergenic
1050105281 9:2158898-2158920 TTTGGGGTCTTTGGGGAGGAGGG + Intronic
1050190906 9:3024973-3024995 TTAGGGGAATGGAGGGAGTATGG - Intergenic
1050325185 9:4491142-4491164 CTGGGGGTGTGGGGTGAGGAAGG - Intronic
1050464768 9:5910579-5910601 TGGGGGTTCTGGAGGGATGTAGG - Exonic
1051306982 9:15720830-15720852 TGGGGTGGGTGGAGGGAGGAGGG - Intronic
1051782411 9:20703935-20703957 TTTGGGGGCTAAAGGGAGGAGGG - Intronic
1052563540 9:30116850-30116872 TAGGGGGTGGGGAGGTAGGAGGG + Intergenic
1052821184 9:33138922-33138944 TTGGGGTTGGGGAGAGAGGAGGG - Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1053526668 9:38837169-38837191 TTTGGAGGCTGGAGGGAGGGCGG + Intergenic
1054825330 9:69567564-69567586 GTGGGGTTGTGGAGGGGGGAGGG - Intronic
1054865868 9:70000290-70000312 GTGGGAGGCTGGAGGGAGGTGGG + Intergenic
1056102068 9:83309186-83309208 TTGTGGGGGTGGGGGGAGGAGGG + Intronic
1056490247 9:87099110-87099132 TTGGAGGTTGGGTGGGAGGAGGG + Intergenic
1056590220 9:87961001-87961023 AGTGGGGACTGGAGGGAGGATGG - Intergenic
1056883387 9:90417780-90417802 TGGGGGGTATGGAGAGAGAATGG - Intergenic
1057009596 9:91589725-91589747 TTGGCGCTGTGGAGGGAGCAGGG + Intronic
1057077240 9:92144393-92144415 TTGGGGATCGGGAGGGAAGGTGG + Intergenic
1057206678 9:93177766-93177788 ATGGGGGTCTGGAGTGCAGAGGG - Intergenic
1057271075 9:93651817-93651839 TTGAGGGTGTGGTGGGAGGCAGG + Intronic
1057307435 9:93920459-93920481 CTGGGGGTCAGGAGTGAAGAAGG + Intergenic
1057337518 9:94166884-94166906 TTGGGGGTTGGGATGAAGGAGGG + Intergenic
1057691599 9:97291268-97291290 CAGGGTGTCTGGCGGGAGGAGGG + Intergenic
1057804814 9:98212460-98212482 TTGGGGGCCCAAAGGGAGGAAGG - Intronic
1058017247 9:100048171-100048193 TTGGGTGGGTGGAGGGGGGAGGG + Intronic
1058041797 9:100310678-100310700 TTGGGAGTCTTGAGGTAGGTGGG - Intronic
1058112567 9:101046967-101046989 TTGGGGGTCGGGGGAGAAGAGGG + Intronic
1058121509 9:101144263-101144285 TTGGGGGTGGGGAGCGGGGAGGG + Intronic
1059396132 9:114035252-114035274 TTGGGGGGCTGGAGAGGGCAAGG + Intronic
1059487991 9:114642190-114642212 TTGAGGGTGGGGAGGAAGGAGGG - Intronic
1059652492 9:116327822-116327844 CTGGGGAACTGGAGGGAGGCTGG - Intronic
1059714919 9:116904937-116904959 TTGGGGGTGCGGAGGGTGGAAGG - Intronic
1060060913 9:120458671-120458693 TGGGGTGTGTGGAGAGAGGATGG + Intronic
1060214835 9:121732499-121732521 TGGCTGGTCTGGAGGGAGAAGGG + Intronic
1060229953 9:121819029-121819051 TTGGGGGACTGGACAGAGGCTGG + Intergenic
1060401908 9:123354382-123354404 ATGGGGGGCTGGGGGGAGCACGG - Intergenic
1060404091 9:123364556-123364578 GTGGGGATGGGGAGGGAGGAGGG + Intronic
1060946888 9:127574969-127574991 ATGGGGGGCTGGAGGCAGGGAGG - Intronic
1060975363 9:127762042-127762064 ATGGGGGTGGGGTGGGAGGAGGG - Intronic
1061244587 9:129394901-129394923 TTGGGGGTCTGCTGGGCAGAGGG - Intergenic
1061296871 9:129681679-129681701 TTTGGGGGGTGGAGGGAGGGCGG - Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061407150 9:130398646-130398668 CTGGTGGTCTGGTGGAAGGACGG + Intronic
1061511323 9:131062908-131062930 ATCAGGGGCTGGAGGGAGGAAGG - Intronic
1061627009 9:131846678-131846700 TTAGGGGAGTGGTGGGAGGAGGG - Intergenic
1061724477 9:132574443-132574465 TTGGGAGATTGGAGGGATGAAGG - Intergenic
1061779534 9:132987500-132987522 TTGGGGCCCTGGAGTCAGGAAGG + Intronic
1061779748 9:132988564-132988586 TTGGGGCTCTGGTGGGATTAAGG + Intronic
1061860834 9:133468061-133468083 TTCGGGGGGCGGAGGGAGGAAGG - Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061972499 9:134052629-134052651 CTTGGGGTCTGGAGAGAGGTTGG - Intronic
