ID: 916242340

View in Genome Browser
Species Human (GRCh38)
Location 1:162652638-162652660
Sequence CTGAGTACCCACTATGTGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1616
Summary {0: 1, 1: 1, 2: 30, 3: 246, 4: 1338}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916242340 Original CRISPR CTGAGTACCCACTATGTGGT AGG Intronic
900009029 1:89128-89150 CTGAGCACCTACTATGTGCCAGG - Intergenic
900916080 1:5639599-5639621 TTGAGCACCTACTATGTGCTGGG + Intergenic
901024527 1:6272074-6272096 CTGAGTGCCCACTGTGGGCTAGG + Intronic
901046530 1:6399510-6399532 TTGAGTACCTACTATGTGCTAGG - Intergenic
901119369 1:6877937-6877959 CTGAGTATCTACTATGTGCAAGG - Intronic
901689901 1:10965981-10966003 CTGAGTACCTACTGTGTGCCAGG + Intronic
901788485 1:11640422-11640444 CTGAGCACTCACCATGTGATAGG - Intergenic
901876467 1:12169569-12169591 CTGAGAACCCACTGTGTGTGAGG - Intronic
901885581 1:12220631-12220653 CTGAGCACCTACTATGTGCCTGG - Intergenic
901893387 1:12287412-12287434 TTGAGTACCTACTTTGTGGCAGG + Intronic
902178746 1:14671334-14671356 CTGAGCACCTACTATGTGCCAGG - Intronic
902256000 1:15188997-15189019 CTGAGTGCCCTCTATGAGCTGGG - Intronic
902404362 1:16174820-16174842 CCGAGAACCTACTATGTGCTGGG - Intergenic
902520837 1:17015000-17015022 TTGAGTACCTACTATGTGAAAGG - Intergenic
902604450 1:17561141-17561163 CTGAGCACCTACTACGTGCTGGG - Intronic
902667185 1:17947844-17947866 CTGAGTACTTACTATGTAGCAGG - Intergenic
902723440 1:18319990-18320012 CTGAGTACCTACTATGTACCAGG - Intronic
902772313 1:18652313-18652335 TTGAGAACCCACTATGTGCCAGG + Intronic
902820729 1:18941738-18941760 CTGAGGTCTCACTATGAGGTAGG - Intronic
902846662 1:19116139-19116161 CTGAGTACTTACTATGTACTAGG + Intronic
902937945 1:19778182-19778204 TTGAGTGCCTACTATGTGCTAGG + Intronic
902939163 1:19787321-19787343 CTGAGCACTCACCATGTGCTGGG + Intronic
902957113 1:19933302-19933324 TTGAGGACCTAGTATGTGGTGGG + Intergenic
902996788 1:20231865-20231887 TTGAGTACCCACTATATGGTTGG - Intergenic
903139164 1:21328374-21328396 CTGAGGACCCACTATGTGCCAGG - Intronic
903144898 1:21365045-21365067 CTGAGCACCTACTATGTGCCAGG - Intergenic
903183273 1:21615805-21615827 CTGAGTACCAACCATGTGTTTGG + Intronic
903227857 1:21904040-21904062 CGGGGTACCTACTATGTGCTGGG + Intronic
903268962 1:22176035-22176057 CTGAGCACCTACTATGTGCCGGG - Intergenic
903354579 1:22738732-22738754 CTGAGGACCAACTATGTGCCTGG + Intronic
903371775 1:22841070-22841092 TTGAGAACCTGCTATGTGGTGGG - Intronic
903685661 1:25130031-25130053 CTGAGTACTCACTATGTGCTAGG + Intergenic
903770403 1:25760164-25760186 CTGAGCACCCGCTATGTGCTGGG + Intronic
903994827 1:27299209-27299231 CTGAGCTCCTACTATGTGCTAGG + Intronic
904258043 1:29269449-29269471 CTGAATGCCCACTTTGTGCTGGG + Intronic
904295160 1:29515543-29515565 TTGGGTACCTACTATGTGTTAGG - Intergenic
904295219 1:29515878-29515900 TTGGGTACCTACTATGTGCTAGG + Intergenic
904296712 1:29524185-29524207 CTGAGCACCCACTGTGTGTGAGG + Intergenic
904321473 1:29700276-29700298 CTGTGTACCTACTATGTGCCCGG - Intergenic
904325533 1:29725306-29725328 CTGAGCACCTACTATGTGCCAGG + Intergenic
904338347 1:29812370-29812392 CTGAGCACCTACTATGTGCCAGG - Intergenic
904342587 1:29846463-29846485 CTGAGCACCTACTATGTGCCAGG + Intergenic
904358918 1:29959915-29959937 CTGAGCACCTACTATGTGCTGGG + Intergenic
904380086 1:30104750-30104772 CTGAGCACCTACTATGTGCCAGG + Intergenic
904386674 1:30147137-30147159 CTGGGCACCCACTTTGTGGCAGG + Intergenic
904407636 1:30303572-30303594 CTGAGCACCTACTATGTGCCAGG + Intergenic
904456843 1:30652907-30652929 CTGAGCATCTACTATGTGCTAGG + Intergenic
904461470 1:30683075-30683097 CTGAGCACCTACTATGTGCCAGG + Intergenic
904500935 1:30912507-30912529 CTGAGCACCCACTCTGTGTCAGG - Intergenic
904541198 1:31234514-31234536 CTGAATACCTACTATGTGTCTGG + Intronic
904717138 1:32476918-32476940 CTGAGCACTCACTATGTGTCAGG - Intronic
904846977 1:33427238-33427260 TTGAGTGCTCACTATGTGCTAGG - Intronic
904894425 1:33803541-33803563 CCGAGTACCTACTATGTGCCTGG + Intronic
904911902 1:33940709-33940731 TTAAGCACCCACTATGTGCTTGG - Intronic
905004127 1:34696688-34696710 ATGAATACCAACTATGTGCTAGG - Intergenic
905241726 1:36585963-36585985 TTGAGTGCCCACTATGTGCCAGG + Intergenic
905364210 1:37440035-37440057 CTGAGGACCTACTATGTGCCAGG - Intergenic
905433045 1:37938447-37938469 CTGAGTTCCTGCTATGTGGTAGG + Intronic
905504044 1:38462789-38462811 CTGAGTGCCTACTATGTGCCAGG - Intergenic
905512584 1:38534326-38534348 CTGAGTACCTACTAAGTGCCTGG - Intergenic
905518508 1:38579599-38579621 CTGAGTGCCAACTATGTGTCAGG - Intergenic
905528087 1:38654693-38654715 CTAAGCACCCACTATGTGTCAGG + Intergenic
905701523 1:40019446-40019468 ATGAGTAACTACTATGTGCTAGG - Intergenic
905774436 1:40659538-40659560 CTGTGTACCTACTATGTGCCGGG + Intronic
905884871 1:41486249-41486271 CTGAGCACCTACTACGTGCTTGG + Intergenic
905890948 1:41518033-41518055 TTGAGTGCCCACTATGTGTCAGG - Intronic
905905244 1:41613462-41613484 ATGAGTGCCTACTATGTGGCAGG - Intronic
905924812 1:41741867-41741889 CTGAGTACCTACTATGTTTCTGG - Intronic
906013255 1:42549663-42549685 GTGAGTACCTACTATGTGTCTGG - Intronic
906135846 1:43500338-43500360 CTGAGTGCCTACTATGTGCCAGG + Intergenic
906141768 1:43537976-43537998 CTAAGCACCTACTATGTGCTGGG - Intronic
906188779 1:43881999-43882021 CTGAGCACCTGCTATGTGCTTGG + Intronic
906212638 1:44020721-44020743 GTGAGTCCCCACTATGTGCCAGG + Intronic
906267220 1:44441783-44441805 TTGAGTACCTACTATGTGCTAGG + Intronic
906272322 1:44489513-44489535 TTGAGTTCCCACTATGTGCCAGG + Intronic
906302598 1:44694099-44694121 CTGAGTACCCACTAAATTTTAGG - Intronic
906365700 1:45207364-45207386 TTGAGCACCCACTATGTGCCAGG - Intronic
906504626 1:46369350-46369372 TTGAGTACCTCCTATGTGCTAGG + Intergenic
906645181 1:47469763-47469785 CTGAGTACCCACTATGTGCCAGG + Intergenic
906691223 1:47793998-47794020 TTGAGTTCCTACTATGTGGCAGG + Intronic
906748688 1:48239731-48239753 GTGAGTACTTACTATGTGCTAGG + Intronic
906824020 1:48959394-48959416 TTGAGAACCTACTATGTGCTGGG + Intronic
906835310 1:49077180-49077202 TTAAGCACCCACTATGTGATAGG - Intronic
906946909 1:50302164-50302186 TTGAGTACCCACTATATGCCAGG - Intergenic
907202716 1:52741606-52741628 TTTAGTGCCCACTATGTAGTAGG + Intronic
907253955 1:53164049-53164071 TTGAGTACCTACTACGTGGCAGG - Intergenic
907353202 1:53850473-53850495 CTGAGCACCTACTATGTGCTGGG - Intergenic
907388426 1:54140745-54140767 TTGAGTACCTACTATGTGCCAGG + Intronic
907391670 1:54162228-54162250 TTGAGTACCTACTATGTGCCAGG + Intronic
907517751 1:55003739-55003761 CTGAGTAGTTACTATGTGCTGGG + Intronic
907551150 1:55305751-55305773 CTGAGTACCTACTATGTGCAAGG - Intergenic
907659714 1:56380812-56380834 CTGAGTATCTATTATGTGCTTGG + Intergenic
907678837 1:56544502-56544524 TTGGGCACCCACTATGTGCTAGG + Intronic
907925952 1:58955355-58955377 TTGAGTACCCACTATGTGGCAGG - Intergenic
907982860 1:59501897-59501919 CTGAGTACCCTCTGTGTGTCAGG + Intronic
908029109 1:59981345-59981367 CTGAGCACCTACTGTGTGTTAGG - Intergenic
908056041 1:60288338-60288360 ATGAATACCTACTATGTGCTAGG + Intergenic
908104153 1:60824256-60824278 TTGAGTACTCACTATGTGCCTGG - Intergenic
908163024 1:61430242-61430264 CAGAGTACCCACTATGTGCTGGG - Intronic
908235637 1:62145206-62145228 CTGAGCACCTGCTATGTGCTAGG + Intronic
908338873 1:63155686-63155708 CTGAGTACCTAGTATGTGCTAGG + Intergenic
908396134 1:63727424-63727446 CTCAGTACCAACTATGTGTCAGG - Intergenic
908570354 1:65403469-65403491 TTGAGTACTTATTATGTGGTAGG + Intronic
908819245 1:68066380-68066402 CTGAGTGTCTACTATGTGCTAGG - Intergenic
909005916 1:70276220-70276242 CTGAGTATGAGCTATGTGGTAGG + Intronic
909300248 1:74003662-74003684 CTGAGTACTTACTATGTGGAGGG - Intergenic
909547610 1:76865296-76865318 TTGAGTACCTACTATGTGCCAGG - Intergenic
909549613 1:76883101-76883123 CTGAGTAGCTACCGTGTGGTAGG + Intronic
909566311 1:77057108-77057130 CTGAGTACCTACTATATGCCAGG + Intronic
910007368 1:82415154-82415176 CTGTGTATCTACTATGTGCTAGG - Intergenic
910072615 1:83237249-83237271 TTGAGTACCTACTATGTGCAAGG + Intergenic
910072695 1:83238080-83238102 CTGAGTGCTCACTATGTTCTAGG + Intergenic
910075512 1:83272805-83272827 CTGAGTGCCTACTATGTGCTGGG + Intergenic
910078857 1:83315004-83315026 CTGAGTATTCACTATGTGCCAGG - Intergenic
910334615 1:86113161-86113183 CTGAGTACCTACTATGTGCTAGG + Intronic
910594280 1:88962203-88962225 CTGTGTACCTACTATGGGCTAGG + Intronic
910934178 1:92473933-92473955 TTGAGCACCCAGTATGTGCTGGG - Intergenic
911252803 1:95597285-95597307 CTGAATGCCTACTATGAGGTAGG + Intergenic
911715343 1:101126249-101126271 CTGAGCACCTACTATGTGCCAGG - Intergenic
911784475 1:101928713-101928735 CTGAAGACCTACTATGTGTTTGG + Intronic
912210031 1:107547135-107547157 CTGAGTGTCCACTATGTGCAAGG + Intergenic
912498533 1:110106760-110106782 CTGAGCACCTACTATGTGCCAGG + Intergenic
912563327 1:110565943-110565965 CAAAGTGCCCACTATGTGGCTGG + Intergenic
912688499 1:111785880-111785902 CTGAGCACGTACTATGTGGTCGG - Intronic
912710295 1:111945006-111945028 TTGAGGACCTACTATGTGTTGGG - Intronic
913053555 1:115137609-115137631 TTGAGTGCCTACTATGTGCTGGG + Intergenic
913335524 1:117706272-117706294 CAGAGTCCCGGCTATGTGGTGGG + Intergenic
913359905 1:117968901-117968923 TTGAGTACCCACTATGTGCCTGG + Intronic
913570472 1:120114974-120114996 TTGAGCACCTACTATGTGCTAGG - Intergenic
914291277 1:146275952-146275974 TTGAGCACCTACTATGTGCTAGG - Intergenic
914334583 1:146702806-146702828 TTGAGTACCCACCATGTGCCAGG + Intergenic
914349679 1:146830189-146830211 CAGAATACCTACTATGTGCTAGG - Intergenic
914402832 1:147339540-147339562 TTGAGTACCTACTATGTGCATGG - Intergenic
914426372 1:147580822-147580844 TTGAGGACCTACTATGTGCTGGG + Intronic
914552321 1:148726735-148726757 TTGAGCACCTACTATGTGCTAGG - Intergenic
914701779 1:150140629-150140651 CTGAGTGTCTACTATGTGCTAGG - Intronic
915102352 1:153509532-153509554 CTGAGTACCCACCATGTGGCAGG + Intergenic
915638592 1:157203840-157203862 CTGAGTGCCTACCATGTGCTGGG - Intergenic
915680575 1:157578391-157578413 CTGAGCACCTCCTATGTGCTAGG - Intronic
915927708 1:160036506-160036528 CTGAGTCCCTATTATGTGGAAGG - Intergenic
916197552 1:162238666-162238688 CTGAGTACTTACTGTGTGTTAGG + Intronic
916214260 1:162382413-162382435 CTGAGTGCCCACCATGTCCTCGG + Intronic
916242340 1:162652638-162652660 CTGAGTACCCACTATGTGGTAGG + Intronic
916313844 1:163426204-163426226 CTGAGTGCCTAGTATGTGCTAGG + Intergenic
916391125 1:164331964-164331986 CTGCGTACCTACTATTTGGCAGG + Intergenic
916572247 1:166038085-166038107 CAGACTAACCACCATGTGGTTGG - Intergenic
916590263 1:166183351-166183373 CTGAGTACCTACTAAGTGTCAGG - Intergenic
916743675 1:167667893-167667915 CTGAGTACCTACTATGGGCTAGG + Intronic
916745112 1:167679312-167679334 CAGAGTACCTCCTATGTGGGAGG - Intronic
916962028 1:169898199-169898221 CTGAGTACCTAGTATGTTCTAGG - Intergenic
917019065 1:170566696-170566718 TTGAGTATCTACTATGTGCTAGG - Intergenic
917966887 1:180184419-180184441 TTGAGTACTCACTATGTGCTAGG + Intronic
918061286 1:181063448-181063470 CTGAGTGCCTACTATGTGCCAGG - Intergenic
918105242 1:181410966-181410988 TTGAGCACCCACTATGTGTTGGG - Intergenic
918118292 1:181515829-181515851 CTGAGTACCAACTATATGCCAGG - Intronic
918118461 1:181517013-181517035 CTGAATACCCACTGTGTGCCAGG + Intronic
918599015 1:186330855-186330877 CTGAGTGCCTAATATGTGGCAGG + Intronic
919556793 1:199065782-199065804 CTGAGTACCCGCTATGTGCCAGG - Intergenic
919739768 1:200974527-200974549 GTGAGTGCCCACCATGTGCTGGG - Intronic
919965389 1:202518235-202518257 TTGAGTACCTACTATATGGAAGG + Intronic
920092261 1:203463293-203463315 CTGAGCACCTATTATGTGGGTGG - Intergenic
920394373 1:205633050-205633072 CTGGGTATCTACTATGTGCTAGG - Intergenic
920414591 1:205790328-205790350 TTGAGTGCCTACTATGTGTTAGG - Exonic
920442776 1:205992420-205992442 ATGAGCACCCACTATGTGCCAGG - Intronic
920459588 1:206128965-206128987 TTGAGTACCCATTATGTGCCAGG - Intergenic
920869545 1:209782792-209782814 CTGAGTACCTTCTATATGGGAGG + Exonic
920950765 1:210569941-210569963 CTGAGTACCAACTATAGGCTAGG - Intronic
920982606 1:210852398-210852420 CTGAGGGCCTACTATGTGCTAGG - Intronic
921055834 1:211541787-211541809 CTCAAAACCCACTATGTGCTAGG - Intergenic
921295239 1:213695127-213695149 TTGAGTGCCTACTATGTGGCAGG - Intergenic
921532446 1:216301406-216301428 TTGAGTACCTACTATGTTCTAGG - Intronic
921739205 1:218664611-218664633 TTGAGTACCTACTATGTGTGAGG - Intergenic
921862473 1:220054188-220054210 TTGAGCACCTACTATGTGTTAGG - Intergenic
922085486 1:222343011-222343033 CTGAGCACCTACTATGCAGTAGG + Intergenic
922165838 1:223115221-223115243 CTGAGCACCCATTATGTGTCAGG + Intronic
922198085 1:223376935-223376957 CTGAGCACTTACTATGTGCTAGG - Intergenic
922493991 1:226041754-226041776 TTGAGTGCTCACTATGTGGCAGG + Intergenic
923160377 1:231309742-231309764 TTGATCACCCACTATGTGCTAGG - Intergenic
923330669 1:232921152-232921174 TTGAATACCTACTATGTGCTGGG - Intergenic
923696068 1:236253799-236253821 CTGAGCATCCACTATGTGTCAGG + Intronic
923765047 1:236885444-236885466 CTGGGTACCCAGTAGGTGTTAGG + Intronic
923805885 1:237257575-237257597 CTGAATATCTACTATGTGCTGGG + Intronic
924093604 1:240527418-240527440 CTGAGTACACACTAAGAAGTTGG - Intronic
924399922 1:243668159-243668181 TTGAGTACCTACTATGTGTCTGG - Intronic
924614523 1:245601648-245601670 TTGAGCACCTACTATGTGCTGGG - Intronic
1062783825 10:243253-243275 TTGAGTACTCACTATGTGCTAGG - Intronic
1063060648 10:2547926-2547948 TTGAATACCAACTATGTGCTAGG - Intergenic
1063441141 10:6074328-6074350 TTGAGTACCTACTATGTGCCAGG + Intergenic
1063484981 10:6411302-6411324 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1063709877 10:8467268-8467290 CTGAGCATCTACTATGTGGAAGG - Intergenic
1063940291 10:11121504-11121526 TTGAGGCCCTACTATGTGGTTGG + Intronic
1064335924 10:14441218-14441240 CTGAGTAACCAGTATGTGCCGGG + Intronic
1064452778 10:15458417-15458439 TTGAGTACCCACTATATGCCAGG + Intergenic
1064862046 10:19836904-19836926 CTGAGTACCTAATATGTGCAAGG - Intronic
1064904894 10:20335153-20335175 CTGAGCATCTACTATGTGCTGGG - Intergenic
1064980740 10:21164139-21164161 CTGAGTACCCAGAATGTTTTAGG - Intronic
1065537913 10:26732676-26732698 CTGAGCGTCCACTATGTGCTAGG - Intronic
1065570362 10:27065324-27065346 TTGAGTACCAACCATGTGCTAGG - Intronic
1065688987 10:28314187-28314209 CTGAGCACCTACTATGTGCCAGG + Intronic
1065787109 10:29226729-29226751 CTGAGTACCAACTCTGTGAGTGG - Intergenic
1065871898 10:29962923-29962945 CTGAGCACTCACAATGTGTTGGG + Intergenic
1066804779 10:39236056-39236078 CTGAGAAACCACTTTGTGATGGG + Intergenic
1067316667 10:45173036-45173058 CTAAGTACCAACTGTGTGCTAGG + Intergenic
1067450197 10:46377317-46377339 CTGAGTCCCTACTCTGTGGCCGG + Intronic
1067470761 10:46536182-46536204 CTGAGTACCTCCTGTGTGGCAGG - Intergenic
1067587045 10:47482446-47482468 CTGAGTCCCTACTCTGTGGCCGG - Intronic
1067634105 10:47990213-47990235 CTGAGTCCCTACTCTGTGGCCGG - Intergenic
1068260322 10:54572228-54572250 TTGAGTACCTGCTATGTGTTAGG + Intronic
1068547553 10:58366364-58366386 GTAAGTGCCCACTATGTGCTAGG - Intronic
1068776917 10:60877701-60877723 TTAAGCACCCACTCTGTGGTGGG - Intronic
1068784198 10:60952401-60952423 GTAAGTACCCACTATGTGTTGGG + Intronic
1068856280 10:61800639-61800661 CTGAGTCCCTACTATGTGACAGG - Intergenic
1069083065 10:64108709-64108731 CTGAGTATCTACTCTGTGCTTGG + Intergenic
1069409601 10:68139813-68139835 CTGAGTACCTACCATGTGCCAGG + Intronic
1069512489 10:69052796-69052818 TTGAGTACCTACTGTGTGGCAGG - Intergenic
1069514564 10:69067388-69067410 CTGAGCACCTATTATGTGCTAGG - Intergenic
1069745351 10:70711586-70711608 TTGAGTACCCACTATGTGCCAGG - Intronic
1070289805 10:75106757-75106779 CTGAGTATCCACTACGTGCCTGG - Intronic
1070392406 10:75982839-75982861 TTGAGCACCCACTATGTGGCAGG + Intronic
1070536329 10:77380676-77380698 CTGAGCTCCTACTATGTGCTGGG - Intronic
1070546230 10:77455146-77455168 CTGAGTACCTACCATGTGCTTGG + Intronic
1070644168 10:78189956-78189978 TTGAGCACCCACTATGTGCCAGG + Intergenic
1070685908 10:78480954-78480976 CTGAGCAACTATTATGTGGTAGG + Intergenic
1070708257 10:78657321-78657343 CTGAGCACCTACTATGTGCCGGG - Intergenic
1070715551 10:78718465-78718487 TTGAGTGCATACTATGTGGTAGG - Intergenic
1070829594 10:79410357-79410379 TTGAGTACCTACTATGTGCCAGG - Intronic
1070830784 10:79417032-79417054 CTGAGCACTCACTATGTGCCAGG + Intronic
1071264774 10:83955129-83955151 ATGAGTACCTACTATGTGCAAGG - Intergenic
1071397252 10:85236562-85236584 TTGAGTGCCCACTAGGTGCTAGG + Intergenic
1071483622 10:86083054-86083076 CTGAGCCCCCACTATGTGTCTGG - Intronic
1071775670 10:88785203-88785225 CTGGGTACTGACAATGTGGTAGG + Intergenic
1071777659 10:88807109-88807131 TTGAGTTCCTACTATGTGCTGGG + Intronic
1071815658 10:89230181-89230203 TTGAGTACCAACTATGTGCCAGG + Intronic
1071850697 10:89566890-89566912 CTGAGTACCTACTATGTGCCAGG + Intergenic
1071940978 10:90591675-90591697 TTGAGTACCCAGTATGTGCTAGG + Intergenic
1071973179 10:90929236-90929258 CTGAGTGCCTACTATGTGCTGGG - Intergenic
1072105127 10:92266498-92266520 CTGAGCACCTATTATATGGTGGG + Intronic
1072138458 10:92569748-92569770 CTGAGTACCTACTATGTGTCAGG + Intronic
1072195485 10:93114250-93114272 TTGAGGACCTACTATGTGCTAGG + Intergenic
1072199520 10:93145659-93145681 CTGAGCACCTACTTTGTGCTGGG - Intergenic
1072205204 10:93197677-93197699 CTGAGTACTCATTATATGGCAGG - Intergenic
1072296770 10:94015933-94015955 TTTAACACCCACTATGTGGTAGG - Intronic
1072460685 10:95615954-95615976 TTGAGTACCTACTATGTGCAAGG - Intronic
1072675539 10:97463093-97463115 CTGAGTACTTCCTATGTGGCAGG + Intronic
1072840446 10:98768570-98768592 CTTAGTAACCACTCTGTGCTGGG - Intronic
1073066605 10:100763750-100763772 CTAAGCACCTACTATGTGCTAGG + Intronic
1073067690 10:100773241-100773263 CTGAGTATCTACTATGTGCTAGG - Intronic
1073204964 10:101763994-101764016 CTGAACACCCACCATGTGCTGGG + Intergenic
1073264890 10:102221040-102221062 TTGAGTGCCCACTATGTGCCAGG + Intergenic
1074060888 10:109964591-109964613 CTGAGTACTTACCATGTGCTGGG - Intergenic
1074064010 10:109996009-109996031 CTGAGCACTCACTATGTGCCAGG - Intergenic
1074260646 10:111850012-111850034 CTGAGCACTCACTATGTGCTGGG - Intergenic
1074547242 10:114410435-114410457 CTGAGTACCTACTATGTGCCAGG - Intergenic
1074844650 10:117386855-117386877 TGAAGTACCCACTATGTGCTAGG - Intergenic
1074883469 10:117676531-117676553 TTGAGTACCTACTATGTGCCAGG - Intergenic
1074946322 10:118284157-118284179 CTGAATACCTACTATGTGCAAGG - Intergenic
1075107820 10:119553750-119553772 CTGAGTACTCACTATGTACTTGG + Intergenic
1075203421 10:120425631-120425653 CTGAGTACCTAATATGTGCCAGG - Intergenic
1075209317 10:120477760-120477782 CTGAGTATCTACTATGTGCCAGG - Intronic
1075238701 10:120757401-120757423 GTGAGAACCTACTATGTGCTAGG - Intergenic
1075294419 10:121261886-121261908 CTGAGCACCTACTATGTGTCAGG - Intergenic
1075411131 10:122228729-122228751 TTGAGCACCTACTATGTGTTTGG + Intronic
1075815383 10:125260975-125260997 GTGAGTATCTACTATGTGTTGGG + Intergenic
1075990414 10:126833615-126833637 CTGAGCACTCACTATGTGCTAGG + Intergenic
1076014467 10:127016211-127016233 CTGAGCACCTACTATGTGCCAGG - Intronic
1076333875 10:129692055-129692077 CTGAGCACCCACTGGGTGCTGGG - Intronic
1077521887 11:3041310-3041332 CTGAGTACCTACCATGTGCCAGG + Intronic
1078199182 11:9164684-9164706 CTGGGTACCTACTATGTGCCAGG - Intronic
1078261552 11:9714420-9714442 CTGAGTACATACTATGTGCCAGG - Intronic
1078262349 11:9722123-9722145 TGGAGTACCTACTATGTGATGGG + Intronic
1078372184 11:10757673-10757695 CTGAGTACCAACTATGTGGCAGG + Intronic
1078459704 11:11504833-11504855 CTGAGTGCCAATTATGTGCTGGG + Intronic
1078784497 11:14475343-14475365 CTGAATACCCACTAAGTGCTAGG - Intronic
1079105338 11:17568589-17568611 CTGAGCACCAACTATGTGCAAGG - Intronic
1079191750 11:18283544-18283566 ATGAGTGCCTACTATGTGTTAGG - Intronic
1079299324 11:19263690-19263712 CTGAGTGCCTACTATGTGCTAGG + Intergenic
1079497222 11:21059308-21059330 CTGAGTACTGACTATGAGTTAGG - Intronic
1079794487 11:24782687-24782709 CTGAGTACCTACTATTTGACAGG - Intronic
1080018130 11:27529202-27529224 TGGAGTACATACTATGTGGTAGG - Intergenic
1080046508 11:27814222-27814244 TTGAGTGTCCACTATGTGCTAGG + Intergenic
1080170019 11:29289476-29289498 CTAAGTGCCTACTATGTGATAGG + Intergenic
1080226047 11:29961619-29961641 CTGAGTACCAACTATGTGCCAGG + Intergenic
1080335193 11:31187184-31187206 CTAAGTACCTACTATGTGTCAGG - Intronic
1080782033 11:35438589-35438611 CTGAGTGCCTACTATGTGGCAGG + Intronic
1081074391 11:38651701-38651723 TTGAGTAGCAACTATGTGGGTGG + Intergenic
1081323716 11:41720652-41720674 CTGTGTACCTACTATGTGCCTGG - Intergenic
1081533849 11:43983380-43983402 CTGAGCACCTACTATGTGCCTGG + Intergenic
1081662751 11:44898062-44898084 TTGAGGACCCACTATGTGCCAGG + Intronic
1081730578 11:45369245-45369267 CTGAATACCTACTATGTGCCAGG - Intergenic
1081748901 11:45493855-45493877 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1081759596 11:45568005-45568027 CTGAGCACCTACTATGTGCCAGG - Intergenic
1081768101 11:45626594-45626616 CTGAGGACCTACTATGTGCTAGG + Intergenic
1081838982 11:46182036-46182058 CTGAGAGCCCACTCTGTGTTAGG - Intergenic
1081890684 11:46539796-46539818 CTGAGGGCCTACTATGTGTTAGG - Intronic
1082672299 11:56049391-56049413 CTGAGTAGCAAATATGTGATTGG + Intergenic
1082812605 11:57487541-57487563 CTGAGAACCTACTATGTGCCAGG + Intronic
1083328898 11:61888012-61888034 CTGAGTGCCTACTATGTGCCAGG - Intronic
1083334283 11:61913725-61913747 CTGAGCACCCATTATGTGCCAGG + Intronic
1083582829 11:63836173-63836195 CTGAGCACCTACTATGTGCAAGG - Intergenic
1083620075 11:64044882-64044904 CTGAGGCCCCACTGTGTGCTGGG + Intronic
1083687180 11:64383520-64383542 CAGAGTACCTACTATGTGCCAGG - Intergenic
1083946758 11:65927932-65927954 CTGAGTACCTACTCTGTGCCGGG + Intergenic
1084268208 11:68015650-68015672 CTGAGCACCTACTATGTGCCAGG + Intronic
1084309734 11:68309971-68309993 CTGAGCACCTACTGTGTGCTAGG + Intergenic
1084482827 11:69431985-69432007 CTGAGCACCTGCTATGTGCTGGG - Intergenic
1084831207 11:71770692-71770714 CTCAGCACCCACTACATGGTGGG - Intergenic
1084864216 11:72042271-72042293 CTGAGCACCTACTATGTGTAAGG + Intronic
1085045455 11:73350268-73350290 CTGAGTGCCCACTATGTGCCAGG + Intronic
1085207143 11:74742237-74742259 TTGAGCACCTACTATGTGGCAGG - Intergenic
1085311490 11:75519547-75519569 CTGAGTGCTCATTATGTGCTGGG + Intronic
1085341674 11:75735459-75735481 CTGAGGACCTACTATGTGCTAGG + Intergenic
1085432389 11:76464155-76464177 CTGAGTGCTTACTATGTGCTTGG + Intronic
1085703381 11:78764682-78764704 CTTAGTACCCATTATGTGGCTGG + Intronic
1085732626 11:79012417-79012439 CTGAGTACCTACCATGTGCCAGG + Intronic
1086177613 11:83910846-83910868 TTGAGAACCCACTATGTGTATGG + Intronic
1086435699 11:86779183-86779205 CTGAGCACCTACTATGTGTCAGG + Intergenic
1086929960 11:92682281-92682303 CTGAGTATTCCCTATGTGGCAGG - Intronic
1087491604 11:98834403-98834425 CTAAATGCCCACTATGTGGCAGG - Intergenic
1087584426 11:100100298-100100320 CTGAGCACCTATTATGTGTTTGG - Intronic
1087711237 11:101555065-101555087 CTGAGCCCTCACTCTGTGGTAGG + Intronic
1088073114 11:105813753-105813775 CTGAGTGCCTAATATGTGCTTGG + Intronic
1088262379 11:107956297-107956319 CTGAATGCCCACTATGTGCTAGG + Intronic
1088394779 11:109354597-109354619 TTGAGTACTCACTATGTGTGAGG - Intergenic
1088422999 11:109669395-109669417 CTGAGTGCTCACTCTGTGCTGGG - Intergenic
1088771805 11:113042922-113042944 CTGAGTACTTACTATGTGTCAGG - Intronic
1089102733 11:115977169-115977191 TTGAATACTCACTATGTGTTTGG - Intergenic
1089151565 11:116368498-116368520 CTGAGAACTCATTATGTGTTGGG - Intergenic
1089321721 11:117631001-117631023 TTGAGTGCCCACTATGTGCCAGG - Intronic
1089388229 11:118081785-118081807 CTGAGCATCTACTATGTGCTAGG + Intronic
1089392010 11:118108623-118108645 CTGAGTACCTACTGTGTGCTGGG - Intronic
1089399936 11:118158570-118158592 CTGAGTACCTACTCTGTGCCTGG - Intergenic
1089550070 11:119267723-119267745 TTGAGTGCCTACTATGTGCTAGG - Intronic
1089576439 11:119447698-119447720 CTGAGGACCCAGCATGTGGGAGG - Intergenic
1089794587 11:120970043-120970065 CTGAGTAACTACTATGTGCCTGG - Intronic
1089870466 11:121668235-121668257 CTGAGTGCCAAGTATGTGCTAGG + Intergenic
1089909908 11:122087357-122087379 CTGAGCACCTACTACGTGCTGGG - Intergenic
1089924685 11:122245212-122245234 CTCAGTACCAACTATGTACTAGG - Intergenic
1090245205 11:125211358-125211380 CTGAGTACCTACTATGTATCAGG + Intronic
1090393177 11:126402693-126402715 CTGAGTACTCACTGTGTGTTAGG + Intronic
1090421184 11:126576050-126576072 CTGAGTGCCTACTATGTGCCTGG - Intronic
1090805744 11:130201086-130201108 CTGAGCACCTACTATGTGCCAGG - Intronic
1090903848 11:131056430-131056452 CTGAGTACCTACTATGTGCAGGG + Intergenic
1091001641 11:131914812-131914834 TTGAGTGCTCACTATGTGTTGGG + Intronic
1091677560 12:2502280-2502302 CTGAGGACCTACTATGTGCGAGG + Intronic
1091731149 12:2881503-2881525 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1091822737 12:3488792-3488814 CAAAGTACCTACTATGTGCTAGG + Intronic
1091878532 12:3957717-3957739 ATGAGTAACCACTATGTGCCAGG - Intergenic
1092025248 12:5234336-5234358 TTGAATACCTACTGTGTGGTAGG - Intergenic
1092104414 12:5911235-5911257 CTGAGCACCTACTAGGTGCTGGG - Intronic
1092365325 12:7872602-7872624 CTGAGCACCTACTATGTCCTGGG - Intronic
1092559034 12:9590151-9590173 CTGAGTGCCTACCATGTGGTAGG + Intergenic
1092578204 12:9813005-9813027 CTGACCACCCACTCTGTGATCGG - Intergenic
1092923498 12:13253337-13253359 CTAAGGACCCACTATATGATAGG - Intergenic
1092970464 12:13689346-13689368 CTGAGTGCCTACTATGTGCCAGG - Intronic
1093314666 12:17633338-17633360 CAGAGTACCTACTAGGTGATAGG - Intergenic
1093390432 12:18612432-18612454 CTGAGTACCTACTATATACTTGG - Intronic
1093731622 12:22571877-22571899 CAAAGTACCCACAATGTGGGTGG + Intergenic
1094214794 12:27929452-27929474 CTGATCACTCACTATGTGCTAGG + Intergenic
1094318504 12:29158974-29158996 CTGAGTACCTACTATGTGCCAGG + Intronic
1094371807 12:29746947-29746969 CTGAGCACCTACTATGTGTCAGG - Intronic
1094469241 12:30788099-30788121 CTGACTACCAACTATGTGTAAGG - Intergenic
1094627527 12:32138139-32138161 CACAATACCCAGTATGTGGTAGG - Intronic
1094867838 12:34559685-34559707 CTGAGAAACCACTTTGTGATGGG - Intergenic
1095535179 12:43237694-43237716 TTGAGTACCTATTATGTGCTAGG + Intergenic
1095573809 12:43711763-43711785 TTGAGTACCTACTATGTGCCAGG + Intergenic
1095787407 12:46124836-46124858 TAGAGTACCTACGATGTGGTAGG + Intergenic
1095876620 12:47086007-47086029 CTGAGCGCCCACTGTGTGCTAGG + Intronic
1095965227 12:47863088-47863110 CTGGGTTCCCACCACGTGGTAGG + Intronic
1095973842 12:47925636-47925658 CTGAATACCTACTAAGTGATGGG + Intronic
1096226733 12:49870834-49870856 CTGAGCACCTGCTATGTGCTAGG + Intronic
1096545787 12:52339317-52339339 CTGAGCACCCACTATATGCCAGG - Intergenic
1096841446 12:54382021-54382043 TTGAGCACCTACTATGTGCTGGG - Intronic
1096968145 12:55645029-55645051 CTGAATACCTACTATGTGCCAGG + Intergenic
1097306111 12:58071000-58071022 TTGAGTACCCACTATGTTCCTGG - Intergenic
1097636636 12:62130612-62130634 CTGAGTACCTACTATGTGGCAGG + Intronic
1098280127 12:68854296-68854318 TTCAGTACCTACTATGTGCTAGG + Exonic
1098932015 12:76429318-76429340 GTGAGCACCTACTATGTGTTGGG + Intronic
1098986632 12:77019131-77019153 TTGAGTACACATTTTGTGGTGGG + Intergenic
1099106590 12:78504873-78504895 CTGAGTGCCCACTAAGTAGTTGG + Intergenic
1099168254 12:79334086-79334108 CTGAGTATACGCTATGTGCTAGG + Intronic
1099219951 12:79901707-79901729 CTGAGAACTCACTATGTGCCAGG + Intronic
1099346173 12:81502630-81502652 TCAAGTACCCACTATGTGCTAGG + Intronic
1099449910 12:82796055-82796077 CTGAGTGCCATCTATGTGGCTGG - Intronic
1099729951 12:86488172-86488194 CTGAGAATTCACTATGTTGTAGG - Intronic
1100195498 12:92239980-92240002 CTGAGTACCTGCTATGTGTCAGG - Intergenic
1100347878 12:93749931-93749953 CTGAGTACCTACTATGTACAAGG - Intronic
1100392350 12:94154873-94154895 CATAGTACCCAGTATGTAGTTGG + Intronic
1100442270 12:94627925-94627947 TTGAGCACCTACTATGTGCTAGG - Intronic
1100476091 12:94936692-94936714 CTGAGTACCTACCATGTGTCAGG + Intronic
1100580728 12:95937800-95937822 TTGAGTACCTACTATGTGTCAGG + Intronic
1101010049 12:100439990-100440012 TTGAGAACCTACTATGTGTTGGG - Intergenic
1101266714 12:103095742-103095764 CTGAGCACCTACTATGTGTCAGG - Intergenic
1101337710 12:103811093-103811115 CTGAGTACCTACTTTGTGCCAGG + Intronic
1101370656 12:104126686-104126708 ATGAGTACCTACTCTGTGGAAGG - Intronic
1101421230 12:104552881-104552903 TTGAGTACCTACTATGTGCTAGG - Intronic
1101446694 12:104742053-104742075 CTGAGTGCCTACTATGTGCCAGG + Intronic
1101591908 12:106132364-106132386 TTGAGGACCTACTATGTGCTTGG + Intronic
1101627687 12:106461641-106461663 CTGAATACCCACTATGTGCCAGG - Intronic
1101735183 12:107458191-107458213 CTGAGTGCCTACTGTGTGCTAGG + Intronic
1101746425 12:107544961-107544983 TTGAGCACCTACTATGTGCTGGG - Intronic
1101840566 12:108324819-108324841 CTGAGCACCCACAATGTGGTGGG + Intronic
1102046018 12:109830858-109830880 CTGAGCACCTACTATGTGCCAGG + Intronic
1102139410 12:110602264-110602286 CTGAGCACCTACTATGTGCCCGG - Intergenic
1102151989 12:110694984-110695006 CTGAGTGCCAACTATGTGCTAGG + Intronic
1102164443 12:110795223-110795245 ATGAGTACCTACTATGTGTGAGG + Intergenic
1102225465 12:111225215-111225237 CTGAACACTCACCATGTGGTGGG - Intronic
1102250000 12:111380346-111380368 CTGAGCACCTACTGTGTGCTAGG - Intergenic
1102387054 12:112518962-112518984 CTGAGCACCCACTATGTGCCAGG - Intergenic
1102407768 12:112688632-112688654 CTTAGTACCTACTAAGTGCTTGG + Intronic
1102552712 12:113703199-113703221 CTGAGCACCCACGATGTGCTAGG + Intergenic
1102619841 12:114185530-114185552 CTGAGCACCTACTATGTGTCAGG - Intergenic
1102629586 12:114266216-114266238 TTGAGTACCAACTATGTGAAAGG + Intergenic
1102773758 12:115501239-115501261 TTGAGTACTTACTATGTGCTGGG + Intergenic
1102884387 12:116510564-116510586 CTGAGCACCTACTATGTGCCAGG - Intergenic
1103099973 12:118164961-118164983 TTGAGCACCTACTATGTGCTGGG + Intronic
1103175964 12:118863354-118863376 CAGAGCACCTACTATGTGGCAGG - Intergenic
1103235492 12:119369047-119369069 CTGAGACCTCACTGTGTGGTTGG - Intronic
1103582459 12:121925429-121925451 CTGAGTACTCACTATGTCTTAGG - Intronic
1103901322 12:124304905-124304927 CTGAGCACCTACTGTGTGCTGGG - Intronic
1103906818 12:124332067-124332089 CTGGGCACCTACTATGTGCTGGG + Intronic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104010420 12:124926235-124926257 CTGAGTACCTATTATGTGCCAGG - Intergenic
1104066228 12:125309487-125309509 CTGAGCACCTACTATGTGCCAGG + Intronic
1104390844 12:128389568-128389590 CTGAGCACCTACTATGTGCCAGG - Intronic
1104502669 12:129301654-129301676 TTGAGTACCCACTTTGTCTTGGG + Intronic
1104640560 12:130464372-130464394 CTGAATACCTACTATGTGCCAGG + Intronic
1104640572 12:130464468-130464490 CTGAATACCTACTATGTGCCAGG + Intronic
1104640579 12:130464517-130464539 CTGAATACCTACTATGTGGCAGG + Intronic
1104640584 12:130464566-130464588 CTGAATACCTACTATGTGCTTGG + Intronic
1105283407 13:18983513-18983535 CTGAGTGCCCACTCTGTGTCAGG + Intergenic
1105291738 13:19057850-19057872 CTGTGTGCCCACTGTGTGCTGGG - Intergenic
1105960648 13:25333243-25333265 ATGAGTGCCTACTATGTGCTGGG + Intronic
1106219787 13:27736090-27736112 CTGAGTACCCAGTGTGTATTAGG + Intergenic
1106234718 13:27852236-27852258 CTGAGCACCCACTATGTGTATGG + Intergenic
1106317462 13:28607359-28607381 CTGAGAACCCAGTATGTGCTAGG + Intergenic
1106375457 13:29182553-29182575 CTGAGAACCTACTATGTGCTAGG + Intronic
1106401370 13:29434479-29434501 CTGAGTGCCTACTATGTGCCTGG - Intronic
1106457349 13:29938679-29938701 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1106569255 13:30912047-30912069 CTGAGTACCTACTGTGTGCTGGG - Intronic
1106605698 13:31226292-31226314 CTGAGTACCTACTAAGTGTAGGG - Intronic
1106785733 13:33106455-33106477 CTGAGTACCTACTATGTGTCAGG + Intronic
1106884196 13:34165753-34165775 CTGAGAACCTACCATGTGCTAGG + Intergenic
1107137832 13:36963917-36963939 CTGGGTACCTACTATGTGCTGGG + Intronic
1107598742 13:41991071-41991093 TTGAGCACCTACTATGTTGTAGG + Intergenic
1107657767 13:42609586-42609608 TTGAGTACCATCTATGTGCTAGG + Intergenic
1107899286 13:44996010-44996032 CTGAGTACCCACTTTGTGCTGGG - Intronic
1107957549 13:45531299-45531321 CTGAGTACCCAGTATGTATTAGG + Intronic
1108285526 13:48904372-48904394 CTGGGCACCTACTATGTGCTAGG - Intergenic
1109740065 13:66541790-66541812 CTGAGTATCTACTCTGTAGTGGG - Intronic
1110170731 13:72497362-72497384 CTGAGCACCTACTATGTGCCAGG + Intergenic
1110617131 13:77553751-77553773 CTGAGCACCTACTGTGTGCTGGG + Intronic
1110795344 13:79630598-79630620 CTGAGTACCCACTGTGTGTCCGG - Intergenic
1111871438 13:93838119-93838141 CTGAGCACCTACTATGTGCCAGG + Intronic
1111897244 13:94156986-94157008 CTGATTACCCACTATGCGCGAGG + Intronic
1111944170 13:94646136-94646158 TTGAGTACCTATTATGTGTTAGG - Intergenic
1112038318 13:95518208-95518230 CTGAGTGCTAACTATGTGCTAGG - Intronic
1112133124 13:96545964-96545986 TTGAGTGCCCACTATGTGCCAGG - Intronic
1112189633 13:97163618-97163640 CTGAATACCCACTGGGTGATTGG + Intergenic
1112569230 13:100579106-100579128 CTGGGTGCCCACTATGTGGAAGG + Intronic
1112644180 13:101310719-101310741 TTGAGGACCCACTATGTGCTAGG - Intronic
1112756105 13:102635359-102635381 CTGTGTTCTCATTATGTGGTGGG - Intronic
1113856063 13:113446084-113446106 CTGCGTACTCTCTCTGTGGTAGG - Intronic
1113982176 13:114285369-114285391 ATGAGTATCCACTGTGTGCTAGG + Intronic
1114428656 14:22641653-22641675 TTGAGTGCCAACTATGTTGTGGG + Intergenic
1115104899 14:29748697-29748719 CTGAATACCTATTATGTGCTTGG - Intronic
1115126749 14:30004181-30004203 CTGAGTACCCACTAAGTGCCAGG + Intronic
1115242332 14:31261913-31261935 CTGGGCACCCACTGTGTGCTGGG - Intergenic
1115292359 14:31786627-31786649 CTGAATACCTACTATGTATTGGG - Intronic
1115649247 14:35391142-35391164 CTGAGTGCCTACTATGTGTCTGG + Intergenic
1115795657 14:36932510-36932532 TTGAGTGCCTACTATGTGCTGGG + Intronic
1115900592 14:38143102-38143124 CTGAGCACCCATTATATGCTGGG + Intergenic
1115955159 14:38769779-38769801 TTGAGTACCCATTATATGGATGG - Intergenic
1115993550 14:39173412-39173434 CTGAGGGCCCACTATGTGCCAGG - Intergenic
1116316337 14:43398948-43398970 TTGAGTACCTATTATGTGGCAGG - Intergenic
1116431583 14:44852089-44852111 CTGAGAACCCACTGTGTTCTAGG + Intergenic
1116999162 14:51354758-51354780 CTGAGTGCTCACTATGTGCCAGG + Intergenic
1117284679 14:54275666-54275688 TTGAGTGCCTACTATGTGCTGGG + Intergenic
1117549503 14:56819563-56819585 CTGGGCACCTACTATGTAGTAGG + Intergenic
1117625555 14:57634117-57634139 CTGAGCACCCACCATGTGCTAGG + Intronic
1117832542 14:59766928-59766950 CTGAGCACCTACTATGTGGTAGG + Intronic
1117961985 14:61172365-61172387 CTGAGTGCCCACTATGTACCAGG + Intergenic
1118136786 14:63037384-63037406 TTGAGTACCTACTATGTGCTAGG - Intronic
1118302377 14:64627061-64627083 CTGAGTGCCTACTATATGCTGGG + Intergenic
1118701980 14:68442405-68442427 TTGAGTGCCTACTATGTAGTAGG + Intronic
1118975874 14:70676209-70676231 CTGAGTACCTACAATGTGCCAGG - Intergenic
1119078350 14:71667469-71667491 CTGAGTACCTACTATGTGCTAGG - Intronic
1119570665 14:75668445-75668467 CTGAGTCCCTACTATGTGCCAGG - Intronic
1119827090 14:77666173-77666195 CTGAGTAACTACTATGTGCCAGG + Intergenic
1119875069 14:78052373-78052395 TTGAGTACCTACTCAGTGGTAGG - Intergenic
1120204646 14:81574551-81574573 CTGAGTGCCAACTATGTGTCAGG - Intergenic
1120931503 14:89853381-89853403 TTGAGTACCTACTATGTGCCAGG + Intronic
1121116774 14:91349174-91349196 CCAAGTACCTACTATGTGCTGGG + Intronic
1121309081 14:92925206-92925228 CTGAGGACCTATTATGTGCTAGG - Intronic
1121383224 14:93492896-93492918 CTGAGTATCCACCATGTACTGGG + Intronic
1121490206 14:94352984-94353006 TTGAGCACCTACTATGTGCTTGG + Intergenic
1121684583 14:95826019-95826041 TTGAGCACCTACTATGTGGCAGG - Intergenic
1121721347 14:96110894-96110916 CTGAGTGCCTACTACGTGCTGGG + Intergenic
1122005912 14:98703437-98703459 CTGAGTACCTACTGTATGCTTGG - Intergenic
1122156580 14:99753699-99753721 CTGAGCACCTACTATGTGCCAGG - Intronic
1122190785 14:100041585-100041607 CTGAGCACCTACTGTGTGTTGGG - Intronic
1122239858 14:100355968-100355990 CTGAGAACTCACTGTGTGCTCGG + Intronic
1122848842 14:104515778-104515800 CTGAATGCCCACTATGTGCCAGG + Intronic
1123999357 15:25741812-25741834 TTGAGTACCCACTATGTGTCAGG - Intronic
1124491017 15:30155576-30155598 CTGAGTGCCCACTGTGTGCTTGG - Intergenic
1124752520 15:32382755-32382777 CTGAGTGCCCACTGTGTGCTTGG + Intergenic
1124851645 15:33345244-33345266 TTGAGTAGCCACTATGTGCCAGG + Intronic
1125350452 15:38761709-38761731 CTGAGCACCCACTATGTGTCAGG + Intergenic
1125584597 15:40811122-40811144 CTGAGTACTCACTATGAGTCAGG - Intronic
1125790513 15:42362010-42362032 CTGAGTACCCACTATGGGACTGG - Intronic
1125956792 15:43796018-43796040 TTGAGTACCCACAATGTGCTAGG - Intronic
1126327054 15:47490227-47490249 CTGAGCACTCACTATGTGTATGG - Intronic
1126541464 15:49829155-49829177 CTGAGTACCTATTAAGTGGTAGG + Intergenic
1126576816 15:50205510-50205532 CTAAGTCCCCTCTATATGGTAGG - Intronic
1126830249 15:52595330-52595352 TTGAGTACTTACTATGTGCTAGG - Intronic
1127051518 15:55088975-55088997 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1127141692 15:55984454-55984476 CTGAATACCCACTCTGTGCCAGG - Intronic
1127201406 15:56656711-56656733 CTGAGTGCCTACTATGTGCCAGG + Intronic
1127402856 15:58608040-58608062 CTGAGTGCCTACTGTGTGTTTGG - Intronic
1127585259 15:60372182-60372204 CTGAGTACCTACTATGTTACAGG + Intronic
1127630340 15:60821704-60821726 CTGAGTGCTTACTATGTGGCAGG + Intronic
1127635003 15:60860776-60860798 CTGGGCACCCACTGTGTGCTAGG + Intronic
1127673466 15:61217674-61217696 CTGAGTACTTTCTATGTGCTAGG - Intronic
1127719619 15:61686870-61686892 TTGAGTACCTACTATGGGTTGGG - Intergenic
1127858446 15:62972570-62972592 TTGAGTACCTACTATGTGGCAGG + Intergenic
1127934802 15:63626844-63626866 CTGAGTACCTTCTATGTGCCTGG + Intronic
1127938936 15:63673529-63673551 TTGAGTACCTACTATGTGTTGGG - Intronic
1128060898 15:64735344-64735366 GGGAGTACCTACTATGTGTTAGG + Intergenic
1128173057 15:65530159-65530181 CTGAGTACCTACTGTGTGCCTGG - Intergenic
1128206768 15:65859479-65859501 TTGAGTACCTACTATGTGCTGGG - Intronic
1128321510 15:66698007-66698029 TTGAGTGCCCACTATGTGACAGG + Intergenic
1128427697 15:67558908-67558930 AAAAGTACCCACTATGTGGTGGG - Intronic
1128453081 15:67818400-67818422 CTGAGTACCTACTAAGTGCCAGG + Intergenic
1128628344 15:69235479-69235501 ATGAGTGCCTACTGTGTGGTAGG + Intronic
1128652492 15:69428791-69428813 CTGAGTTCCTACTCAGTGGTAGG + Intronic
1128652649 15:69430376-69430398 TTGAGTACCTACTATGTGCCAGG + Intronic
1128674960 15:69601898-69601920 CTGAGTACTTACTATGTGCCAGG - Intergenic
1128689318 15:69711270-69711292 CTGAGCACCTACTATGTGCTAGG - Intergenic
1128734183 15:70043215-70043237 CTGAGAGCCCACTGTGTGGTGGG + Intergenic
1128810901 15:70571943-70571965 TTGAGTATCTACTATGTGCTAGG - Intergenic
1128971553 15:72111554-72111576 CTGAGTACCTACTATATGCTTGG + Intronic
1129545736 15:76393010-76393032 ATGAGTGCTCACTATGTGCTAGG - Intronic
1129635996 15:77318521-77318543 CTGAGATCCCACTCTGTCGTTGG - Intronic
1129698790 15:77755710-77755732 CTGGGCACCTACTATGTGCTGGG + Intronic
1129709462 15:77813115-77813137 CTGTGTACCCACTATATGCAAGG - Intronic
1129743423 15:78001323-78001345 CTGAGTACCTGCTTTGTGGTAGG - Intronic
1129888550 15:79055890-79055912 CTGAGTACCTACTGTGTGCCAGG + Intronic
1129932580 15:79424641-79424663 CTGAGCACCTATTATGTGCTGGG + Intronic
1130041573 15:80409550-80409572 CTGAGTAACTACTATGTGCCGGG + Intronic
1130179615 15:81611874-81611896 CTGAGCACCTACTATGTGCAAGG - Intergenic
1130353252 15:83109015-83109037 CTGAGTGCCTACTGTGTGTTTGG + Intronic
1130894894 15:88162344-88162366 TTGAGTGCCTACCATGTGGTGGG - Intronic
1131737951 15:95354270-95354292 TTGATTACCTACTATGTGCTAGG - Intergenic
1131808610 15:96148950-96148972 TTGAGTACCCACTACTTGCTAGG + Intergenic
1132016467 15:98321668-98321690 CTGAGTATCCATTCTGTGTTAGG + Intergenic
1132080653 15:98862070-98862092 CTGATCCACCACTATGTGGTAGG - Intronic
1132917786 16:2362777-2362799 TTGAGCACCTACTATGTGCTAGG - Intergenic
1133385876 16:5370045-5370067 TTGAGCACCTACTATGTGCTGGG + Intergenic
1133686883 16:8173781-8173803 CTGAGTACCAATTATGTGCCTGG + Intergenic
1133722612 16:8508902-8508924 TTGAGTACCTACTCTGTGGCTGG - Intergenic
1133826065 16:9279298-9279320 CTGAGTATCTACTATGTGCCGGG - Intergenic
1133842547 16:9423104-9423126 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1133859245 16:9578596-9578618 CTGAGTGCCCACTACGTGTCAGG + Intergenic
1134080983 16:11324848-11324870 CTGAGCCCCTACTATGTGCTTGG + Intronic
1134122849 16:11596871-11596893 CTGAGTACCCACTGGGTGCCAGG + Intronic
1134298214 16:12965806-12965828 CTGAGCACTGACTATGTGCTGGG - Intronic
1134309675 16:13064262-13064284 TTGAGCACCTACTATGTGCTAGG + Intronic
1134667889 16:16032751-16032773 CTGAGCACCTACTATGTGCTAGG - Intronic
1134756306 16:16670524-16670546 TTGAGCACCTACTATGTGCTGGG - Intergenic
1134877186 16:17711519-17711541 CTGAGTATCAACTATGTGCTTGG + Intergenic
1134989764 16:18688640-18688662 TTGAGCACCTACTATGTGCTGGG + Intergenic
1135054743 16:19221635-19221657 TTGAGTATCTACTATGTGCTAGG + Intronic
1135185755 16:20314455-20314477 CTGAGTGCCCACTGTGTGCCAGG - Intronic
1135538832 16:23314748-23314770 CTGAGTACCCTCTTTGTTGGGGG - Intronic
1136048154 16:27631756-27631778 TTGAGTACCCACTATGTGCCAGG + Intronic
1136090395 16:27915545-27915567 CTGAGCACCTACTATGTGCTGGG + Intronic
1136411838 16:30082280-30082302 CTGAGTACCAACTATTCTGTAGG - Intronic
1136427855 16:30181178-30181200 TTGAGTGCCTACTATGTGCTGGG - Intergenic
1136634193 16:31508765-31508787 TTGAGCACCTACTATGTGTTGGG - Intronic
1136686456 16:31997418-31997440 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136721787 16:32325541-32325563 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1136738745 16:32491619-32491641 CTGAGAAACCACTTTGTGATTGG + Intergenic
1136740276 16:32514581-32514603 CTGAGAAACCACTTTGTGATGGG - Intergenic
1136787067 16:32940947-32940969 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1136840169 16:33531820-33531842 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1137234351 16:46601902-46601924 TTGAGTACCTACTATGTGCAGGG - Intronic
1137251056 16:46741225-46741247 TTGAGCACCCACTATGTGCTGGG - Intronic
1137404007 16:48176011-48176033 CTGAGCACCTACTATGTGCCTGG - Intronic
1137684019 16:50373493-50373515 CTGTGTGCCTACTATGTGCTGGG + Intergenic
1137730381 16:50685281-50685303 CTGAGCACCCACTATGTGGCAGG - Intergenic
1137737769 16:50737641-50737663 TTGAGCACCTACTATGTGCTAGG - Intergenic
1137818795 16:51424063-51424085 CTGAGTACTTACTGTGTGGTAGG - Intergenic
1137905605 16:52318992-52319014 CTGAGTGCCTACTATGTGTTGGG + Intergenic
1137949002 16:52764220-52764242 CTGAGTGCTGACTATGTGATGGG - Intergenic
1137980219 16:53063079-53063101 GTAAGTACCCAGTAAGTGGTGGG - Intronic
1138075635 16:54039684-54039706 TTGAGTACCCAGTATGCGTTAGG + Intronic
1138158729 16:54732123-54732145 CTGAGTAACTACTATGTGCCAGG - Intergenic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1138584589 16:57961733-57961755 CTGAGTCCTCACTCTGTGGCAGG + Intronic
1138617891 16:58185921-58185943 CTGAGTGCTTACTATGTGCTGGG - Intronic
1138867424 16:60839842-60839864 TTGAATACCTACTATGTGCTAGG + Intergenic
1139255557 16:65538537-65538559 CTGAGTGCCTACTATGTGCCAGG + Intergenic
1139735402 16:68983434-68983456 TTGAGTAGCCACTGAGTGGTTGG + Intronic
1139829888 16:69788817-69788839 CTGAGGGCCCACTATGTGTCAGG - Intronic
1139984356 16:70885357-70885379 CAGAATACCTACTATGTGCTAGG + Intronic
1139999039 16:71008426-71008448 TTGAGTACCCACCATGTGCCAGG - Intronic
1140039139 16:71394035-71394057 CTGAGCACCTACTGTGTGCTTGG - Intergenic
1140653119 16:77110049-77110071 CTGAAAACCCACTCTGTGGAAGG + Intergenic
1140808862 16:78558021-78558043 CTGAGGGCCGACTATGTGCTTGG - Intronic
1140871524 16:79110994-79111016 CTGAGAACCTACTATGTGCAAGG - Intronic
1141088954 16:81117003-81117025 CTAAGTGTCCACTATGTGGTAGG - Intergenic
1141219048 16:82052040-82052062 CTGAGCACCTATGATGTGGTTGG - Intronic
1141470908 16:84237682-84237704 TTGAGCACCTACTATGTGCTTGG + Intronic
1141597036 16:85103750-85103772 CTGAATACCCACTAGGTGCCAGG + Intronic
1141641770 16:85345804-85345826 CTGAGTACCAACTATGTGCTAGG - Intergenic
1141642634 16:85350137-85350159 CCGAGTACCTACTATGTGCCAGG - Intergenic
1141643329 16:85354401-85354423 CTGAGCACCTACTATGTGCCAGG - Intergenic
1142418227 16:89954616-89954638 CTGAGCACCTACTATGTGCTGGG - Intronic
1203004645 16_KI270728v1_random:192229-192251 TTGAGTATCCACTAAGTGCTAGG - Intergenic
1203014468 16_KI270728v1_random:340172-340194 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203029340 16_KI270728v1_random:560660-560682 CTGAGAAACCACTTTGTGATGGG + Intergenic
1203032803 16_KI270728v1_random:613331-613353 CTGAGAAACCACTTTGTGATTGG - Intergenic
1203042381 16_KI270728v1_random:773771-773793 CTGAGAAACCACTTTGTGATGGG - Intergenic
1203089304 16_KI270728v1_random:1202617-1202639 CTGAGTATCCACTGTGTGCCAGG - Intergenic
1203136196 16_KI270728v1_random:1728348-1728370 TTGAGTATCCACTAAGTGCTAGG - Intergenic
1203150336 16_KI270728v1_random:1832110-1832132 TTGAGTATCCACTAAGTGCTAGG + Intergenic
1142641285 17:1287295-1287317 CTGAGTACCTACTAAATGTTAGG + Intronic
1142965814 17:3580352-3580374 CTGAGGTCCCACTATGTGCCAGG + Intronic
1143349928 17:6280434-6280456 TTGAGTACCTACTATGTGTTAGG - Intergenic
1143551944 17:7635698-7635720 CTGAGCACCCGCTATGTACTAGG + Intergenic
1144059441 17:11569331-11569353 CTGATCACCCACTATGGGGTGGG + Intergenic
1144089063 17:11837291-11837313 ATGAGTACCTACTATGTGCCAGG + Intronic
1144181174 17:12753883-12753905 CTGAGCACCTACTATGTGCCAGG + Intronic
1144209589 17:13003119-13003141 CTGAATGCCCACTTTGTGGGAGG - Intronic
1144630543 17:16869956-16869978 CTGAGCGCCTACTATGTGCTAGG - Intergenic
1144773762 17:17773673-17773695 CTGGGTACCCTCTGTGTGCTGGG - Intronic
1145017231 17:19407292-19407314 CTGAGCACCTACTAAGTGCTGGG - Intergenic
1145250150 17:21293063-21293085 GTGAATACCTACTATGTGCTGGG - Intronic
1145795432 17:27652825-27652847 TTGAGCACCTACTATGTGCTAGG - Intergenic
1145809867 17:27758156-27758178 TTGAGCACCTACTATGTGCTAGG - Intronic
1145813555 17:27779909-27779931 CTGAGCACCTACTATGTGCCAGG + Intronic
1146327931 17:31903136-31903158 CTGAGTACTTATTATATGGTAGG - Intergenic
1146380941 17:32326972-32326994 CTGTGTACCTACTATGTGCTAGG + Intronic
1146568466 17:33933393-33933415 CTGAGTATCCAGTATGTGCCAGG - Intronic
1146623746 17:34420346-34420368 CTAAGCACCTACTATGTGCTGGG - Intergenic
1146687600 17:34851965-34851987 GTGAGCACCTACTATGTGGCAGG - Intergenic
1146957986 17:36948115-36948137 CTGACTGCCCACTATGTGGCAGG - Intergenic
1147131920 17:38414887-38414909 CTGAGGAGCCACTAGGTGGCAGG - Intergenic
1147357859 17:39911647-39911669 CTCAGTACCTACTGTGTGCTTGG + Intronic
1147418871 17:40312178-40312200 TTGGGTGCCCACAATGTGGTTGG + Intronic
1147604694 17:41767861-41767883 CTAAGTAACCACCATGTGGAAGG + Intronic
1147854383 17:43467810-43467832 CTGAGCACCCAGTATGTGCGAGG - Intergenic
1147900785 17:43782546-43782568 CTGAGCAACTACTATGTGCTAGG + Intronic
1148107472 17:45127115-45127137 CTGAGCACCCACTATGGGCCAGG - Intronic
1148336953 17:46848370-46848392 CTGAGTACCTACTATGTGCTGGG + Intronic
1148578315 17:48726608-48726630 CTGGGTACCCAGTATGTGCAGGG - Exonic
1148678238 17:49457479-49457501 TTGAGCACCTACTATGTGGCAGG + Intronic
1148869184 17:50645923-50645945 CTGAGCACCTACTATGTGCTAGG + Intronic
1148921638 17:51040566-51040588 CTGAGTACCTATAATGTGCTAGG + Intronic
1149018495 17:51936177-51936199 CTGAGGACCTACTATGTGTCAGG + Intronic
1149061884 17:52432420-52432442 TTGAGTACTTGCTATGTGGTAGG + Intergenic
1149237187 17:54606191-54606213 CTGAGTGTCCACTAAGTGCTAGG - Intergenic
1149288918 17:55196695-55196717 CTGAGTACTTCCTATGTGCTAGG - Intergenic
1149835982 17:59912999-59913021 CTGAGTACCTATTATGTGCCAGG - Intronic
1150174902 17:63043280-63043302 CTGAGAACCCATTAAGTGATGGG - Intronic
1150279681 17:63922133-63922155 CTGCGTGTCCACTATGTGCTTGG + Intergenic
1150494836 17:65599362-65599384 CTGAACACCTACTATGTGCTGGG + Intronic
1150840558 17:68601729-68601751 CTGAGCACCTACTATGTGCCAGG - Intergenic
1150851287 17:68705967-68705989 TTGAGCACCCACTATGTGTCAGG - Intergenic
1151200133 17:72461849-72461871 CTGAGTGCCTACTAAGTGCTGGG - Intergenic
1151539246 17:74756833-74756855 CTGAACACCTACTATGTGTTAGG - Intronic
1151697591 17:75725765-75725787 CTGAGGACCCACTGTGTGCCAGG + Intronic
1151773457 17:76180502-76180524 CTGAGTATCTACTATGTGCCAGG + Intronic
1153225261 18:2895069-2895091 CTGAGCCCCTATTATGTGGTAGG + Intronic
1153256131 18:3173316-3173338 TTGAATACCCACTCTGTGGCAGG + Intronic
1153364154 18:4235220-4235242 ATGGGTGTCCACTATGTGGTGGG - Intronic
1153539886 18:6142246-6142268 CTGAGCACTAACTATGTGTTGGG - Intronic
1153718706 18:7879493-7879515 CTGAGCACCCATTATGTATTGGG - Intronic
1154152653 18:11918818-11918840 CTGAGCACTAACTATGTGGCAGG - Intergenic
1154279993 18:12994073-12994095 CTGAGTACCTGCTGTGTGCTAGG + Intronic
1154307425 18:13240772-13240794 CTGAAGACCTACTATGTGCTAGG - Intronic
1154477387 18:14776218-14776240 CTGAGTACCAACTGTGTGCTAGG + Intronic
1154482009 18:14839103-14839125 TTGAGTACCAACTGTGTGCTAGG + Intronic
1154941246 18:21114613-21114635 CTGAGTGCTCACCATGTGCTAGG + Intergenic
1155096127 18:22558275-22558297 TTGAGTACTTACTATGTGCTAGG + Intergenic
1155149956 18:23115322-23115344 CTGAGTACCCCCAATGTGCCAGG + Intergenic
1155150331 18:23117883-23117905 CTGAGTACCTACTATGTGCCAGG + Intergenic
1155437557 18:25828950-25828972 TTGAGTACATACTATGTGATAGG + Intergenic
1155528808 18:26744928-26744950 TTGAGCACCTACTATGTGCTGGG - Intergenic
1156013852 18:32525950-32525972 CTGAGTATCTACCATGTGCTAGG - Intergenic
1156108353 18:33692703-33692725 CTGAGCACCTACTATGTGCTAGG - Intronic
1156834258 18:41533605-41533627 CTGAGTACTGACTATGTGCTGGG + Intergenic
1156869083 18:41923797-41923819 TTGAGTACCTACTATGTGCTAGG - Intergenic
1157194220 18:45607449-45607471 CTGAGTACCAACTATGTGGTAGG - Intronic
1157396741 18:47347931-47347953 CTGAGCACCTACTATGTGTCAGG - Intergenic
1157539680 18:48491540-48491562 TTTAGTACCCACTATGTGCTAGG + Intergenic
1157743204 18:50111910-50111932 CTGAGTACCTACTATGTGCCAGG + Intronic
1157879099 18:51303117-51303139 TTGAGCACCTACTATGTAGTAGG + Intergenic
1157982445 18:52396943-52396965 TTGAGTACCCACTATATGCTTGG - Intronic
1158131015 18:54152740-54152762 GTGAGCACCCACTATGTGCCAGG + Exonic
1158134775 18:54195660-54195682 CTGAGTGCCTACTATGTGGCAGG + Intronic
1158150331 18:54360304-54360326 TTGAGTACCTACTATGTGGCTGG - Intronic
1159531790 18:69664726-69664748 CTGACTACCCACAATGTGCCAGG + Intronic
1160021603 18:75185798-75185820 CTGAGTACCTGCTATGTGTATGG + Intergenic
1160350061 18:78170533-78170555 CCGAGTTCCCACTCTGTAGTGGG - Intergenic
1160431021 18:78812586-78812608 CTGAGTGCCCACTATGTGTCAGG - Intergenic
1160479639 18:79226941-79226963 CTGAACACCCACTGTGTGTTGGG + Intronic
1160564041 18:79775922-79775944 CTGAGTGCCCGCTCTGTGCTGGG - Intergenic
1160937377 19:1603289-1603311 TTGAGCACCTACTATGTGTTAGG - Intronic
1161082628 19:2319057-2319079 TTGAGTATCCACTCTGTGGCTGG - Intronic
1161473188 19:4471506-4471528 CTGAGTACCTACTATATGCCAGG - Intergenic
1161625053 19:5321581-5321603 GTGAGTACCCACTGTGTGCCAGG + Intronic
1161881537 19:6957791-6957813 TTGAGTATCTACTATGTGCTAGG - Intergenic
1162043468 19:7984191-7984213 CTGAGCACCTACTATGTGTCAGG + Intronic
1162306893 19:9880296-9880318 CTGAGCACCCACTATGTGCCAGG + Intronic
1162754501 19:12849190-12849212 TTGAGTACCTACTGTGTGCTGGG - Intronic
1163201613 19:15773843-15773865 CTGAGTATCTACTATGTGCTAGG + Intergenic
1163257582 19:16166728-16166750 TTGAGCACCTACTATGTGTTGGG + Intronic
1163284770 19:16339464-16339486 CTGAGCACCTACTATGTGTCAGG - Intergenic
1163342745 19:16720176-16720198 CTGAGCACCTACTATGTGCCAGG + Exonic
1163601155 19:18249965-18249987 CTGAGCACCTACTATGTGCTGGG - Intronic
1163681088 19:18683169-18683191 CTGAGCACCTACTATGTGCCAGG - Intergenic
1164155394 19:22593311-22593333 TTGAGTACCTACTATGTGCAAGG + Intergenic
1164490305 19:28705514-28705536 TTGAGTACCTACTATGTGCAGGG - Intergenic
1164547532 19:29181368-29181390 CTGAATACCTACTATGTGGCAGG + Intergenic
1164708279 19:30336318-30336340 CTGAGCACCTACTATGTGCCAGG - Intronic
1165065287 19:33225109-33225131 CTGAGTACCTACTGTGTGCAGGG - Intronic
1165315474 19:35052788-35052810 CTGAGAACCTACTATGTGCCAGG - Intronic
1165320880 19:35084471-35084493 CTGAACACCCACTAAGTGCTAGG + Intergenic
1165347260 19:35256661-35256683 CTGAGTACCACCTATGTTCTAGG - Intronic
1165559131 19:36664009-36664031 TTGAGTACCTACTATGTGACAGG - Intronic
1165714830 19:38037592-38037614 CTGAGTTCCCACTCTTTGGCAGG + Intronic
1166063497 19:40342480-40342502 CTGAGAACCTACTATGTGTAAGG + Intronic
1166374904 19:42322254-42322276 CTGAGAACCCATCATGTGCTGGG + Intronic
1166570780 19:43795612-43795634 CTGAGCACCTACTATGTGCAAGG - Intergenic
1166660766 19:44645883-44645905 TTGAGGACCTACTATGTGCTAGG + Intronic
1166847867 19:45740940-45740962 TTGAGCACCCACTAAGTGTTAGG + Intronic
1166889075 19:45979242-45979264 CTGAGCACCTACTATGTGTTGGG + Intergenic
1166985217 19:46655753-46655775 CTGAGCACCCACTTTGTGCCAGG - Intronic
1167143498 19:47668203-47668225 CTGCGGGCCCACTATGTGCTGGG - Intronic
1168144140 19:54410185-54410207 TTGAGAACCTACTATGTGCTAGG + Intergenic
1168473769 19:56661460-56661482 CTGAGGACCTACTGTGTGCTTGG + Intergenic
925153415 2:1632890-1632912 CTGAGTATCCACCATGTGCCAGG - Exonic
925218722 2:2120878-2120900 TTGAGTGCGCACTGTGTGGTGGG + Intronic
925956183 2:8967734-8967756 CTGAATACCCATTATGTGTTTGG - Intronic
926038389 2:9653061-9653083 CAGAGCACCTACTATGTGCTGGG - Intergenic
926049446 2:9735109-9735131 CTGAGCACCCACTATGTACCAGG + Intergenic
926356492 2:12045494-12045516 TTGAGTACCCAGTATGTGCCAGG + Intergenic
926446784 2:12952579-12952601 CTGAGCTCCTACTATGTGGCAGG + Intergenic
926768551 2:16347278-16347300 CTGACTACCCACCATGTGCTAGG - Intergenic
926980539 2:18562398-18562420 CTGAGTACCTACCATTTTGTAGG - Intronic
927250669 2:20992608-20992630 CTGAGCACCTACTGTGTGCTGGG + Intergenic
927253438 2:21018822-21018844 CTGAGTACCCAATAAGCGGCAGG - Intronic
927253446 2:21018867-21018889 CTGAGTACCCACTAAGCGGCAGG - Intronic
927450820 2:23207805-23207827 CTGAGCACCTACTATGTGCCAGG - Intergenic
927751692 2:25675192-25675214 TTGAGCACCCCCTATGTGGAAGG + Intergenic
928103149 2:28451123-28451145 CTGAGCACCTACTATGTGTCAGG - Intergenic
928151636 2:28835571-28835593 TTGACTACCCACTATGTGCCAGG - Intronic
928273411 2:29877547-29877569 CTTAATACCTACTATGTGATAGG - Intronic
928425744 2:31176387-31176409 CTGAGCACCCACTTTGTGCCAGG - Intronic
928610261 2:32985697-32985719 TTGAGTACCTACCATGTAGTAGG + Intronic
928871103 2:35981007-35981029 CTGAGTATCTACTATGTGTCAGG - Intergenic
929239390 2:39638400-39638422 CTGAGTACTCATTATGTGCCAGG + Intergenic
929569117 2:43008947-43008969 TTGAGTGCCTACTATGTGCTAGG + Intergenic
929743832 2:44634565-44634587 TTGAGTACCTACGATGTGCTAGG + Intronic
929755796 2:44763470-44763492 CTGAGTGCTTACTATGTGCTAGG + Intronic
929900039 2:45992895-45992917 TTGAGGACCTACTATGTGCTGGG - Intronic
929911330 2:46091724-46091746 CTGAGTACTTACTCTGTGGCAGG - Intronic
930094903 2:47559664-47559686 CTGCATACCTACTATGTGCTGGG + Intronic
931165433 2:59742077-59742099 CTGAGTTCCTACTATGTGCATGG + Intergenic
931186350 2:59955114-59955136 CTGAGTGCCCACTATGTTCCAGG - Intergenic
931320875 2:61174065-61174087 CTTGGTGCCCACTATGTGCTGGG + Intergenic
931507655 2:62949310-62949332 CTAAGTCCCCACTATTTGGGAGG + Intronic
931859791 2:66342716-66342738 CTGAGTACCTACTATGTGCTAGG - Intergenic
931907681 2:66860136-66860158 TTGAGAGCCTACTATGTGGTAGG - Intergenic
931961612 2:67489123-67489145 TTGAGCACCTACTATGTGCTAGG - Intergenic
932342390 2:70974543-70974565 CTGGGTGCCCACTATATTGTAGG - Intronic
932399472 2:71469955-71469977 CTGAGTACCTACTACGTGCCTGG + Intronic
933570085 2:84000253-84000275 CTTAGTACCTACTATGTGTCAGG + Intergenic
933615615 2:84479635-84479657 CTCCGTACCCACTCTGTAGTGGG + Intergenic
934919645 2:98332456-98332478 CTGAGCACCTATTATGTGCTTGG - Intronic
935093911 2:99925513-99925535 CTGAGTGCCGACTATGTGCCAGG - Intronic
935626511 2:105176242-105176264 CTGAGTACCCACTCTGTGCCTGG + Intergenic
935984453 2:108659316-108659338 GTGAGTGCCTACTATGTGTTAGG - Intronic
936136890 2:109902964-109902986 GTGAGTGCCTACTATGTGTTAGG - Intergenic
936207807 2:110468521-110468543 GTGAGTGCCTACTATGTGTTAGG + Intronic
937000786 2:118465446-118465468 TTTAGTACCTACTATGTGCTAGG - Intergenic
937156256 2:119721572-119721594 CTGAGACCCCACCTTGTGGTTGG + Intergenic
937644936 2:124255859-124255881 TTGAGTACCTACTATGTGCCTGG - Intronic
937764043 2:125639207-125639229 CTGAGCACTTACTATGTGGTAGG + Intergenic
938558246 2:132446251-132446273 GTGAGCACCCACTATGTGCCAGG + Intronic
938932527 2:136099316-136099338 TTGAGCAACTACTATGTGGTAGG - Intergenic
939097738 2:137854003-137854025 CTGAGCACCTACTATTTGATGGG - Intergenic
939586579 2:144013225-144013247 TTGAGTACCTAATATGTGATGGG + Intronic
939639848 2:144627318-144627340 CTGAGTACCAACTGGGTGCTGGG + Intergenic
940164932 2:150760602-150760624 CTGAGTATCCATTTTGTGCTAGG + Intergenic
940324181 2:152407868-152407890 CTGAGTACCTACTGTGTGCCAGG - Intronic
940522230 2:154765503-154765525 CTGAGTGCCAACTATGTGCAAGG - Intronic
940538092 2:154972174-154972196 CTGAGCACCCACTATGTGGCAGG + Intergenic
940749059 2:157603357-157603379 CTGACTGCCCACTATGTGCATGG + Intronic
940760150 2:157729799-157729821 TTGAGCACCTACTATGTGCTTGG - Intergenic
941695207 2:168544043-168544065 CTGAGTACCCACAGTGTGCCAGG + Intronic
941782374 2:169459120-169459142 TTGAACACCCACTATGTGATAGG + Intergenic
941921745 2:170857804-170857826 CTGAGTACCCACTGTGTGCCAGG + Intronic
942255298 2:174091083-174091105 TTGAGCACCCACTATGTGCCAGG - Intronic
942473678 2:176291394-176291416 CTGATTACCTGCTATGTGCTAGG + Intronic
942981405 2:182087590-182087612 CTGAGTACCTACTGTGTGCCAGG - Intronic
943201655 2:184835002-184835024 CTGACTACCTACTATTTGGCAGG + Intronic
944307000 2:198189869-198189891 CTGAGGACTTACTATGTGTTGGG - Intronic
944581699 2:201137666-201137688 CTGGATGCCCACTATGAGGTAGG + Intronic
944882845 2:204031990-204032012 CTGAGTGCCTACTATGTGTCAGG + Intergenic
944884212 2:204046505-204046527 TTGAGCACGCACTATGTGTTAGG + Intergenic
944924997 2:204455419-204455441 CTGAGAGCCCACTATGTGCTGGG - Intergenic
944936508 2:204574837-204574859 CTGAGTAGAAACTATGTGTTGGG - Intronic
945112225 2:206370873-206370895 CTGAGAACCTACCATGTGCTAGG + Intergenic
945786688 2:214248254-214248276 CTGAATACCTGCTATGTGCTGGG + Intronic
945871449 2:215231167-215231189 CTGAGGACCTACTGTGTGCTAGG - Intergenic
945916469 2:215709729-215709751 TTGAGAACTCACTATGTGCTGGG - Intergenic
946033501 2:216723767-216723789 CTGAGTACCTACTATGTGCCAGG + Intergenic
946047401 2:216832755-216832777 CTGAGGACCTACTGTGTGTTAGG + Intergenic
946132544 2:217618064-217618086 CTGAGTACCTACTATGTGCCAGG + Intronic
946252255 2:218420897-218420919 TTGAGCACCTACTATGTGCTAGG + Intronic
946270813 2:218591940-218591962 CAGAGTACCTACTATGTGCCCGG - Intronic
946411646 2:219518113-219518135 CTGGGTGCCTACTATGTGTTGGG + Intronic
946581708 2:221135266-221135288 CTGAGTACCCACTTTGATATTGG - Intergenic
946835156 2:223765106-223765128 CTGAGTACTTACTCTGTGCTGGG - Intronic
946845819 2:223858138-223858160 TTAAGTACCTACTATGTGCTAGG + Intronic
946994702 2:225378238-225378260 CTGAGTATTAACTATTTGGTAGG + Intergenic
947333843 2:229059393-229059415 CTGAATACCTATTATGTGCTAGG + Intronic
947339079 2:229118081-229118103 TTGAGTACTTACTATGTGCTAGG - Intronic
947652638 2:231799947-231799969 TTGAGTACCTACTATGGGTTAGG - Intronic
947714783 2:232334038-232334060 CTGAGCACCCACTGTGGGGGTGG - Intronic
947813479 2:233020548-233020570 CAGAGCACCCACTGTGTGCTGGG + Intergenic
948417836 2:237828000-237828022 CTGAGCACCTACTATGTGCCAGG - Intronic
948706720 2:239798540-239798562 CTGAGTGCCCGCTGTGTGGCAGG - Intronic
948967609 2:241395737-241395759 CTGAGTGCCTACTATGTGGGGGG + Intronic
949001436 2:241616390-241616412 CTGCTTACCCGCTCTGTGGTGGG - Intronic
1168796452 20:612912-612934 CTGAGCACCTGCTATGTGCTAGG + Intergenic
1168841726 20:914122-914144 TTGAGTACCTACTGTGTGTTCGG + Intronic
1168887222 20:1267966-1267988 CTGAGAACCTACTATGTGCCAGG - Intronic
1168980689 20:2001265-2001287 CTGAGTACCTACTATGTTCTGGG + Intergenic
1169033296 20:2430052-2430074 TTGAGCACCTACTATGTGCTAGG - Intronic
1169266426 20:4170022-4170044 CTGAGCACCTACTATGTAGCAGG - Intronic
1169309397 20:4522111-4522133 CTCAGTACCCACCAAATGGTGGG + Intergenic
1169368373 20:5009579-5009601 CTGAGAACTTACTGTGTGGTAGG - Intronic
1169510267 20:6256257-6256279 CTGAGCACCTACTATGTGCCAGG - Intergenic
1169546179 20:6653220-6653242 TTGAGCATCCACTATGGGGTGGG - Intergenic
1169611953 20:7391312-7391334 CTGAGTATCCACAATGTCCTAGG + Intergenic
1170177366 20:13487247-13487269 TTGAGTCCCTACTCTGTGGTAGG + Intronic
1170240982 20:14165728-14165750 CTGAGTAGCCATTCTGTGGCAGG - Intronic
1170261779 20:14416694-14416716 TTGAGTACCCACTATGTGCCAGG + Intronic
1170587281 20:17744402-17744424 CTGAGCACCTACTATGTGCCTGG + Intergenic
1171057956 20:21926266-21926288 TTGAGTACCTACTATGTCCTAGG - Intergenic
1171162734 20:22942647-22942669 CTGAGCAACCACCATGTGGCAGG + Intergenic
1171968463 20:31548568-31548590 CTGAGCACCCACTATGTGCCAGG + Intronic
1172108203 20:32529048-32529070 CTGACTACCTACTATGTGTCAGG - Intronic
1172266978 20:33624681-33624703 CTGAGAACCTACTATGTATTAGG - Intronic
1172600682 20:36180499-36180521 CTGAGCACCTACTATGTGCTTGG - Intronic
1172801297 20:37578119-37578141 CTGAGCACCTACTATGTGCCAGG + Intergenic
1172830703 20:37831760-37831782 CTGAGTACCAACTATGTGCCAGG - Intronic
1172880564 20:38197043-38197065 CTGAGTACCTGCTATGTGCCAGG + Intergenic
1172901927 20:38341598-38341620 CTGATCACCAACTATGTGGCAGG - Intergenic
1172937858 20:38633429-38633451 TTGAGTACTCACTATGTGTCGGG + Intronic
1173056056 20:39613888-39613910 CTGAGTGCCTACTATGTGCCAGG - Intergenic
1173059446 20:39647625-39647647 CTGAGTATTTACTATGTGCTGGG - Intergenic
1173258160 20:41409955-41409977 ATGAGTAACCACTAGGTAGTGGG + Intronic
1173354206 20:42271564-42271586 CTGAGTACCTACTATGTGTCAGG - Intronic
1173446610 20:43124678-43124700 CTGAGTGCCTACTATGTGCCAGG + Intronic
1173447841 20:43136360-43136382 TTGAGCACCTACTATGTGCTGGG - Intronic
1173560437 20:44001382-44001404 CTGAGTACCTACTATGTGCCAGG - Intronic
1173673895 20:44817293-44817315 GTGAGCACCTACTATGTGTTAGG - Intergenic
1173787485 20:45804994-45805016 CTGAGTACTCACAATATGCTAGG - Intronic
1173823501 20:46032924-46032946 CTGAGCACCTATTATGTGCTGGG + Intronic
1173837109 20:46133083-46133105 CTGAGTGCTCACTATGTGCTAGG + Intergenic
1173866502 20:46315920-46315942 TTGAGTACCTACTATGTGCCAGG - Intergenic
1173907769 20:46641291-46641313 CTGAGCACCTACTATGTGTCAGG + Intronic
1174024021 20:47557310-47557332 TTGAGTGCCCACCATGTGTTAGG + Intronic
1174045261 20:47728556-47728578 CTGAGCACCTACGATGGGGTGGG + Intronic
1174200609 20:48804184-48804206 CTAAGCACCCACTATGTGCCAGG + Intronic
1174251648 20:49224326-49224348 TTGAGCACCCACTATGTGGCTGG - Intronic
1174275193 20:49398493-49398515 CTGAGTACCGACAATGTGTCAGG + Intronic
1174305991 20:49614706-49614728 CTGAGCACCTACTATGTTGCAGG - Intergenic
1174393419 20:50232058-50232080 CTGAGCACCTACTGTGTGCTGGG - Intergenic
1174399289 20:50267372-50267394 CAGAGTGCCCAGCATGTGGTAGG - Intergenic
1174456808 20:50654579-50654601 CTGAGTGCCTCCTATGTGTTAGG - Intronic
1174505015 20:51011762-51011784 CTGAATACCTACTATGTGCCAGG - Intronic
1174557402 20:51405716-51405738 CTGAGCACCTACTATGTGCTGGG - Intronic
1174709396 20:52688884-52688906 CAGAGTACGTACTATGTGCTTGG + Intergenic
1174752657 20:53127200-53127222 TTGAGTGCCCACTAAGTGTTGGG + Intronic
1174792789 20:53496119-53496141 CTGAGCACCTACTATGTGTCAGG + Intergenic
1174830614 20:53808814-53808836 CTGAGCACCTACTATGTGCCAGG - Intergenic
1174830622 20:53808893-53808915 CTGAGTACCCACTCTGTGCCAGG - Intergenic
1174879700 20:54265794-54265816 TTGAGTACCTACTATTTGCTTGG + Intergenic
1175102267 20:56587819-56587841 CTGAGCACCTACTATGTGCCAGG + Intergenic
1175192503 20:57221057-57221079 CTGAGCACCTACTATGTGCCAGG + Intronic
1175263887 20:57691158-57691180 TTGAGCACCTACTGTGTGGTGGG - Intronic
1175373476 20:58508701-58508723 CTGAGTACCTACTATGTGCCAGG + Intronic
1176185192 20:63774588-63774610 CTGAGTGCCAGCTATGTGCTAGG + Intronic
1176725659 21:10430389-10430411 TTGAGTACCAGCTATGTGCTAGG - Intergenic
1176991401 21:15501557-15501579 TTGAGTACCTACTATGTGCCTGG + Intergenic
1177089349 21:16747732-16747754 TTGAGTACCCAATATGTACTAGG + Intergenic
1177186165 21:17799802-17799824 TTGAGTACCCACTATGTGCCCGG - Intronic
1177756801 21:25358259-25358281 CTGAGTACCTACTGTGTGCCAGG - Intergenic
1177757724 21:25367817-25367839 TTGAGTGCCTACTATGTGGCAGG + Intergenic
1178095931 21:29215705-29215727 TTGAGCACCTACTATGTGATAGG - Intronic
1178343463 21:31805511-31805533 TTGAGCACCTACTATGTGCTAGG + Intergenic
1178928952 21:36800300-36800322 CGGAGTACCCACTGTGTGCCAGG - Intronic
1180643114 22:17315451-17315473 CTGAGAGCCCACTATGGGGCAGG + Intergenic
1180848341 22:18996891-18996913 CTGAGCACTTATTATGTGGTAGG - Intergenic
1180978719 22:19868576-19868598 TTGAGCACCTACTATGTGGCAGG + Intergenic
1181185384 22:21099691-21099713 CTGAGTGCCTACTGTGTGGCAGG + Intergenic
1181365249 22:22371516-22371538 CTGAATACCTACTATGTGCCAGG + Intergenic
1181567460 22:23748064-23748086 CTGAGCACCTACTCTGTGCTAGG + Intronic
1181765006 22:25085163-25085185 CTGAGCACCTACTCTGTGCTGGG + Intronic
1181765468 22:25088436-25088458 CTGAGTACCCACCAGGTGCCAGG + Intronic
1181863263 22:25835617-25835639 TTGAGCAGCCACTATGTGCTGGG + Intronic
1181888784 22:26042763-26042785 TTGAGTACCTATTATGTGCTAGG + Intergenic
1181918608 22:26301348-26301370 CCGAGCGCCCACTGTGTGGTAGG + Intronic
1181945463 22:26513600-26513622 CTGAGTACATACTATGTGTCAGG - Intergenic
1182001338 22:26922226-26922248 CTGAGTACCTACTATGTACCTGG + Intergenic
1182044774 22:27265656-27265678 ATGAGTGCCTACTATGTGGCAGG - Intergenic
1182125779 22:27814962-27814984 TTGAGCACCTACTATGTGCTGGG + Intergenic
1182125963 22:27816027-27816049 CTGAGCACCTACTATGTGCCAGG + Intergenic
1182167192 22:28188011-28188033 TTGAGTGCCTACTATGTGCTAGG + Intronic
1182243590 22:28936584-28936606 CTGAGTAGCTACTTGGTGGTGGG + Intronic
1182319494 22:29469472-29469494 TTGAGCACCCACTAAGTGCTGGG - Intergenic
1182575269 22:31268727-31268749 CTGAGTGCCCTCTATATGCTAGG + Intronic
1182713944 22:32340371-32340393 CTGAGCACCTACTATGTGTCAGG + Intergenic
1182833579 22:33323310-33323332 CTGGGTACCTACTATGTGACTGG + Intronic
1183099404 22:35574707-35574729 CTGAGTACCTACTATGTGCCAGG - Intergenic
1183323952 22:37181252-37181274 CTGAGCACTCACTCTGTGCTGGG - Exonic
1183329824 22:37213380-37213402 CTGAGCACCTACTATGTGCCAGG + Intergenic
1183364866 22:37401555-37401577 CTGAGGGCCCACTGTGTGATTGG - Intronic
1183391294 22:37546828-37546850 CTGAGCACCTACTATGTGCCAGG - Intergenic
1183669513 22:39264266-39264288 CTGAGGGCCCACTGTGTGCTGGG + Intergenic
1183693211 22:39403121-39403143 CTGAGCACTCACTATGTGCTAGG + Intronic
1183706587 22:39478320-39478342 CTGAGTGCCCACTGGGTGTTGGG + Intronic
1184057473 22:42062116-42062138 TTGAGTACCTACCATGTGCTGGG - Intronic
1184112470 22:42403397-42403419 CTGAGCACCTACTATGTGTCAGG - Intronic
1184163200 22:42711591-42711613 TTGAGCACTTACTATGTGGTAGG - Intronic
1184180474 22:42820500-42820522 CTGAGCACCTACTATGTGCCAGG + Intronic
1184272703 22:43393656-43393678 CTGAGCACCTACTATGTGTCAGG + Intergenic
1184341794 22:43890180-43890202 CTGAGCACCTACTATGTGCCAGG - Intronic
1184372039 22:44088820-44088842 CTGAGCACCTACTATGTGCAGGG - Intronic
1184402327 22:44281241-44281263 CTGAGCAGCTACTATGTGCTGGG + Intronic
1184402893 22:44284259-44284281 CTGAGGACCTACTATGTGCCAGG + Intronic
1184450580 22:44580259-44580281 CTAAGTACCTACTCTGTGCTGGG + Intergenic
949097480 3:102821-102843 CCAAGTACCCACTATGTGTGAGG + Intergenic
949293331 3:2491169-2491191 CTGAGTACGTACTATGTGCTGGG - Intronic
949316682 3:2764112-2764134 CTGAGTGCCTACTCTGTGCTGGG + Intronic
949471860 3:4404852-4404874 TTGAGTACCTAGTATGTGCTGGG - Intronic
949482858 3:4510583-4510605 CTGAATACCTACTATGTGCTAGG + Intronic
949868385 3:8565887-8565909 CTGAGTACTTACTAAGTGCTAGG - Intronic
949922569 3:9014395-9014417 CTGAGCAACCACTATGTGTCAGG - Intronic
950055611 3:10021887-10021909 CTGAGTGCCCACTGTGTGCCTGG - Intergenic
950120000 3:10475451-10475473 TTGAGCACCTACTATGTGTTGGG + Intronic
950178373 3:10893024-10893046 ATGAGCACCTACTATGTGCTAGG - Intronic
950186568 3:10949143-10949165 CTGAGTACCTACTGTGTGCTGGG - Intergenic
950293801 3:11810226-11810248 TTGAGTACCTACTGTGTGCTGGG - Intronic
950317266 3:12014144-12014166 CAGAGAACCCACTATCTAGTGGG - Intronic
950376791 3:12579107-12579129 CTGAGTACTCACTATGGGTCAGG + Intronic
950471156 3:13187168-13187190 CTGAGTATCTACTATGGGTTAGG + Intergenic
950500604 3:13361237-13361259 CTGAGCACCCGCTATGTGCCAGG - Intronic
950545148 3:13633832-13633854 ATGAGCACCTACTATGTGCTGGG - Intronic
950668824 3:14513171-14513193 CTGAGCACCTACTATGTGCCAGG + Intronic
950669435 3:14517263-14517285 CCCAGCACCCACTGTGTGGTGGG - Intronic
950711408 3:14815527-14815549 TTGAGTACCAACTATGTGCCAGG - Intergenic
950746067 3:15090213-15090235 CTGAGCATCCACTTTGTGTTAGG - Intronic
951038630 3:17963357-17963379 CTGAATACCTACTATGTGCTAGG - Intronic
951355291 3:21659736-21659758 TTGAATACCTACTATGTGTTAGG - Intronic
951409211 3:22341863-22341885 CTGAGCACCTACTATGTGCCTGG - Intronic
951605398 3:24428237-24428259 TTGAGTACCTACTATGTGCCTGG + Intronic
951710705 3:25582928-25582950 CTAAGTACCTACTACGTGCTAGG - Intronic
951819723 3:26794689-26794711 CTGGGTACATACTATGTGTTAGG + Intergenic
952170457 3:30800683-30800705 CTCAGTACCTACTAAGTGTTAGG - Intronic
952286909 3:31978374-31978396 TTGAGCACCTACTATGTGGCAGG - Intronic
952300299 3:32098886-32098908 TTGAGTGCCCACTCTGTGCTAGG + Intergenic
952422328 3:33143502-33143524 TTGAGTACCTACTGTGTGCTAGG + Exonic
952495416 3:33911716-33911738 CTGAGCACCTACTGTGTGCTGGG - Intergenic
952790842 3:37199499-37199521 CTGAGAACCTACTATGTGTCAGG - Intergenic
953140686 3:40226767-40226789 CTGAGTGCTCACTGTGTGCTAGG - Intronic
953188783 3:40663997-40664019 CTGTGTACCTACTATGTGCTGGG - Intergenic
953329022 3:42036320-42036342 CTGAGTACCTACTATGTACCAGG - Intronic
953368416 3:42366749-42366771 CCGAGTACCTACTATGTGCCAGG + Intergenic
953718053 3:45332829-45332851 CTGAGCACCTACTATGTGAAAGG + Intergenic
953962933 3:47281090-47281112 CTGAATACCTACTCTGTGCTGGG - Intronic
954446567 3:50550075-50550097 CTGAGCACCCACTATGTGGCAGG + Intergenic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955065260 3:55528474-55528496 CTGAATACCTACTATGTGCTGGG + Intronic
955088943 3:55730491-55730513 CTGAGCACCTACTATGTGCCTGG + Intronic
955152669 3:56383535-56383557 TTGAGTATCCACTATGTGCCAGG - Intronic
955188319 3:56736191-56736213 TTGAGTACCCAGTATGTGCCAGG + Intronic
955391230 3:58523885-58523907 TTCAGTACCTACTATGTGTTAGG - Intronic
955397793 3:58569410-58569432 CTGAGTACCTACTATGTGCTGGG - Intronic
955405543 3:58623485-58623507 CTGAGCACCCACTGAGTGCTGGG + Intronic
955766953 3:62354936-62354958 CTGAACACTCACTATGTGTTGGG + Intergenic
955811053 3:62789902-62789924 TTGAGGGCCCACTATGTGTTTGG + Intronic
955863459 3:63356715-63356737 CTGAGTACCTAGTATGTGCCAGG - Intronic
955945041 3:64185477-64185499 CTGAGTGCCAACTACGTGTTAGG + Intronic
955961532 3:64345965-64345987 CTGAGAACCCACTATCTGCCAGG + Intronic
956084261 3:65592997-65593019 TTGAGTGCCTACTATGTGGTAGG - Intronic
956156593 3:66304720-66304742 CTGATTAACCACCATGTGGGTGG + Intronic
956190585 3:66604043-66604065 CTGAGCACCTACTATGTGCCAGG - Intergenic
956230662 3:67012440-67012462 TTGAGTGCCTACTATGTGCTAGG - Intergenic
956296269 3:67717011-67717033 CTGAGTACTTACTGTGTGCTAGG - Intergenic
956724765 3:72147913-72147935 CTGAGTACCTACTATGTGCCAGG - Intergenic
956951246 3:74285608-74285630 CTGAAGACCTACTATGTGCTAGG + Intronic
956957401 3:74356606-74356628 TTGAGTACCTACTATATGCTAGG - Intronic
