ID: 916242050 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:162650082-162650104 |
| Sequence | GATTAAGTGATCCAGGAGGA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 227 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 21, 4: 204} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 916242050_916242053 | 26 | Left | 916242050 | 1:162650082-162650104 | CCTTCCTCCTGGATCACTTAATC | 0: 1 1: 1 2: 0 3: 21 4: 204 |
||
| Right | 916242053 | 1:162650131-162650153 | ATGTAGTTGAAGTTCAAATGTGG | 0: 1 1: 0 2: 1 3: 19 4: 246 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 916242050 | Original CRISPR | GATTAAGTGATCCAGGAGGA AGG (reversed) | Intronic | ||