1062036606 9:134385321-134385343 TTGTGTGGCTGGAGGGAGGCTGG + Intronic
1062048495 9:134435381-134435403 TGGGGGGGCGGGAGGGAGGGGGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062284613 9:135767558-135767580 TTGGGGTGCAGGAGGGAGGGGGG - Intronic
1062343296 9:136103385-136103407 CTGGGGGTCTCGAGGGACGGAGG - Intergenic
1062388441 9:136324497-136324519 CTGGGGCTCTGGACGGAGGTGGG - Intergenic
1062448649 9:136606394-136606416 CTGGGCGTCTGCAGGGCGGAGGG - Intergenic
1062567758 9:137170829-137170851 GTGAGGGCCTGCAGGGAGGACGG + Intronic
1062588704 9:137263429-137263451 TTGGGGGGAAGGAGGGAGGGAGG - Intronic
1203634001 Un_KI270750v1:94891-94913 CTGGGGATCTGCAGGGAGGTCGG + Intergenic
1185577561 X:1185897-1185919 TTGGGGGGCAGGATGGAGGGGGG + Intergenic
1185583090 X:1226126-1226148 ATGGGTGGGTGGAGGGAGGAAGG + Intergenic
1186214087 X:7280624-7280646 TTGGGGGTCAGGTGGAAGGATGG + Intronic
1186673668 X:11793482-11793504 TTGGGGGACAAGAGGGAGGCAGG - Intergenic
1187682248 X:21779108-21779130 TTGGGGGTATGAAGGAAGTAGGG - Intergenic
1188213273 X:27448089-27448111 TGGGGCCTCTGGAGGGAGTATGG - Intergenic
1188297149 X:28463356-28463378 TTGGAAGTCTAGAGGGCGGAAGG + Intergenic
1188542445 X:31265774-31265796 TTGGGGGTGTGGGGGGGGGGGGG + Intronic
1188977626 X:36694055-36694077 GTGGGGGCCTGGCGGGAGGTGGG + Intergenic
1190322691 X:49187911-49187933 GTAGGGGTCTGGAGGGGAGAAGG + Exonic
1190322724 X:49188051-49188073 GTGGAGGTGTGGAGGGAGGGAGG + Exonic
1192156943 X:68753692-68753714 CTGGGGGCCTGCAAGGAGGAGGG + Intergenic
1192175231 X:68881036-68881058 GTAGGGGTTTGGAGAGAGGAGGG - Intergenic
1192488355 X:71550892-71550914 TTGGGGGGGTGGAGGAGGGATGG + Intronic
1193516985 X:82478261-82478283 CTGAGGATCTGGAGGGAGGCAGG - Intergenic
1194282406 X:91969555-91969577 TTGGGAGTCTGAAGGTGGGAGGG + Intronic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194668907 X:96706524-96706546 TTGGGGATCTGGATGGGAGAAGG + Intronic
1195505844 X:105656094-105656116 TGGGGGGTTGGGAGGGAGGTAGG - Intronic
1195766601 X:108302989-108303011 TTGGGGGGGTGGAGGGGGGAGGG - Intronic
1196274565 X:113751923-113751945 TTAGAGAACTGGAGGGAGGAAGG - Intergenic
1196290179 X:113930623-113930645 TACGGGGGCTGGAGGAAGGAGGG - Intergenic
1196554455 X:117070503-117070525 ATGGTGGTGTGGTGGGAGGAGGG - Intergenic
1196711037 X:118763022-118763044 TGGGGGCTGTGGTGGGAGGAGGG + Intronic
1196767609 X:119262393-119262415 TTGGAGGTAGGGAGGGAGGTAGG + Intergenic
1196923397 X:120607787-120607809 TTGGGGAAGTGGGGGGAGGAAGG - Intronic
1197402262 X:126006394-126006416 TGGAGCGTCTGGAGGGAGCAGGG + Intergenic
1197969187 X:132097119-132097141 GTGAGGATCTGGAGAGAGGATGG - Intronic
1198117336 X:133556768-133556790 TTGGGGGGGTGGGGGGAGGGGGG + Intronic
1199317058 X:146393471-146393493 TGGGGGGGAGGGAGGGAGGAAGG - Intergenic
1199325910 X:146497989-146498011 TTGGGGGGTTGGGGGGAGGTGGG + Intergenic
1199590354 X:149462165-149462187 TGGGGTGTCTGGAGGAAGGAAGG - Intergenic
1199617744 X:149671374-149671396 TTGGGGAAGTGGATGGAGGAGGG + Intergenic
1199624898 X:149731875-149731897 TTGGGGAAGTGGATGGAGGAGGG - Intergenic
1199737062 X:150694130-150694152 TGGGGGGTTGGGAGTGAGGACGG + Intronic
1199769970 X:150969094-150969116 CTGGGGACCTGGAGGGAGGTGGG - Intergenic
1199795924 X:151196761-151196783 GTGGGGGTCAGGTGGGGGGATGG - Intergenic
1200599995 Y:5194192-5194214 TTGGGAGTCTGAAGGTGGGAGGG + Intronic
1201438646 Y:13985638-13985660 TGGTGGGTGGGGAGGGAGGAAGG - Intergenic
1201445927 Y:14057070-14057092 TGGTGGGTGGGGAGGGAGGAAGG + Intergenic