ID: 916243921

View in Genome Browser
Species Human (GRCh38)
Location 1:162667811-162667833
Sequence AAGCCTAACCAGATGCTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916243921_916243924 12 Left 916243921 1:162667811-162667833 CCAGTCAGCATCTGGTTAGGCTT 0: 1
1: 0
2: 0
3: 12
4: 99
Right 916243924 1:162667846-162667868 CATCTTCCTCAATTATCTGCAGG 0: 1
1: 0
2: 1
3: 8
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916243921 Original CRISPR AAGCCTAACCAGATGCTGAC TGG (reversed) Intronic
915730802 1:158052839-158052861 AGGCCTCACCAGAAGCTGAGTGG - