ID: 916237061

View in Genome Browser
Species Human (GRCh38)
Location 1:162600605-162600627
Sequence TAGGATGTCATTCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916237055_916237061 -1 Left 916237055 1:162600583-162600605 CCGCTAACAAGTTGTCACAAGAT 0: 1
1: 0
2: 0
3: 6
4: 106
Right 916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916237061 Original CRISPR TAGGATGTCATTCATGGGGT GGG Intergenic
900848750 1:5125286-5125308 TAGGATCTGATTGATGGGTTGGG + Intergenic
900933738 1:5752612-5752634 TAGGAGGCCATGAATGGGGTGGG + Intergenic
903590992 1:24455882-24455904 TAGGATTACCTTCAGGGGGTTGG + Intronic
904744017 1:32700075-32700097 TAGGATGTCAAGCATTGGGTGGG - Intronic
916237061 1:162600605-162600627 TAGGATGTCATTCATGGGGTGGG + Intergenic
917699211 1:177563190-177563212 TAGGAAGACATTCATGAGATAGG + Intergenic
921103353 1:211951072-211951094 TAGGATGTCATTAAAGAGTTAGG - Intronic
921622625 1:217342826-217342848 CAGAATATCATTCATGGGGATGG - Intergenic
1062944276 10:1448887-1448909 TGAGATGTCAGTCATGGGGTCGG - Intronic
1063406555 10:5801378-5801400 AAGGATGTCCTTGATAGGGTGGG + Intronic
1063968553 10:11365303-11365325 TAGGAGCTGATTCATGGTGTAGG + Intergenic
1067708680 10:48630383-48630405 TAAGATGTCATTTCTGGGCTGGG - Intronic
1077336860 11:2009176-2009198 GAGGATGTCATGCATGGTGTTGG + Intergenic
1078897879 11:15613959-15613981 TAGTATTTACTTCATGGGGTTGG + Intergenic
1079433490 11:20420838-20420860 TAGGATCTCCTTTATGGTGTTGG - Intronic
1083721473 11:64605776-64605798 GAGGAGGTCATTCCTGGGCTTGG - Intergenic
1085218857 11:74855836-74855858 TAAAACATCATTCATGGGGTCGG + Intronic
1086614504 11:88799992-88800014 TAGGACCTCATTCATGATGTTGG - Intronic
1091143619 11:133258209-133258231 CTGGATGTCGTTCATGGGCTAGG - Intronic
1202819844 11_KI270721v1_random:64358-64380 GAGGATGTCATGCATGGTGTTGG + Intergenic
1092116318 12:6011128-6011150 GAGCATGTCATCCATGGGCTGGG - Intronic
1093559654 12:20522905-20522927 GAGTATGCCATTCATGGGGAAGG + Intronic
1102007656 12:109598668-109598690 CAGGATGTCACTCCTGGGGCAGG + Intergenic
1103357495 12:120332478-120332500 TAGGAAGGCTTTCATGGGCTGGG - Intergenic
1103943856 12:124515431-124515453 CAGGATGTTATTCTTGGGGGAGG - Intronic
1106817580 13:33425850-33425872 GATGATGTCATTCATGGTATTGG + Intergenic
1108207463 13:48105243-48105265 CAGAATGTCATTCAATGGGTTGG + Intergenic
1112223570 13:97515144-97515166 TGGGATGTCATTCATGACTTGGG + Intergenic
1113089323 13:106600396-106600418 CAGGATGACCTTCATGGGCTTGG - Intergenic
1114793183 14:25682038-25682060 GATGATTTCCTTCATGGGGTGGG - Intergenic
1118043104 14:61938450-61938472 TAGGAAGGCATTCTTGGGGAGGG + Intergenic
1118175886 14:63439763-63439785 TAGGATGTCCATCATGGAGATGG + Intronic
1119119729 14:72063425-72063447 TATCATGTCATTGATTGGGTGGG + Intronic
1120474705 14:84972671-84972693 TAGAATGTCACCCATGGGGACGG - Intergenic
1120813545 14:88829554-88829576 TATGCTTTCATTAATGGGGTAGG + Intronic
1122289155 14:100670446-100670468 CAGGATGCCAGGCATGGGGTAGG - Intergenic
1122463573 14:101916014-101916036 TGGGGTGTCAGTTATGGGGTGGG + Intronic
1132133417 15:99307348-99307370 TTGGATGGCATTTATGGGATGGG - Intronic
1143997710 17:11022244-11022266 AAGCAGGTCATCCATGGGGTTGG + Intergenic
1144965469 17:19074807-19074829 TTGGATTTCATTCTGGGGGTTGG - Intergenic
1144982498 17:19177376-19177398 TTGGATTTCATTCTGGGGGTTGG + Intergenic
1144985725 17:19200863-19200885 TTGGATTTCATTCTGGGGGTTGG - Intergenic
1148371617 17:47103945-47103967 TAGGATTTCAGTCATGGAGCTGG + Intergenic
1150268593 17:63847821-63847843 ATGGATGTCCTTCAGGGGGTTGG + Intergenic
1152003373 17:77661578-77661600 TAGGATTTAATTCTTGGGCTGGG + Intergenic
1152372070 17:79894899-79894921 TAGGATGTGAGTCTTGAGGTGGG + Intergenic
1152455908 17:80415928-80415950 TAGGATGTCATTAATAGTCTGGG + Intronic
1154943941 18:21142204-21142226 TAGGATGGCATTTAGGGAGTGGG - Intergenic
1156724451 18:40111267-40111289 GATAATGTCATTCCTGGGGTTGG + Intergenic
1156802089 18:41128127-41128149 TAGGATGACATTCATGGTACTGG + Intergenic
1160012435 18:75116309-75116331 GAGGATGTTATTCAGAGGGTGGG - Intergenic
1160440130 18:78883475-78883497 TAGGGTGTCCTTCATGGATTGGG - Intergenic
1163837097 19:19581717-19581739 TGGGCTGGCATTCTTGGGGTTGG - Intronic
1163988490 19:20975145-20975167 CAGCATGTGATACATGGGGTAGG - Intergenic
1166737739 19:45096160-45096182 GAGGAGTTCATGCATGGGGTGGG + Intronic
1168501619 19:56897977-56897999 AAGGATGTCCTTCTTGGGATCGG + Intergenic
927378288 2:22445133-22445155 TAGGATGTCAATTATGGGTGTGG - Intergenic
929502698 2:42503901-42503923 AAGAATGTGGTTCATGGGGTTGG - Intronic
931801226 2:65760124-65760146 TAGGATGACATTAATGAAGTTGG + Intergenic
932460054 2:71876221-71876243 AAGGATGTCAATCTTGGGGAGGG + Intergenic
934312310 2:91878448-91878470 TAGGATTTAATTTATGAGGTGGG - Intergenic
934976454 2:98806087-98806109 TAGTATATCCATCATGGGGTGGG + Intronic
937175725 2:119932355-119932377 TAGGATTTGATTCATGGTTTGGG + Intronic
937219455 2:120333413-120333435 GAGGATGCCATTCACGGGGCAGG - Intergenic
943553130 2:189366259-189366281 AATGTTGTCATTAATGGGGTGGG - Intergenic
944058920 2:195551453-195551475 TTCGAAGTCATTCATGGGGATGG + Intergenic
1169107469 20:3009239-3009261 TGGGATGTCATTGATGGGGGTGG + Intronic
1169625590 20:7564983-7565005 TAGGATATCAGTCAGGGTGTTGG + Intergenic
1175280012 20:57797102-57797124 AAGGATGTCATCTGTGGGGTGGG - Intergenic
1182178562 22:28319540-28319562 TGGGATGTCAATAATGGGGGAGG + Intronic
952700237 3:36320015-36320037 TAGGATGTGACTGAGGGGGTGGG + Intergenic
954971160 3:54652743-54652765 TGGGATGTGATCCAAGGGGTTGG + Intronic
955849059 3:63199973-63199995 TAGTATCTAATTTATGGGGTTGG - Intergenic
962373057 3:134837085-134837107 TAGCTAGTCATTCATGCGGTTGG + Intronic
965024229 3:163278258-163278280 GAGGATGTCTTTTATGTGGTAGG - Intergenic
976409737 4:84699730-84699752 TAGGATGACCATAATGGGGTGGG - Intronic
978405559 4:108375220-108375242 TAGTATGTCAGGCATGGTGTAGG + Intergenic
979408187 4:120340689-120340711 TAGGGTTTAAGTCATGGGGTGGG + Intergenic
980840889 4:138260040-138260062 TAGGCTGTCATTAATGGTGATGG - Intergenic
982297007 4:153839449-153839471 TAAGATTTGATTCATGGCGTAGG - Intergenic
984631250 4:182063912-182063934 AAGGAAGGCATTCATGGAGTTGG + Intergenic
990413092 5:55560805-55560827 GAGGGTGCCAGTCATGGGGTGGG - Intergenic
999621622 5:153480257-153480279 TTGGATGTCCTTCAAGGGGTGGG - Intergenic
1005079962 6:21946900-21946922 TTGGTTGTCATGAATGGGGTAGG + Intergenic
1008227607 6:48940547-48940569 GAAGATGTCATTCATAGAGTAGG + Intergenic
1018242152 6:161788227-161788249 CAGGATGTCATTAATAGAGTAGG - Intronic
1020193246 7:6016866-6016888 AAGGCTGTCATGCATGGGTTTGG + Intronic
1030301822 7:107981837-107981859 TTGGATGTCATTTAAGCGGTGGG - Intronic
1031308274 7:120161592-120161614 TAGGATGGCATACCTGGGGAGGG - Intergenic
1034498163 7:151434056-151434078 TAGGAGGCCTTTCCTGGGGTCGG - Intronic
1035145226 7:156809192-156809214 CAGGTTGTCCTTCATGTGGTAGG - Intronic
1036563903 8:9921753-9921775 TGGGATGACATTCACGGGGGTGG + Intergenic
1038327413 8:26582378-26582400 TAGAATGTCATTGTTTGGGTTGG + Intronic
1040345288 8:46486570-46486592 AAGGATGTAATCCATGGGTTTGG - Intergenic
1040777326 8:51061786-51061808 AGGCATGTCATTCATGGGATGGG - Intergenic
1050319478 9:4436484-4436506 TAAGATGTCATTGATGGGGATGG - Intergenic
1050394563 9:5181270-5181292 TAGGATGTCATTTATCTGGCAGG - Intronic
1051509677 9:17863585-17863607 CAGGATGTCCTTCATGGAGCAGG + Intergenic
1052834092 9:33237579-33237601 TGGGAGGTCATTCATGGTGATGG - Intronic
1057934924 9:99229226-99229248 TAGGAAGTAATTCTTGGGGTTGG + Intronic
1203784340 EBV:119062-119084 TATTATGTCTTTGATGGGGTGGG - Intergenic
1201716238 Y:17046924-17046946 AAGGGTGTCATTCACAGGGTAGG + Intergenic