ID: 916242050

View in Genome Browser
Species Human (GRCh38)
Location 1:162650082-162650104
Sequence GATTAAGTGATCCAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916242050_916242053 26 Left 916242050 1:162650082-162650104 CCTTCCTCCTGGATCACTTAATC 0: 1
1: 1
2: 0
3: 21
4: 204
Right 916242053 1:162650131-162650153 ATGTAGTTGAAGTTCAAATGTGG 0: 1
1: 0
2: 1
3: 19
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916242050 Original CRISPR GATTAAGTGATCCAGGAGGA AGG (reversed) Intronic