ID: 916242592

View in Genome Browser
Species Human (GRCh38)
Location 1:162655088-162655110
Sequence CCAAGCACACCAGGCACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916242592_916242599 19 Left 916242592 1:162655088-162655110 CCTTTAGTGCCTGGTGTGCTTGG 0: 1
1: 0
2: 2
3: 13
4: 103
Right 916242599 1:162655130-162655152 GCTGGACAGGAGTGCCAAAGAGG 0: 1
1: 0
2: 1
3: 12
4: 162
916242592_916242598 6 Left 916242592 1:162655088-162655110 CCTTTAGTGCCTGGTGTGCTTGG 0: 1
1: 0
2: 2
3: 13
4: 103
Right 916242598 1:162655117-162655139 TCTGTTGCACGGCGCTGGACAGG 0: 1
1: 0
2: 0
3: 6
4: 63
916242592_916242596 -5 Left 916242592 1:162655088-162655110 CCTTTAGTGCCTGGTGTGCTTGG 0: 1
1: 0
2: 2
3: 13
4: 103
Right 916242596 1:162655106-162655128 CTTGGAAGGTTTCTGTTGCACGG 0: 1
1: 1
2: 4
3: 48
4: 392
916242592_916242597 1 Left 916242592 1:162655088-162655110 CCTTTAGTGCCTGGTGTGCTTGG 0: 1
1: 0
2: 2
3: 13
4: 103
Right 916242597 1:162655112-162655134 AGGTTTCTGTTGCACGGCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916242592 Original CRISPR CCAAGCACACCAGGCACTAA AGG (reversed) Intronic
900112366 1:1013821-1013843 CCAGGCACAGAAGGCACTGAGGG - Intronic
900165176 1:1241615-1241637 CCAACCCCACCAGCGACTAAGGG + Intergenic
900636502 1:3668764-3668786 CCAAGCACACTCAGCACTACAGG - Intronic
902845130 1:19104508-19104530 CCCAGCACCCAAGGAACTAAGGG + Intronic
906127781 1:43438116-43438138 CCGAGCACAGCAGGAACTAGAGG - Intronic
910361396 1:86416226-86416248 CCAAGCAGAACAGCCACCAAGGG + Intergenic
911445376 1:97985547-97985569 CCAAGCACAGAAGTCACTCAAGG + Intergenic
915646154 1:157274062-157274084 CCATGGAAACCAGGCACTAAAGG + Intergenic
916242592 1:162655088-162655110 CCAAGCACACCAGGCACTAAAGG - Intronic
919032730 1:192265068-192265090 CTAAGAACATCAGGCAATAAGGG + Intergenic
1065117269 10:22495142-22495164 CCAAGCAGACCATGCCCTCAGGG + Intergenic
1065284467 10:24174351-24174373 CCAACCACACCAGACCCTAGGGG + Intronic
1067725726 10:48769250-48769272 CCAAGCCTACCAGGCCATAAGGG + Intronic
1069623287 10:69851005-69851027 CACAGCACAGCAGGCACTACAGG + Intronic
1069851779 10:71409908-71409930 CCACCCAGACCAGGCACAAAGGG - Intronic
1074309637 10:112311229-112311251 CCCAGCACACCAGCCACCACAGG + Intergenic
1074761123 10:116668257-116668279 CCAATCACACCAGGCTATAGCGG - Exonic
1076463239 10:130660542-130660564 CCAAGCACACCAGGCAGCTGGGG - Intergenic
1076891151 10:133284141-133284163 CCCAGCACACCAGACACTCACGG + Intronic
1077527315 11:3074991-3075013 ACCCGCACACCAGGCCCTAAAGG - Intergenic
1080998945 11:37643487-37643509 CCAAGCAGACAAGGCAATGAGGG - Intergenic
1084545020 11:69810883-69810905 CCAAGTTCACCAGGCACACAGGG - Intronic
1084858692 11:72004567-72004589 CCCAGCTCACCAAGGACTAAAGG - Intronic
1084974586 11:72789840-72789862 CCCAGAACACCAGGGACTCACGG - Intronic
1095123869 12:38451524-38451546 CCAAGTGAACCAGGCAATAATGG + Intergenic
1095252086 12:39990702-39990724 CCAAGCACAGCTGCCACTAGGGG - Intronic
1096638567 12:52976507-52976529 CCAGGCACGCCAAGTACTAAAGG - Intergenic
1108867185 13:54937881-54937903 CCATGGAAACCAGGTACTAAAGG + Intergenic
1111636755 13:90914943-90914965 CCACTCACATCAGGCAATAAGGG + Intergenic
1113218347 13:108069658-108069680 GCAACCACACCAGGCACAAGTGG - Intergenic
1113357027 13:109590589-109590611 CCAAGTTCACCAGGAAGTAAAGG - Intergenic
1115090630 14:29570181-29570203 CCAAACACACCAGGAACAACTGG + Intergenic
1116869755 14:50059963-50059985 CCATGCACTCCAGGCACTGAGGG + Intergenic
1118722677 14:68605570-68605592 CCAAGCACACCAGGGGCTAGAGG - Intronic
1120929881 14:89837483-89837505 CTAAGAACAGCAGGCTCTAAAGG - Intronic
1122508534 14:102247865-102247887 CCATGGAAACCAGGTACTAAAGG - Intronic
1122641894 14:103164896-103164918 CCAAGCACCCCAGCCAGGAAGGG - Intergenic
1127792473 15:62410611-62410633 CCCAGCCCACTAAGCACTAACGG - Intronic
1128553533 15:68614716-68614738 CCCAGCACACAAGGCAGGAACGG - Intronic
1137814530 16:51385992-51386014 AAAAGCAAACCAGGGACTAATGG - Intergenic
1145857061 17:28170013-28170035 CAGAGCAGAGCAGGCACTAAAGG + Intronic
1146993368 17:37295997-37296019 CCAAGCAAGCCAGCCACTCAAGG + Intronic
1147228101 17:38996521-38996543 CCAAGCACACCAGGTTCTTGTGG - Intergenic
1150829965 17:68510874-68510896 CCAAATCCACCAGGCTCTAAGGG - Intergenic
1151440483 17:74125699-74125721 CCAAGCACAGCTGGGACTACAGG + Intergenic
1151964980 17:77426444-77426466 CCAAGCACAGCAGACACCCAGGG - Intronic
1153647713 18:7210210-7210232 ACAAGCAAGCCAGGCAATAAAGG + Intergenic
1158704360 18:59778318-59778340 CCAAGGACACCAGTGACTCAAGG - Intergenic
1160542600 18:79633022-79633044 CCCAGCACTCCAGGCAAGAACGG + Intergenic
1160874309 19:1290145-1290167 CCATCCACACCAGGCCCTATCGG - Intronic
1160995714 19:1881162-1881184 CCAAGCACCGCAGGCAGAAACGG + Intronic
1161274742 19:3409551-3409573 CAACGCACACCCGGCACTCACGG - Intronic
1165684208 19:37804389-37804411 ACAAGCACACCAGGCTCAAGTGG + Intronic
1166599070 19:44077940-44077962 CCTAGTACTCCAGGCACCAAAGG + Intronic
925464122 2:4090690-4090712 CCAAGCAGGCCAGGCGCTGAAGG + Intergenic
928395193 2:30938174-30938196 CAAAGCACAGCAGGCACAAAAGG - Intronic
928441171 2:31293415-31293437 CCTTGCATACCAGGCACTCATGG + Intergenic
932531923 2:72543795-72543817 CTAACCTCACCAGGCACTAGTGG + Intronic
935651552 2:105386420-105386442 CAAAGCACACCACGCAGTAGGGG + Exonic
939013684 2:136876845-136876867 CTAAGCAGAGCAGGCACTGATGG + Intronic
942731951 2:179069924-179069946 CCAAGCAAACCAGGACCTAGAGG - Intergenic
942953936 2:181751864-181751886 CCAAGAACACCAAGAACTCAGGG - Intergenic
944560381 2:200930089-200930111 CCCAGAACACCAAGCACTAGAGG + Intronic
944715947 2:202376334-202376356 CCGAGCAGACCAGACACAAAGGG - Intergenic
945426417 2:209710012-209710034 TCACGCACACCAGGCACTCCTGG + Exonic
1169350395 20:4863721-4863743 CCAAGCACACCAGGCAGGCCTGG + Intronic
1173979350 20:47211236-47211258 CCAAGCACCCCATGCACTTCTGG + Intronic
1173992646 20:47315176-47315198 CCAAGCCCACCAGGAAACAAAGG + Intronic
1175396307 20:58665293-58665315 CCAACTACACCAGGCACTATAGG - Intronic
1179963368 21:44784759-44784781 CCAAACACACCATTCAGTAAAGG + Intronic
1180654354 22:17406875-17406897 CCAGGCATGCCAGGCAGTAAAGG - Intronic
1181023334 22:20114547-20114569 CCATGCCCACCAGGGACTCATGG + Intronic
1184387641 22:44185460-44185482 CCAGGCTCACCAGGCTCTAAGGG - Intronic
1184503232 22:44886256-44886278 CCAGGCACGCCAGGGACAAATGG + Intronic
950712924 3:14826342-14826364 TCAAGAACAACATGCACTAATGG - Intronic
951342278 3:21502852-21502874 AAAAGCACTCCAGGCACAAATGG + Intronic
953653835 3:44832215-44832237 CCAAGCACAGCAGGCAGTCAGGG + Intronic
954322119 3:49839410-49839432 GCACGCACTCCTGGCACTAAGGG + Intronic
968062988 3:195740100-195740122 TTAAGCACACATGGCACTAACGG - Intronic
968542879 4:1177273-1177295 CCAACCACAGCAGGCACTAAGGG - Intronic
969409034 4:7015743-7015765 CCAAGACCACAAGGCAATAATGG - Intronic
970230073 4:13900674-13900696 CCAAGCACAACAGGAACCACAGG - Intergenic
974542947 4:63262466-63262488 CCAAGCACACACTGCAATAAAGG - Intergenic
982902550 4:161025387-161025409 CAAAGCACACCATGCCATAATGG - Intergenic
987083409 5:14446559-14446581 CCAAGCACACAAAGCATTACGGG - Intronic
990512515 5:56501444-56501466 CCAATCACACCAGGGACTCCTGG + Intergenic
997629087 5:135353138-135353160 CCAAGTGCACGAGGCACAAAAGG + Intronic
998653225 5:144144634-144144656 CAAAGCAACCCAGCCACTAAGGG + Intergenic
1002548306 5:179967773-179967795 CCAACCAAACCTGGAACTAATGG + Intronic
1002882611 6:1266175-1266197 CCAAGCACACCTGACACTCATGG + Intergenic
1003119484 6:3308001-3308023 CCACTCACATCAGGCACTAGAGG + Intronic
1004460172 6:15828087-15828109 CCAAGGAGACCTGGCACTAGGGG + Intergenic
1008071230 6:47100935-47100957 CCAAGAACAAAAGGCACTGATGG - Intergenic
1009036957 6:58129221-58129243 CCAGGCACCCCAGGCAGAAAAGG + Intergenic
1011282273 6:85688969-85688991 CCAATAACAACAGGCTCTAAAGG + Intergenic
1017256727 6:152341678-152341700 CCAAGCTCACCAGCCACTAAGGG + Intronic
1022126749 7:27364996-27365018 CCAAACACACCAGGGTCTGATGG + Intergenic
1022484279 7:30765879-30765901 CCAAGCCCTCCAGACACTCAAGG + Intronic
1023367754 7:39481101-39481123 CCAAGAACCACAGGCACTAAAGG - Intronic
1024585554 7:50838904-50838926 CCAAACACATCAGACACTAAAGG + Intergenic
1030071744 7:105703819-105703841 CCAACCACACCTGACACGAAAGG - Intronic
1032692859 7:134306180-134306202 CAAAGCACTCCAGGCAAAAAAGG - Intronic
1034432098 7:151046168-151046190 CCAAGAACACCCAGCACTGAAGG + Intronic
1035159963 7:156943265-156943287 CCCAGCACAGCAGCCACTCAGGG + Intergenic
1045358106 8:101407015-101407037 CCACGGACAGCAGGCACTCAGGG + Intergenic
1047541261 8:125768677-125768699 CAGAGGGCACCAGGCACTAAAGG + Intergenic
1048139943 8:131784383-131784405 CCAAGCTGACCAGGCAGAAATGG + Intergenic
1056773465 9:89496169-89496191 CCCAGGACCCCAGGCACTCAGGG + Intronic
1058690707 9:107518100-107518122 CCAAGCCCACCAGGAACTTATGG + Intergenic
1059018017 9:110543381-110543403 CCAAGAACACCAGGCACATAAGG - Intronic
1059436905 9:114282517-114282539 CCTGGCACTCCAGGCCCTAAAGG + Exonic
1186757006 X:12682062-12682084 TGAAGGACACCAGGCACAAAAGG - Intronic
1189408093 X:40743861-40743883 TCAGGCTTACCAGGCACTAAGGG + Intergenic
1189724247 X:43952678-43952700 ACAAGAACTCCAGGCACTGAAGG + Intronic
1190218576 X:48496215-48496237 CAAAGTACACCAGACACAAAGGG + Intergenic
1193352235 X:80477005-80477027 GCCAGCACTCCAGGCACTAGTGG - Intergenic
1196746908 X:119079407-119079429 CCAAACCCACCAAACACTAAGGG - Exonic
1199741005 X:150736275-150736297 CCAAGAACACCTGGGACTATCGG + Intronic
1201714286 Y:17027217-17027239 CCAGGAACACCAGGAACTAGTGG - Intergenic