957056707 3:75448847-75448869 CTCAGCACCCACTACATGGTGGG + Intergenic
957927501 3:86833257-86833279 CAGAGTGCCTACTATGTGGCAGG + Intergenic
958447601 3:94234505-94234527 TTGAGTGCCCGCTATGTGATAGG + Intergenic
958885257 3:99719355-99719377 CTGAGTGCCTACTATGGGCTAGG - Intronic
959159531 3:102706606-102706628 CTGAGTCCCCACTATGTTCCAGG + Intergenic
959367668 3:105483278-105483300 CAGAGTGCCTACTATGTGTTAGG + Intronic
959636491 3:108578266-108578288 CTGAATAAGCACTATCTGGTGGG + Intronic
959758149 3:109924628-109924650 GTGAGTACCTACTATGTGCCTGG + Intergenic
960175858 3:114517040-114517062 CTGAGTGCCTACTATGTGCTAGG + Intronic
960240531 3:115336309-115336331 TTGAGTACCTACTATGTTCTGGG + Intergenic
960520781 3:118652744-118652766 CTGAGCACCTACTATGTGTGAGG - Intergenic
960639632 3:119813257-119813279 CTGAATGCCCACTCTGTGCTGGG - Intronic
960649175 3:119927078-119927100 CTGAGTACCTACTGTGTGCTAGG - Intronic
960671461 3:120158639-120158661 CTGAGGGCCCACTATGTGCCAGG - Intergenic
960920231 3:122739173-122739195 ATGAGTACCCAGCATGTAGTAGG - Intergenic
960944301 3:122955884-122955906 CTGAACACCTACTATGTGCTGGG + Intronic
961042772 3:123689031-123689053 CTGAGTGCCCACTCTGTGCCAGG - Intronic
961361516 3:126371014-126371036 CTGAGTACCTACTATGTGCCTGG + Intergenic
961516402 3:127440150-127440172 CTGAGGACCTACTATGTGCCAGG - Intergenic
961584434 3:127910520-127910542 CTGAGTACCTACTTTGTGCCAGG + Intergenic
961607927 3:128111300-128111322 CTGAGCACCCACTATGTGCCAGG + Intronic
961734573 3:128993481-128993503 TTGAGTACCGACTGTGTGGCAGG - Intronic
961929743 3:130520575-130520597 CTGAATACCTACTAAGTGCTAGG - Intergenic
962031297 3:131603185-131603207 TTGAGTACCCACACTGTGTTGGG + Intronic
962117802 3:132530291-132530313 CTGAGCACCTCTTATGTGGTAGG - Intronic
962341946 3:134593301-134593323 CTGAGTACTTACTATGTGCCCGG + Intergenic
962379547 3:134886672-134886694 TTGAGTACTCACTATGTGCTGGG + Intronic
962448709 3:135493203-135493225 CTGACTACCTACTAAGTGGTTGG - Intergenic
962601110 3:136991435-136991457 TTAAGTACCTACTATGTGCTAGG - Intronic
962607005 3:137040687-137040709 CTGACTACCTACTATGTGCCTGG - Intergenic
962696319 3:137950882-137950904 TTGAGTATCTACTATGTGCTGGG - Intergenic
962934682 3:140068996-140069018 TTGAATACCTACTATGTGGCAGG - Intronic
962977426 3:140457766-140457788 CTGAGTGCCTACTATGTGTCAGG + Intronic
963625969 3:147672973-147672995 CTGATAACCCACTATGTGAGAGG + Intergenic
963631934 3:147744218-147744240 TTGAGTCCCTACTATGTGCTGGG + Intergenic
963704927 3:148674939-148674961 TTGAGTACCTACTATGTGCCAGG + Intergenic
963925004 3:150942542-150942564 CTGAGCACCTACTATGTGCCAGG + Intronic
964461414 3:156934284-156934306 CTGAGCACCTACTATGTGACAGG - Intronic
964598234 3:158462989-158463011 CTGAGTTTCTACTATGTGTTAGG - Intronic
964722538 3:159781611-159781633 TTGAATGCCCACTATGTGTTAGG + Intronic
964736920 3:159927212-159927234 CTGAGTACCTATTATGTGCCAGG + Intergenic
964747106 3:160022741-160022763 GTGAGTGCCCACTATGTGGTAGG + Intronic
964875640 3:161365592-161365614 TTGAGCAGCTACTATGTGGTAGG - Intronic
964981578 3:162688395-162688417 CTGAGTACCCACTATATGCCAGG - Intergenic
965152363 3:164994804-164994826 CTGAGAACCCACAATGTGCATGG - Intronic
965327545 3:167325684-167325706 TTGAGTACACGCTATGTGGTGGG - Intronic
965447894 3:168798673-168798695 CTGAATACCTACCATGTGCTAGG + Intergenic
965453849 3:168873196-168873218 CTGAGTATCTACTATGTGTCAGG - Intergenic
965569826 3:170161086-170161108 TTAAGTACCTACTATGTGATGGG + Intronic
965707124 3:171520409-171520431 TTGTCTACCCACTATGTGCTGGG - Intergenic
965778038 3:172254519-172254541 CTGAGTACCTACTATGTGTCAGG - Intronic
966184034 3:177212502-177212524 TTGAGTACTTACTATGTGTTAGG + Intergenic
966418509 3:179714565-179714587 CTGAGCACCTACTATGTGTGAGG - Intronic
966437896 3:179908985-179909007 TTCAGTACCTACTATGTGCTGGG - Intronic
966471614 3:180295782-180295804 TTGAGTTCCTACTATGTGCTAGG + Intergenic
966564058 3:181356423-181356445 CTGAGTACTTACTATGTGCTGGG + Intergenic
966784706 3:183612574-183612596 TTGAGCACCCACTATGTGCCAGG + Intergenic
966910077 3:184554665-184554687 CTGAAGACCTACTATGTGCTAGG + Intronic
966949834 3:184806294-184806316 CTGAGTACCTATTATGTGCCAGG - Intergenic
967037866 3:185661663-185661685 CTGAGCACCTACTCTGTGGGAGG + Intronic
967277560 3:187791301-187791323 CTGAGCACCTACTATGTGTCAGG + Intergenic
967868274 3:194208068-194208090 CTGAGCTCCCACTATGGGCTGGG + Intergenic
968592996 4:1468916-1468938 CTGAGTGCCCACTAAGGGCTGGG + Intergenic
968855397 4:3116568-3116590 TTGAGCACCCACTGTGTGCTAGG + Intronic
968976638 4:3825501-3825523 TTGTGTACCCACCATGTGGCAGG - Intergenic
969035370 4:4249025-4249047 CTGAGCATCTACTATTTGGTAGG + Intergenic
969255304 4:5997276-5997298 CTGAGCATCTACTATGTGGCAGG + Intergenic
969453768 4:7289447-7289469 CTGAGCACCCACTCAGTGCTAGG - Intronic
969688258 4:8689053-8689075 CTGAGGACCCGCTATGTGCTGGG + Intergenic
969927210 4:10595868-10595890 CTGAGTGCTCACTATGTGCTAGG - Intronic
970523233 4:16906433-16906455 CTGAGTACCTGCAATGTGCTGGG + Intergenic
970590444 4:17555557-17555579 TTGAGGACCCACTATATGGCAGG - Intergenic
970738821 4:19208338-19208360 CTGAGCACCTATTATGTGCTTGG - Intergenic
970811026 4:20094149-20094171 CTGAGTATTTACTATGTGTTGGG + Intergenic
970882859 4:20952009-20952031 CTGCGTACCCACTCTGTGCTAGG - Intronic
971198415 4:24491203-24491225 CTTAGCACCTACTATGTGTTAGG + Intergenic
971258413 4:25034081-25034103 CTGAGAACCTACTATGTGCTGGG + Intergenic
971270557 4:25140625-25140647 CTGAGCACTTACTATGTGGAAGG - Intronic
971353611 4:25874448-25874470 CTGAGTGCCCACAATATGGTAGG + Intronic
971457585 4:26859179-26859201 CTGAGTACCTAGTATGTGCCAGG - Intronic
971477757 4:27088338-27088360 TTGAGAACCCACTATGTGCCAGG - Intergenic
971559822 4:28063843-28063865 TTTAATACCAACTATGTGGTGGG - Intergenic
972171355 4:36349476-36349498 TTGAGTGCCTACTATGTGCTGGG - Intergenic
972349946 4:38227209-38227231 ATGAGTACCTACTATGTGCTAGG - Intergenic
972495089 4:39627058-39627080 CTGAGGACCCACTCTCTGGTTGG + Intronic
972530739 4:39959103-39959125 GTGAGTGCCAATTATGTGGTTGG - Intronic
972566729 4:40276215-40276237 GTGAGTACCTACTATGTGCCAGG - Intergenic
972669092 4:41196355-41196377 TTGAGTACCCACTAGGTGCTAGG - Intronic
972793162 4:42392365-42392387 CTAAGCACCCACTATGTGCTAGG + Intergenic
973008112 4:45038878-45038900 CTGGGTATCTACTATGTGGCAGG + Intergenic
973295258 4:48511992-48512014 TTGAGTACCCACTACTTGCTAGG - Intronic
973340393 4:48997473-48997495 TTGAGTGCCCACTATGTGCCAGG - Intronic
973662056 4:53118252-53118274 CTGAGCACCTACTATGTGCCAGG - Intronic
973740463 4:53914924-53914946 TTGAACACCCACTATGTGGCAGG - Intronic
974440467 4:61909191-61909213 CTGAGAACTTACAATGTGGTTGG + Intronic
975340116 4:73230436-73230458 CTGAGTACTTACTAGGTGGCAGG + Intronic
975427768 4:74250522-74250544 CTGAATAGCTACTATGTGCTAGG - Intronic
975583890 4:75931104-75931126 CAGAACACCCACTATGTGGCAGG - Intronic
976097541 4:81525645-81525667 CTGAATGCCCACTATGTGCCAGG + Intronic
976210875 4:82668506-82668528 TTGAGTACCCACTATATGTCAGG - Intronic
976241136 4:82957885-82957907 CTGAGTGCTTACTATGTGGTAGG - Intronic
976525269 4:86080069-86080091 TTGAGTACCTACTATGTACTGGG - Intronic
976546081 4:86337142-86337164 TTGAGTATCTACTATGTGCTAGG - Intronic
976858575 4:89633709-89633731 TTGAGTAACCACTGTGTGGTAGG + Intergenic
977662435 4:99606214-99606236 CTCAGTACCTCCTATGTGGTAGG - Intronic
977717506 4:100198136-100198158 TTGAGTACCTACTATGTGCAAGG + Intergenic
977914696 4:102578422-102578444 TTGAGTACCTACTATGTGCCAGG + Intronic
978085255 4:104644259-104644281 CTAAGTGCCCACTATGTGCAAGG - Intergenic
978237625 4:106478412-106478434 TTGAGTACCTATTATGTGGCAGG - Intergenic
978405855 4:108377976-108377998 CTGAGTACCTACGATGTGCCTGG + Intergenic
978416974 4:108487016-108487038 CTGTGTCCTCACTATGTGCTAGG - Intergenic
978418135 4:108500985-108501007 TTGAGTACCTACTATGTGGCAGG + Intergenic
978690161 4:111498641-111498663 CTAAGTACCCAGTATGTCATTGG - Intergenic
978757749 4:112322518-112322540 TTGAGCACCTACTATGTGCTAGG + Intronic
978793258 4:112684424-112684446 TTGAGTACCTACTATGTGTCAGG - Intergenic
978818728 4:112938916-112938938 CTGAGTTCCTGCTATGTGGCAGG - Intronic
978835093 4:113139711-113139733 TTGAGTGCCCACTTTGTGTTGGG + Intronic
978961895 4:114690069-114690091 CTGAGCACCCACTCTGTGCTAGG + Intergenic
979655042 4:123182472-123182494 CTGAGTGCCTACTATGTGGGAGG - Intronic
979660311 4:123245888-123245910 CTGAGTATCTACTATGTGTCAGG - Intronic
980953523 4:139405766-139405788 TTGAGTACCTACTATGTATTTGG - Intronic
981040923 4:140220789-140220811 ATGAGCACCCACTATGTGCCAGG + Intergenic
981333565 4:143540948-143540970 CTGAGTACCCACCAGATGCTAGG + Intronic
981405508 4:144362896-144362918 CTGAGTATTCACTATGTGCAAGG - Intergenic
981450105 4:144886788-144886810 TTGAGTACTTACTATGTGCTGGG - Intergenic
981656578 4:147118625-147118647 CTAAGTGACCACTATGTGCTAGG + Intergenic
981995599 4:150970856-150970878 GTGAGCACCTACTATGTGCTGGG + Intronic
982290479 4:153776637-153776659 CTGAGTACTCAGTATGTGCAAGG - Intergenic
982655002 4:158136881-158136903 TTGAGTACCTACTATGTGGTAGG - Intronic
982707656 4:158727439-158727461 CTGAGCACCTACTATGTGTCAGG - Intergenic
982967816 4:161936522-161936544 CTGAATCCCAACTTTGTGGTTGG + Intronic
983257512 4:165416864-165416886 CTGAGTCCCCACTGTGTGCCAGG - Intronic
983501245 4:168502107-168502129 TTGAGTGCCTACTATGTGCTAGG - Intronic
983568755 4:169182033-169182055 TTGAGTGCCTACTATGTGCTGGG - Intronic
983910746 4:173236011-173236033 CTGAGTACCTACTATGTACCAGG - Intronic
984169103 4:176339976-176339998 CTGGCTACCTATTATGTGGTAGG + Intergenic
984643017 4:182190951-182190973 TTGAGTACCTACTGTGTGCTAGG + Intronic
984884103 4:184434859-184434881 CAGAGCACCTACTATGTGCTGGG + Intronic
985550715 5:532179-532201 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
985550726 5:532239-532261 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
985550749 5:532359-532381 CTCAGTTTCCCCTATGTGGTTGG + Intergenic
985897946 5:2760507-2760529 TTGAGCACCCACTGTGTGCTGGG - Intergenic
987035660 5:14015687-14015709 CTGAGCACCTACTGTGTGCTAGG - Intergenic
987342709 5:16952790-16952812 TTGAGCATCCACTATGTGGCAGG - Intergenic
988610855 5:32723322-32723344 CTGTGTAGCCCTTATGTGGTAGG + Intronic
988994465 5:36701433-36701455 TTGAGTATCTACTATGTGCTAGG - Intergenic
989061310 5:37414651-37414673 TTGAGTACCTACTATGTGCTAGG - Intronic
989196574 5:38722521-38722543 CTGATTATCTACTATGTGCTAGG - Intergenic
989237099 5:39160744-39160766 CTGAATACCTACTGTGTGCTTGG - Intronic
989254795 5:39354613-39354635 CTGAGTACCTACTATGTTCCAGG + Intronic
989371848 5:40718610-40718632 CTGAGTAGCCACCACGTGGAGGG - Intronic
989401398 5:41011462-41011484 TTGAGCACCTACTATGTGGTAGG - Intronic
989807406 5:45626380-45626402 CTGAGTGCTCACCATGTGGCAGG + Intronic
989832198 5:45933708-45933730 CTGAGAAACCACTTTGTGATTGG + Intergenic
989848441 5:46176365-46176387 CTGAGAAACCACTTTGTTGTGGG - Intergenic
990150186 5:52809190-52809212 CTAAGTACCTACTATGTGACAGG + Intronic
990171937 5:53061137-53061159 CTGAGTGCCTACTCTGTGATTGG + Intronic
990273457 5:54170858-54170880 TTGAGCACCTACTATGTGCTAGG - Intronic
990466112 5:56073302-56073324 CTGAGTGCTCACTATGTGCCAGG + Intergenic
990504318 5:56429728-56429750 CTGAGCACCTACTATGTGCCAGG + Intergenic
990670424 5:58123381-58123403 CTGAGTGCCTACTATGTGCCTGG + Intergenic
990800133 5:59592192-59592214 CTGAGTACCAACAATGTTTTTGG - Intronic
991654571 5:68891394-68891416 TTGAGCACCTACTATGTGGCAGG + Intergenic
991963510 5:72068495-72068517 TTGAGGACCTACTATGTGGCAGG - Intergenic
992226605 5:74624980-74625002 CTGAGGACCTACTATGTGCCAGG + Intergenic
992304893 5:75426666-75426688 TTGAATACCTACTATGTGCTGGG + Intronic
992382171 5:76248598-76248620 CTGAGCACCTACTATGTGCAGGG - Intronic
992497956 5:77311626-77311648 TTGAGCACCTACTATGTGCTGGG - Intronic
993550035 5:89261983-89262005 CTGAGCACTCACTATGTGCTAGG - Intergenic
993884214 5:93397488-93397510 CTGAATACCTGCTATGTGCTGGG + Intergenic
993912328 5:93698755-93698777 CTGAGTACAAACTATATGTTAGG + Intronic
993932702 5:93960556-93960578 CTGAGTGCCTACAATGTGCTAGG - Intronic
994036485 5:95207709-95207731 TTGAGAACCTACTATGTGCTAGG - Intronic
994127704 5:96187706-96187728 CTGAGTGCCCACTTTGTGCAAGG - Intergenic
994209391 5:97071559-97071581 TTGAGCACCTACTATGTGTTAGG + Intergenic
994652701 5:102549104-102549126 TTGAGTGCCTACTGTGTGGTAGG - Intergenic
994680919 5:102886857-102886879 CTGAGTACCTTCTATGTGCAAGG - Intronic
995061195 5:107813462-107813484 TTGAGTGCCCACTATGTGCTAGG + Intergenic
995068564 5:107890899-107890921 TTGAGTACCCACTATGTGTCAGG + Intronic
995130463 5:108624516-108624538 CTGATTGCCCACTTGGTGGTGGG + Intergenic
995314354 5:110751141-110751163 CTGAGTACTTACTATGTGCCAGG + Intronic
995466653 5:112456760-112456782 CTGAGTACCTAGTATGTGTTAGG - Intergenic
995513689 5:112933341-112933363 CTGAGCACCTACTATCTGCTAGG + Intergenic
996044945 5:118861644-118861666 TTGAGTACCAACTATGTGCCTGG + Intronic
996294615 5:121896839-121896861 TTGAATACCTACTATGTGCTAGG - Intergenic
996411075 5:123159916-123159938 CTGAGTACCTACTATGTGTCTGG + Intronic
996439099 5:123469575-123469597 CTGAGTGCCTACTATGTGCCAGG + Intergenic
996470653 5:123856245-123856267 CTGAGTACCCATTATATGCCTGG - Intergenic
997018725 5:129970296-129970318 TTGAGTACCTACTATGTGCCAGG - Intronic
997019984 5:129988592-129988614 CTGAGTGCCTACTATGTGCTAGG - Intronic
997201994 5:132016096-132016118 CTGAGTCCCCACTATGTGCAAGG + Intergenic
997202740 5:132022376-132022398 TTGAGTACCTACTATGTACTAGG + Intergenic
997435378 5:133870329-133870351 CTGAGTACTCACTATGTGCCAGG + Intergenic
997741107 5:136255689-136255711 TTGAGCACCTACTATGTGCTAGG + Intronic
998011787 5:138701159-138701181 TTGAGCACCTACTATGTGCTAGG + Intronic
998069057 5:139182413-139182435 CTGAGTACCCATTGTGTGCCAGG - Intronic
998105194 5:139463860-139463882 CTGAGGACCTGCTATGTGGCAGG - Intergenic
998142632 5:139708919-139708941 CTGAGTGCCTACTACGTGCTAGG - Intergenic
998224913 5:140319473-140319495 CAGAGTTCCTACTATGTGCTAGG + Intergenic
998390143 5:141782110-141782132 CTGAGCACCTACTATGTGCGAGG + Intergenic
998503746 5:142655355-142655377 CTGAGTACCTATGGTGTGGTGGG - Intronic
998652342 5:144135046-144135068 TTGAGCATCCACTCTGTGGTAGG + Intergenic
998772342 5:145560370-145560392 TTGAGCACCTACTATGTGCTGGG - Intronic
998796911 5:145830147-145830169 CTGAGTACCTACTATGTTCCAGG + Intronic
998890005 5:146735889-146735911 TTGAATACCAAATATGTGGTGGG + Intronic
998921374 5:147071842-147071864 CTGAGCACCTACTATGTGCTTGG - Intronic
999053882 5:148553079-148553101 CTGAGCACCTACTCTGTGTTAGG + Intronic
999252225 5:150189747-150189769 CTGAGCACCTACTATGTGTCAGG + Intergenic
999530811 5:152461733-152461755 ATGAGTAGCTACTATGTGCTAGG + Intergenic
999687961 5:154119110-154119132 CTGAGCACCCACTATGTCCCAGG + Intronic
999693857 5:154171201-154171223 CTGAGCACCTACTATGTGCTGGG + Intronic
1000049343 5:157548382-157548404 GTGAGTGCCAACTATGTGGCAGG - Intronic
1000180918 5:158810280-158810302 CTGAGCACCTACTATGTGCTGGG - Intronic
1000369699 5:160522954-160522976 TTGAGTACCCCCTATGTGCCAGG + Intergenic
1000631705 5:163597796-163597818 CTTGGTACCCAAAATGTGGTGGG + Intergenic
1000674250 5:164101384-164101406 CTGAGTACCTAATATGTGCTGGG + Intergenic
1001136753 5:169108845-169108867 TAGAGTACCCACTCTGTGCTAGG - Intronic
1001143601 5:169165084-169165106 CTGAGCACCTACTATGTGCCAGG - Intronic
1001302241 5:170542183-170542205 CTAAGCACCTACTATGTGGCAGG + Intronic
1001304502 5:170561752-170561774 TTGAGTTCCCACTGCGTGGTGGG + Intronic
1001306481 5:170578084-170578106 TTGAGTGCCCACTATGTGGTAGG + Intronic
1001311011 5:170610899-170610921 CTGAGTACCTAGTATGTGCGGGG + Intronic
1001314217 5:170631323-170631345 CTGAGCACCTACTATGTGCCAGG - Intronic
1001321975 5:170690100-170690122 CTGAGGACCTACTATGTGCTGGG - Intronic
1001590560 5:172861643-172861665 CTAAGTACCTACTATGTGTCAGG - Intronic
1001662094 5:173401751-173401773 CTGAGCACCTACTATGTGCCAGG + Intergenic
1001680459 5:173553282-173553304 CTGAGTGCCAACTATGCGGGAGG - Intergenic
1001858414 5:175032595-175032617 TTGAGAACCTACTATGTGCTAGG - Intergenic
1002101941 5:176862136-176862158 CTGAGCACCTACTATGTGCAGGG + Intronic
1002125673 5:177042117-177042139 CTGAGTCCCTACTATGTGCCAGG - Intronic
1002517798 5:179772630-179772652 CTGAGTACCCACTCTGTGGCAGG - Intronic
1002966310 6:1969921-1969943 CTGAGTACTCTCCATGTGGCAGG - Intronic
1003332225 6:5139023-5139045 TTGAGTACCTACTATGTTCTAGG + Intronic
1003367324 6:5487409-5487431 CTGAGTGCACACTATATGTTAGG - Intronic
1003721261 6:8705239-8705261 TTGAGTACCTACTATGTGTCAGG - Intergenic
1004034967 6:11914973-11914995 CTGAGCACCTACTTTGTGGCAGG - Intergenic
1004095331 6:12548526-12548548 CTGAGTGCCTACTATGTGCCTGG - Intergenic
1004454129 6:15775697-15775719 TTGAGTACCTACTATGTGTTTGG + Intergenic
1004477950 6:15991426-15991448 ATGAGCACCCACTATGTGCCAGG - Intergenic
1004553884 6:16676502-16676524 CTGAGTGCCTACTTTGTGCTAGG + Intronic
1004587158 6:17013574-17013596 CTGAGCACTCACAATGTGCTAGG - Intergenic
1004598716 6:17126938-17126960 CTGGGTCTCCACTATGTGCTGGG + Intronic
1004670806 6:17794782-17794804 CTGAGCACTTACTATGTGCTAGG + Intronic
1004773286 6:18811550-18811572 TTGAGCACCAACTATGTGGCAGG + Intergenic
1004946986 6:20626354-20626376 TTGAGTACCTACTATGTGCTGGG - Intronic
1004957384 6:20744386-20744408 CTGAGTGCCTACTGTGTGCTTGG + Intronic
1004991314 6:21141511-21141533 TTAAGTACCCACTATGTGTCAGG - Intronic
1005011744 6:21342364-21342386 CTGAGTACCCACTTTCAGGGTGG + Intergenic
1005081176 6:21958170-21958192 CTAAGTCCCCACTCTGTGATAGG + Intergenic
1005954170 6:30651932-30651954 TTGAGTACCTACCATGTGCTAGG - Intronic
1006130709 6:31867786-31867808 CAGAGGACCCACTATGTGCCAGG - Intronic
1006451332 6:34107351-34107373 CTGAGCACCCTCTATGTGCCTGG + Intronic
1006662052 6:35655251-35655273 CTGAATACCTACTATGTGCCAGG + Intronic
1006704451 6:36006450-36006472 TTGAGTACCTACTATGTGCTAGG + Intronic
1006930831 6:37687233-37687255 ATGAGTACCCACTACGTGTCTGG - Intronic
1007005697 6:38360309-38360331 TTGAGTACCTACTATATGCTAGG - Intronic
1007304153 6:40891359-40891381 GTGAGCACCTACTATGTGCTAGG + Intergenic
1007313510 6:40965454-40965476 CTGAGTGCCTACTATGTGCCTGG + Intergenic
1007329283 6:41091858-41091880 CTGAGCACCTACTATGTGCCAGG + Intronic
1007364227 6:41379347-41379369 CTGAGCACCTACTATGGGTTGGG + Intergenic
1007434326 6:41797837-41797859 CTGAATAAGTACTATGTGGTAGG + Intronic
1007555054 6:42758811-42758833 TGGAGTACCCACTATGTTCTAGG + Intronic
1007908376 6:45487743-45487765 CTGAGCACCCACTCTGTAGCAGG + Intronic
1007946919 6:45835255-45835277 CTGAGAACCTACAATGTGCTGGG - Intergenic
1008014061 6:46498007-46498029 TTGAGTATCCACTATGTGTTAGG + Intergenic
1008071242 6:47101097-47101119 CTGAGTAGCAACTATGTGCCAGG - Intergenic
1008546403 6:52587519-52587541 CTCAGTACCTACTATGTGGCAGG - Intergenic
1008670595 6:53764697-53764719 TTGAGCACCCACTATGTGTGAGG + Intergenic
1008690670 6:53975172-53975194 CTGAGTAACTACTATGTGCCAGG + Intronic
1008697896 6:54062838-54062860 CTAAGCACCCACTTTGTGATAGG - Intronic
1008952553 6:57176455-57176477 TTGAACACCCACTATGTGTTAGG + Intronic
1008974228 6:57405718-57405740 CTGAGTAGCCACTATGTGCCAGG + Intronic
1009163117 6:60307241-60307263 CTGAGTACCCACTATGTGCCAGG + Intergenic
1009259206 6:61462543-61462565 CTGAGAAACCACTTTGTGATGGG + Intergenic
1009450485 6:63794199-63794221 TTGAGTACCTACTATGTGCTAGG - Intronic
1009935883 6:70234163-70234185 CTAGGTACACACTAAGTGGTAGG + Intronic
1010627613 6:78157780-78157802 ATGGGTACCTACTATGTGGCAGG + Intergenic
1011068018 6:83350195-83350217 CTAAGTACCTACTATGTGCCAGG + Intronic
1011367058 6:86594657-86594679 TTGAGTACCTACTATGTGCTAGG + Intergenic
1011412807 6:87083459-87083481 CTGAGAACCTACTAAGTGTTGGG - Intergenic
1011727309 6:90223218-90223240 CTGAGTACCCACCACATGTTAGG + Intronic
1011880559 6:92018907-92018929 CTGAAAACTCACTATCTGGTAGG + Intergenic
1011895969 6:92225794-92225816 CCGAGTACCTACTATGTACTAGG - Intergenic
1011961803 6:93100435-93100457 TTGAATACCCACTATGTGACAGG + Intergenic
1012560634 6:100576644-100576666 CTGAGAACCCACTACATGCTAGG - Intronic
1012841784 6:104337881-104337903 TTGAGCACCTACTATGTGGCTGG - Intergenic
1012945762 6:105463888-105463910 CTGAGTACCTATTATGTGCTAGG + Intergenic
1012949455 6:105502796-105502818 TTGAGTGCCCACTCTGTGGCAGG + Intergenic
1013030072 6:106324572-106324594 CTGAGTACCTCCTATGTGTTAGG - Intronic
1013219345 6:108063535-108063557 TTGAATACCAACTATGTGCTAGG - Intronic
1013343167 6:109235479-109235501 CTAAGCACCTACTATGTGTTAGG + Intergenic
1013428750 6:110037554-110037576 CTGAGCACCTACTATGTGCTAGG + Intergenic
1013916526 6:115345211-115345233 CTGAGTAGCCATTATGTGCTAGG - Intergenic
1015107201 6:129550914-129550936 CTGAGTCCCCACTATGTGGAAGG - Intergenic
1015766097 6:136718534-136718556 TTGAGTATTCACTATGTGCTAGG - Intronic
1015911054 6:138168081-138168103 GTGAGTACCTACTATGTGCCAGG + Intronic
1016030037 6:139327592-139327614 TTGAGCACCCACTAGGTGTTAGG - Intergenic
1016596004 6:145802027-145802049 CATAGTACCTACTATGTAGTAGG - Intronic
1016710695 6:147168264-147168286 CTGAGCACCTACTGTGTGCTAGG + Intergenic
1016788010 6:148034749-148034771 GAGAGTACCTACTATGTGATAGG + Intergenic
1016966964 6:149727925-149727947 CTGAGTACCTACTATGTGCCAGG + Intronic
1016967181 6:149729824-149729846 CTGAATGCCTACCATGTGGTAGG - Intronic
1017111869 6:150940204-150940226 GTGAGTTCCTACTATGTGCTGGG - Intronic
1017236082 6:152118863-152118885 CTGAATGCCCACTATGTGGCAGG - Intronic
1017323843 6:153124299-153124321 TTGAGCACCCACTATGTGCTAGG - Intronic
1017440619 6:154461347-154461369 CTGAGTACTTACTATGTTTTTGG + Intronic
1018052384 6:160022602-160022624 CTGAGCTCCCACTATGTTGTAGG + Intronic
1018174604 6:161167859-161167881 CTGAGCACATACTATGTGTTAGG - Intronic
1018407054 6:163497032-163497054 CTGAGTACCAACTACATGGCAGG - Intronic
1018615532 6:165683072-165683094 GTGAGTACGCACCATGTGCTAGG - Intronic
1018634371 6:165848206-165848228 CTGAGCGCCCCCTATGTGGCGGG + Intronic
1018886710 6:167944335-167944357 CTGAGCACCTACTATGTGCCGGG - Intronic
1019665154 7:2248281-2248303 CTGAACACCCACTCTGTGCTGGG - Intronic
1019916417 7:4135744-4135766 CTCAGCACTCACTATGTGGCAGG - Intronic
1020113451 7:5461217-5461239 TTGAGCACCTACTATGTGCTGGG + Intronic
1020661880 7:10993484-10993506 TTGAGTACCTTCTATGTGCTTGG + Intronic
1020876431 7:13700452-13700474 CTGAGCACCTACTATGTGAAAGG - Intergenic
1021084838 7:16409904-16409926 CTGAGCACCCACTAAGAGTTAGG - Intronic
1021210890 7:17851029-17851051 TTGAGTGCCTACTATGTGCTAGG + Intronic
1021437949 7:20642608-20642630 CTGAGTGCCCACTATGTGTGAGG - Intronic
1021651894 7:22840680-22840702 CTGAGAACCCAGCATGTGGACGG - Intergenic
1021736314 7:23641678-23641700 CTGAGTACCTAATATATGCTAGG + Intronic
1021985618 7:26095637-26095659 CTGAGCACTTACTATGTGCTTGG - Intergenic
1022035877 7:26534291-26534313 TTGAGTACCCACTATCTCCTTGG - Exonic
1022115710 7:27258715-27258737 CTGAGTACCCACCAGGTGCTAGG - Intergenic
1022320381 7:29282305-29282327 CTGAGTGCCCACTATGTGCAGGG + Intronic
1022330157 7:29371080-29371102 CTGAGTACCCATTATGCAGCAGG - Intronic
1022410059 7:30132654-30132676 CTGAGTTCTTACTATGTGCTAGG + Intergenic
1022436428 7:30390278-30390300 CTGAGTGCCAACTATGTGCCAGG - Intronic
1022481589 7:30746964-30746986 CAGAGTACCTACTGTGTGCTGGG + Intronic
1022556038 7:31297329-31297351 TTGAGCACCCACTGTGTGCTAGG - Intergenic
1022574668 7:31486143-31486165 CTGAGTACCTACTGTGTGCAGGG - Intergenic
1022983726 7:35629016-35629038 CTTTGTACCCACCATGTGTTTGG + Intergenic
1023359268 7:39399312-39399334 TTCAGTACCCACTATGTTTTGGG - Intronic
1023576360 7:41632250-41632272 CTGAGTCCCCACTCTGTAATTGG + Intergenic
1023592800 7:41796913-41796935 GTGAGTACCCACCATGTAGAAGG + Intergenic
1023660379 7:42465650-42465672 TTGAGTACCTACTAGGTGCTAGG + Intergenic
1023900222 7:44471025-44471047 CTGAGTACCAACTACGTGCCAGG + Intronic
1025109602 7:56203036-56203058 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025244072 7:57302993-57303015 CTGAGCACCTACTATGTGCCAGG + Intergenic
1025550371 7:62239270-62239292 CTGAGAAACCACTTTGTGATTGG + Intergenic
1025588549 7:62825053-62825075 CTGAGAAACCACTTTGTGATAGG + Intergenic
1026141714 7:67712459-67712481 TTGAGTACCTATTATGTGCTTGG - Intergenic
1026234982 7:68519642-68519664 ATGAGTACCTACTATGTGCTTGG - Intergenic
1026282665 7:68935608-68935630 CTGAGTACAGACTTTGTGCTAGG - Intergenic
1026308304 7:69161582-69161604 CTGAGCACCTACTATGTGCCAGG - Intergenic
1026339489 7:69423187-69423209 TTGTGTACCTACTATGTGCTGGG + Intergenic
1026356183 7:69559427-69559449 TTGAGAACCTACTATGTGCTGGG - Intergenic
1026547007 7:71331858-71331880 TTCAGTACTCACTATGTGGTGGG - Intronic
1027290338 7:76702404-76702426 TTGAGTACCTACTATGTGCAAGG + Intergenic
1027293229 7:76737682-76737704 CTGAGTGCCTACTATGTGCTGGG + Intergenic
1027296636 7:76780279-76780301 CTGAGTATTCACTATGTGCCCGG - Intergenic
1027375717 7:77547215-77547237 CTGAGTGCCCACTATGCCCTAGG + Intronic
1027756672 7:82222773-82222795 TTTAGTACCTAGTATGTGGTAGG - Intronic
1028168501 7:87567318-87567340 CTGAGTGCTTACTATGTGCTGGG - Intronic
1028636059 7:92990512-92990534 TTGAGCACCTACTATGTGCTAGG + Intergenic
1028830851 7:95325071-95325093 TTGAGTACCTACTATGTGCCAGG + Intergenic
1028889181 7:95967753-95967775 ATGAGCACCTACTATGTGCTGGG - Intronic
1028890879 7:95987329-95987351 TTGAGTACCTACTATGTGCTAGG + Intronic
1028965396 7:96796345-96796367 CGAAGTACCCACAATCTGGTTGG - Intergenic
1028980350 7:96961389-96961411 TTGAGTACTAACTATGTGGCAGG - Intergenic
1029142645 7:98422485-98422507 CTGAGCACCTCCTATGTGCTAGG + Intergenic
1029190194 7:98766472-98766494 CTGAGCACCTACTATGTGCCAGG - Intergenic
1029976102 7:104835499-104835521 TTGAGCACCTACTATGTGCTAGG + Intronic
1030004921 7:105108396-105108418 CTGATTTCCCATTATTTGGTTGG + Intronic
1030088828 7:105839755-105839777 CTGAGCACCTACTATGTGCCAGG + Intronic
1030089140 7:105841908-105841930 TAAAGTACCCACTATGTGCTAGG - Intronic
1030631948 7:111905915-111905937 TTGAGTACCTACTATGTGCTGGG + Intronic
1031159536 7:118149746-118149768 TTGAGTACACACTATGTGGCAGG + Intergenic
1031494587 7:122431245-122431267 CTGAGTACCAAATATGTGCTGGG + Intronic
1031930695 7:127682828-127682850 CTGAGTGCCTACTATGTGCCAGG - Intronic
1032005958 7:128302101-128302123 CTGAGCACCTACTATGTGTCAGG - Exonic
1032102206 7:128990474-128990496 TTGAGTGCCCACTATGTGCCAGG - Intronic
1032139550 7:129315041-129315063 CAGAGCACCAACTATGTGGTAGG - Intronic
1032238491 7:130143464-130143486 CTGAGCATCTACTATGTGCTAGG - Intergenic
1032609751 7:133400003-133400025 CTGAATACCATCTATGTGTTAGG + Intronic
1032631474 7:133657875-133657897 CTGAACACCCATTGTGTGGTTGG + Intronic
1032640976 7:133767800-133767822 ATGAGTGCCCACTACATGGTAGG + Intronic
1032648264 7:133849756-133849778 TTGAGTACCTACTACGTGTTAGG - Intronic
1033242600 7:139692757-139692779 GTCAGTACCCATTATGTGGGTGG + Intronic
1033244372 7:139705861-139705883 CTGAGTGCTCACTATGTGCCAGG + Intronic
1033674051 7:143520280-143520302 TTGAGTACCTACTATGTGTCAGG + Intergenic
1033736592 7:144228522-144228544 TTGAGCACTTACTATGTGGTTGG - Intergenic
1033736604 7:144228696-144228718 GTGAGTACTCACTCTGTGCTAGG + Intergenic
1033746452 7:144322254-144322276 GTGAGTACTCACTCTGTGCTAGG - Intergenic
1033746464 7:144322428-144322450 TTGAGCACTTACTATGTGGTTGG + Intergenic
1034480294 7:151314679-151314701 CTGAGCACCCACTATGGGCCAGG - Intergenic
1036520692 8:9489054-9489076 CTGAGTGCCCACAATGTGACAGG + Intergenic
1037402691 8:18508789-18508811 CTGAGCACTTACTATGTGCTAGG + Intergenic
1037422282 8:18715848-18715870 CTGAGTCCCTACTATGTGACAGG + Intronic
1037604295 8:20424410-20424432 CTGAGCACTTACTATGTTGTAGG - Intergenic
1037756670 8:21714645-21714667 CTGAGGACCTACTATGTGTCAGG + Intronic
1037894263 8:22641387-22641409 CTGAGTTCCCACTCTGTGCCAGG - Intronic
1038275664 8:26118825-26118847 TTGAGCACCTACTATGTGCTAGG - Intergenic
1038465684 8:27760571-27760593 CTGAATACCTACTATGTGCCAGG + Intronic
1038709997 8:29934412-29934434 CTGAGCCCCTACTATGTGCTAGG - Intergenic
1038967054 8:32586093-32586115 TTGAGTACCTACTATGTGCCAGG - Intronic
1039139872 8:34374794-34374816 TTGAGTACTCACTATGTGCCAGG + Intergenic
1039165365 8:34673455-34673477 TTGAGTGCCCACTATGTGCTAGG + Intergenic
1039180766 8:34863689-34863711 CTGAGTACTTCCTATGTGGCGGG + Intergenic
1039614618 8:38945305-38945327 CTGAGCACCTACTATGCGCTAGG - Intronic
1039680080 8:39725046-39725068 GTGAATACCCACTGCGTGGTGGG + Intronic
1040077369 8:43250692-43250714 TTGAGTTCCTACTAAGTGGTAGG - Intergenic
1040344526 8:46476733-46476755 CTGTGAAACCACTTTGTGGTGGG - Intergenic
1040425890 8:47285875-47285897 CTGGGTGCCCACTGTGTGCTAGG - Intronic
1040588865 8:48770531-48770553 CTGTGTACCAGCTATGTGTTAGG + Intergenic
1041489691 8:58419637-58419659 CTAAGTACCAACTCTGTGCTAGG - Intronic
1041545036 8:59033299-59033321 CTGAGTGCCTACTGTGTGCTAGG - Intronic
1041583356 8:59488065-59488087 TTGAGAACCTACAATGTGGTAGG + Intergenic
1041722293 8:60987014-60987036 TTGAGTAGCCACTGTGTGCTAGG + Intergenic
1042102180 8:65285211-65285233 CTGAGTTCCCACACTGTGCTGGG - Intergenic
1042602884 8:70516169-70516191 CTGAGGACCTACTATGTGCCAGG + Intergenic
1042648972 8:71018627-71018649 CTGAGTACGTACTATGTGCCAGG - Intergenic
1042945177 8:74147014-74147036 CTGAGTACTAACAATGTGTTTGG - Intergenic
1043379186 8:79684512-79684534 TTGAGTACCTACTATGTGCCAGG - Intergenic
1043667399 8:82833426-82833448 CTGAATACCTACTATGTGCCAGG - Intergenic
1043787214 8:84418361-84418383 CTGAGTACCTAATATGTGCCAGG - Intronic
1043807015 8:84684318-84684340 TTGAGTACCCACTATGAATTAGG + Intronic
1043820038 8:84851990-84852012 CAGAGTATCCACTATGTGTGAGG - Intronic
1044587227 8:93879003-93879025 TTGAGTCCCTACTATATGGTAGG - Intronic
1044599801 8:93992169-93992191 TTGAGCACCTACTATGTGCTGGG - Intergenic
1044630062 8:94270009-94270031 CTGAGTTCCCTCTGTGTGCTAGG - Intergenic
1044701273 8:94967441-94967463 CTGAGTACCTACTGTGTGCCAGG + Intronic
1044782115 8:95753823-95753845 TTGAGCACCTACTATGTGCTGGG - Intergenic
1044954303 8:97463596-97463618 CTGAGTACCCACCATATGCCAGG + Intergenic
1045085548 8:98679641-98679663 TTGAGTACCTACCATGTGCTTGG - Intronic
1045092839 8:98764707-98764729 CTGAGTAACCATTATGTGGCAGG + Intronic
1045374981 8:101563028-101563050 ATGGGTACTCACTATGTGCTGGG + Intronic
1045593070 8:103620782-103620804 CTGAGTAACCACTATATGCCAGG - Intronic
1045934846 8:107667222-107667244 CTGAGTACCTCCTATGTGCCAGG - Intergenic
1046089137 8:109478272-109478294 CTGAGTATCCACTATGTGCCAGG + Intronic
1046094568 8:109541576-109541598 TTGAGTACCTACTATGTGCCCGG + Intronic
1046112745 8:109745887-109745909 CTGAGCACCTACTATGTGCCTGG - Intergenic
1046527985 8:115405741-115405763 CTGAGTATTTACTATGTGCTGGG - Intergenic
1046665968 8:117003300-117003322 TTGAGTACCTACTAAGTGGTAGG + Intronic
1046711832 8:117519457-117519479 CTGAGCACCTATTATGTGCTGGG - Intergenic
1046818482 8:118611152-118611174 CTGAGTACCTACTATATGCTAGG - Intronic
1046844349 8:118899413-118899435 TTGAGTACTTACTATGTGGCAGG + Intergenic
1046859258 8:119071758-119071780 TTGAGCACCCACTATGTGTCGGG - Intronic
1046871788 8:119211949-119211971 CTGAATACCTACTATGTGCAAGG + Intronic
1047097943 8:121643752-121643774 CTGAATACCCACAATGTTGCAGG - Intergenic
1047168127 8:122463369-122463391 CTGATCACCTACTATGTGTTAGG + Intergenic
1047275458 8:123401937-123401959 CTGGATGCCCACTATGAGGTAGG - Intronic
1047517134 8:125564718-125564740 ATATGTACCTACTATGTGGTCGG - Intergenic
1047660643 8:127031931-127031953 CTGAGTACTTACTATGTGCCAGG - Intergenic
1047675595 8:127198133-127198155 TTGAGCACCTACTATGTGGCAGG + Intergenic
1047720962 8:127638686-127638708 TTGAGTACTCACTGTGTGCTAGG - Intergenic
1047752312 8:127891070-127891092 ATGAGCACCCTCTGTGTGGTTGG + Intergenic
1047912929 8:129550496-129550518 CTGAGCACCTACTATATGTTAGG + Intergenic
1047992905 8:130305315-130305337 TTGAGTACCTACAATGTGGCAGG - Intronic
1048011366 8:130459119-130459141 CTGAGTACCAACTATGTGACAGG + Intergenic
1048131761 8:131705485-131705507 ATGAGCACCTACTAGGTGGTTGG + Intergenic
1048296585 8:133219182-133219204 CTGAGCACCTACTATGTGCTAGG + Intronic
1048378375 8:133842999-133843021 CTGAGCACCTACTATGTGATGGG + Intergenic
1048378464 8:133843653-133843675 CTGAGCACCTACTGTGTGCTGGG + Intergenic
1048400916 8:134069401-134069423 TTGAGGACCTACTATGTGATTGG - Intergenic
1048497910 8:134950451-134950473 CTGAGCACCTACTATGTGCTAGG + Intergenic
1048568414 8:135628308-135628330 CAGAGCACCCACTATATGCTGGG - Intronic
1048598221 8:135889513-135889535 CTGAACACCTACTATGTGCTGGG - Intergenic
1048708453 8:137181484-137181506 TTGAGTACCTACTATGTGCTGGG - Intergenic
1048867182 8:138769709-138769731 CTGGGTACCCGCTGTGTGCTGGG - Intronic
1049236923 8:141517002-141517024 CTGAGCACCTACTGTGTGGCAGG - Intronic
1050057916 9:1674950-1674972 CTGAGTACCGATTATATGCTTGG + Intergenic
1050272474 9:3960570-3960592 CTGTGGACCCACTATGTGCCAGG - Intronic
1050404299 9:5291908-5291930 CTTGGGACCCACCATGTGGTAGG + Intergenic
1050532728 9:6604937-6604959 CTGAGTGCCCACCATGTGCCAGG + Intronic
1050852955 9:10311586-10311608 TTGTGTACCTACTATGTGTTGGG + Intronic
1051139985 9:13968212-13968234 GTGAGTACCCACTAAGTCTTAGG + Intergenic
1051355259 9:16234655-16234677 CTCAGTACCCACCAAATGGTGGG + Intronic
1051422096 9:16898905-16898927 TTGAGTACCAATTATGTGCTAGG - Intergenic
1051589404 9:18761037-18761059 TTGAGTACCCACTGAGTGCTAGG - Intronic
1051722147 9:20048224-20048246 CTAAATACCTACTATGTGCTAGG - Intergenic
1051873485 9:21766426-21766448 TTGAGTTTCCACTATGTGCTAGG + Intergenic
1052020275 9:23517885-23517907 CTGAGTTCCTTCTATGTGCTAGG + Intergenic
1052343293 9:27383791-27383813 ATAAGTACCCACTATGTTTTGGG - Intronic
1052400776 9:27997608-27997630 CTGTGTACTTACTATGTGGCAGG + Intronic
1052779480 9:32765843-32765865 CTGAGTACCTACTGTGAGCTGGG - Intergenic
1052847364 9:33349155-33349177 ATGAGTACCTACTATGTGCTAGG + Intronic
1052941237 9:34133307-34133329 CTGGATGCCCACTATGAGGTAGG + Intergenic
1053168589 9:35862120-35862142 TTGAGCACCTACTATGTGTTAGG + Intergenic
1053292367 9:36889705-36889727 CTGAGTACCTACTGTGTGCCAGG - Intronic
1053540592 9:38969826-38969848 CTGAGTACCTGCTTTGTGCTAGG + Intergenic
1053804935 9:41791982-41792004 CTGAGTACCTGCTTTGTGCTAGG + Intergenic
1054362615 9:64191435-64191457 CTGAGAAACCACTTTGTGATGGG + Intergenic
1054625551 9:67394097-67394119 CTGAGTACCTGCTTTGTGCTAGG - Intergenic
1054966851 9:71038643-71038665 CTGAGTACCTATTATGTGTCAGG + Intronic
1054985395 9:71256365-71256387 CTTAGTACCAACTATGTGACAGG + Intronic
1055287533 9:74745318-74745340 TTGAGTACCTACTATGTGCCAGG + Intronic
1055351255 9:75390829-75390851 CTGAGTGCCCACAATGTGCCAGG - Intergenic
1055354295 9:75421515-75421537 TTGAGTGCCTACTATGTGCTAGG - Intergenic
1055389462 9:75803999-75804021 CTGAGCACTCACTAAGTGCTAGG + Intergenic
1055566063 9:77569451-77569473 CCGAGGACCTACTATGTGTTGGG + Intronic
1055582110 9:77716838-77716860 TTGAGCACCTACTATGTGCTAGG + Exonic
1055715238 9:79110382-79110404 CTGGGTACCCACAATCAGGTGGG - Intergenic
1055743005 9:79410305-79410327 CTTAGTTCCTACTATGTGTTTGG - Intergenic
1056074572 9:83025269-83025291 CTGAGCACCCACCATGTGGTGGG + Intronic
1056537017 9:87537337-87537359 CTGCGTACACACTATGTGATGGG - Intronic
1056724144 9:89097657-89097679 TTGAGCACCTACTATGTGCTGGG + Intronic
1057250253 9:93495093-93495115 CTGAGTAGGCATTGTGTGGTGGG + Intronic
1057504249 9:95619627-95619649 CTGAGTACCCACTGTGTACTGGG - Intergenic
1057718380 9:97513659-97513681 CTGGGTACCCACTATGGGGAGGG - Intronic
1057731548 9:97613373-97613395 TTGAGTGCCTACTATGTGGCAGG - Intronic
1057789008 9:98110339-98110361 CTGAGCACCTATTATGTGCTGGG + Intronic
1057871542 9:98721884-98721906 CTGAGGACCTACTATGTGCCAGG - Intergenic
1057928568 9:99173650-99173672 CTGAGCACCCACTATGTGCTGGG + Intergenic
1057949918 9:99361552-99361574 CTAAGCACCCACTCTGTGCTAGG - Intergenic
1058022196 9:100101220-100101242 CTGAGTGACAACTATGTGCTAGG - Intronic
1058057950 9:100468245-100468267 CTGAGCACCCACTATGATCTAGG - Intronic
1058328639 9:103729642-103729664 CTGAGTGCTCACTATATGGAAGG + Intergenic
1058548782 9:106090436-106090458 CTGAGTACCTATTATGTGGCAGG + Intergenic
1058816911 9:108692743-108692765 CTGAATGCCTACTATGTGTTAGG - Intergenic
1059226650 9:112679120-112679142 CTGATACCCCACTCTGTGGTGGG - Intergenic
1059290550 9:113220563-113220585 CTGAGCACTCACTATGTGCTAGG + Intronic
1059511331 9:114851047-114851069 CTGAGTACTTATTATGTGCTTGG + Intergenic
1059655676 9:116355223-116355245 CTGAGTACCTACTAGGTGCCTGG - Intronic
1059914390 9:119082926-119082948 ATGAGTACCTACTATGTGCTAGG - Intergenic
1059920305 9:119152923-119152945 GTGAGCACCTACTATGTGCTTGG - Intergenic
1059981036 9:119772315-119772337 CTGAGTACCAACTATGTACCAGG + Intergenic
1060208001 9:121693824-121693846 TTGAGCACCTACTATGTGCTAGG + Intronic
1060285607 9:122248918-122248940 CTGAGTTCTCACTGTGTAGTAGG + Intronic
1060351435 9:122864404-122864426 CTGAGTGCTTACTATCTGGTAGG + Intronic
1060373681 9:123099041-123099063 TTAAGTACCTACTATGTGCTGGG - Intronic
1060433431 9:123570646-123570668 CTGAGCACCTACTATGTGCTAGG - Intronic
1060516566 9:124269743-124269765 CTGAGCACCTACTATGTGCCAGG - Intronic
1060518992 9:124283230-124283252 CTGAGCACCTACTATGTGCCAGG - Intronic
1060713153 9:125890429-125890451 TTGAGTACCTACTATGTCCTAGG + Intronic
1060725394 9:126002718-126002740 CTGAGCACCTACTATGTGCCAGG - Intergenic
1060765474 9:126292480-126292502 TTGTGTACCTACTATGTGCTGGG - Intergenic
1060931227 9:127490728-127490750 TTGAGCACCTACTATGTGCTAGG - Intronic
1061100189 9:128486269-128486291 CTGAGAACTCACTATGTGCCAGG + Intronic
1061855648 9:133440646-133440668 CAGGGGACCCACTATGTGTTGGG + Intronic
1061933992 9:133847240-133847262 CTGAGCACCCACTTGGTGGGAGG - Intronic
1062451027 9:136615910-136615932 CTGAGCACCTACTGTGTGCTGGG - Intergenic
1185891385 X:3825322-3825344 CTGAGCAGCCACTCAGTGGTGGG + Intronic
1185896492 X:3863736-3863758 CTGAGCAGCCACTCAGTGGTGGG + Intergenic
1185901610 X:3902162-3902184 CTGAGCAGCCACTCAGTGGTGGG + Intergenic
1186196988 X:7118854-7118876 CTGGGTACCTACTTTGTGCTAGG + Intronic
1186277475 X:7955705-7955727 CTAAGTACCCACTATGTGGCAGG + Intergenic
1186701195 X:12091994-12092016 CTGAGCACCCATTATGGGCTGGG + Intergenic
1186825688 X:13337806-13337828 TTGAGTACCTACTATGTGGATGG - Intergenic
1186902146 X:14068183-14068205 TTGTGTACCAACTATGTGTTAGG + Intergenic
1186909378 X:14145719-14145741 TTGAGTACCGACTGTGTGCTAGG + Intergenic
1187089437 X:16079801-16079823 TTGAGTACCTACTATGTGTCAGG - Intergenic
1187092640 X:16113342-16113364 CTGAGTATTCACTATGTGCCAGG - Intergenic
1187408707 X:19027708-19027730 CTGAGCACCTACTATGTGCCAGG - Intronic
1187456198 X:19443351-19443373 CTGAGTGCCTACTCTGTGGGTGG + Intronic
1187600077 X:20819232-20819254 CTGAGTACCTACTGTGTGCTAGG - Intergenic
1187723534 X:22177119-22177141 ATGAGAACCCACTCTGTGTTAGG + Intronic
1187746506 X:22414929-22414951 CTGAGCACCTACTAGGTGCTGGG + Intergenic
1189222107 X:39381396-39381418 TTGAGTACCCACTGTGTGCCAGG + Intergenic
1189594764 X:42552394-42552416 CTGAATACTTACTATGTGCTAGG + Intergenic
1189704904 X:43750089-43750111 TTGAGCACCTACTATGTGGTAGG + Intergenic
1189926040 X:45956615-45956637 TTGAGTACCCACCATGTGCCAGG + Intergenic
1190001860 X:46696622-46696644 TTGGGTACCCACTATGTGTCAGG + Intronic
1190454616 X:50615582-50615604 CTGAGCACCCACTGTGTGCCGGG - Intronic
1190465078 X:50718089-50718111 CTGAGTGTCCACTGTGTGCTGGG + Intronic
1190476686 X:50835051-50835073 CTGAGAACCTACTATGTGCCAGG - Intergenic
1190570944 X:51780650-51780672 CTGAGTGCCCACAATGTACTAGG - Intergenic
1190823983 X:54000107-54000129 CTGAGTACCTACTAAGTGCTAGG + Intronic
1190879860 X:54484406-54484428 TTGAGTGCCTACTATGTGCTAGG - Intronic
1191007916 X:55730183-55730205 CTGAGCACCCACTCTATGGCTGG - Intronic
1191661960 X:63660743-63660765 CTAAGTACCTACTATGTGCCAGG + Intronic
1191737688 X:64404531-64404553 TTGAGTACCTACTATGTGTTAGG - Intergenic
1192142687 X:68659186-68659208 CTGAGCACCCATTGTGTGGCAGG - Intronic
1192273487 X:69606740-69606762 TTGAGTACCTACTATGTGCCAGG - Intergenic
1192418813 X:71010202-71010224 CTGAGCACCTACTATGTAGCAGG - Intergenic
1192546621 X:72019526-72019548 CTGAGCACCCACTGTGTGTCAGG - Intergenic
1192558671 X:72110416-72110438 CTGAGTACCTACTAGGTGGCTGG - Intergenic
1193684741 X:84563571-84563593 CTGAGTAACTACTATGTGCAAGG - Intergenic
1194230402 X:91315839-91315861 TTGAGGACCTACTATGTGCTAGG + Intergenic
1194436717 X:93875683-93875705 GGGAGTACCCACTATGAGGCTGG + Intergenic
1194667233 X:96688695-96688717 CTGAGTACCTACTGTGTGCTAGG + Intronic
1194770999 X:97904859-97904881 CTGAGCACCTACTATGTATTGGG + Intergenic
1194918983 X:99741041-99741063 TTGAGTTCCCATCATGTGGTAGG - Intergenic
1194970301 X:100335750-100335772 TTGAGTGCCCACTATGTGCCTGG - Intronic
1195430792 X:104787082-104787104 TTGAGTACCCACTTTGTGCCAGG + Intronic
1195444034 X:104930447-104930469 CTGAGTGCTCACTATGTGATAGG + Intronic
1195451104 X:105013988-105014010 CTGAATACGCACTATGTGCCTGG - Intronic
1195604773 X:106792850-106792872 TTGAGTATCTACTATGTGCTGGG - Intronic
1195981027 X:110578526-110578548 CTGAGTAGCTGCCATGTGGTAGG + Intergenic
1195994872 X:110721783-110721805 CTGAGCACCTACTATGTGCCAGG + Intronic
1196143128 X:112287521-112287543 TTGAGTACCTACTCTGTGCTAGG + Intergenic
1196175507 X:112635239-112635261 TTGAGTACCGACTATATGCTAGG + Intronic
1196198769 X:112862283-112862305 CTGAGTACCTACTATGTGCTAGG + Intergenic
1196287996 X:113905002-113905024 TTGAGTACCTACTATGTGCCAGG + Intergenic
1196397619 X:115282392-115282414 CTGAGGACCTACTATGTGCTAGG + Intergenic
1197180049 X:123525070-123525092 TTGAGTACCCACTATGTTACAGG - Intergenic
1197981711 X:132224154-132224176 CTAAGTACCCATCATATGGTAGG + Intergenic
1197981724 X:132224331-132224353 CTAAGTACCCACCATACGGTAGG + Intergenic
1198036871 X:132809441-132809463 TTGAGTACTGACAATGTGGTTGG + Intronic
1198089551 X:133314061-133314083 CTGAGCACCTACTATGTGCCAGG + Intronic
1198122421 X:133607330-133607352 CTGAGCACCCACTATGTGTCAGG - Intronic
1198432018 X:136576779-136576801 CTGAGCACTCAACATGTGGTGGG + Intergenic
1198511473 X:137356154-137356176 CTGAGCACCCACTATGTGCCAGG - Intergenic
1198749749 X:139927233-139927255 CTGAGCACCTACTATGTGCTGGG - Intronic
1198866911 X:141132868-141132890 TTGAGTACCTACTGTGTGTTAGG - Intergenic
1198998485 X:142604628-142604650 CTGAGTACCAACGATATTGTAGG - Intergenic
1199366491 X:146991290-146991312 CTGAGTACCTACTATTTGCTAGG - Intergenic
1199668249 X:150119323-150119345 CTCAACACCCACTATGTGGCAGG - Intergenic
1199814466 X:151385774-151385796 CTGAGTGCCTACTATGTGCAAGG - Intergenic
1199969001 X:152844786-152844808 GTGAGTGCCCACTTTGTGCTGGG + Intronic
1199972647 X:152872302-152872324 CTGAGCACCCACTATGCTGTGGG - Intergenic
1199989749 X:152979888-152979910 CTGAGCACCTACTATGTGCAGGG - Intergenic
1200008503 X:153103934-153103956 CTGAGTGCCTACTATGTGACAGG - Intergenic
1200042271 X:153379178-153379200 CTGAGTCCCCACTGTGTGCCAGG - Intergenic
1200334258 X:155332669-155332691 TTGAGTACTTACTATATGGTAGG - Intronic
1200619713 Y:5427445-5427467 TTGAGTCCCCACTATGTGACAGG + Intronic
1202301010 Y:23414045-23414067 TTGAGTACCTACTATATGGAAGG + Intergenic
1202569801 Y:26256553-26256575 TTGAGTACCTACTATATGGAAGG - Intergenic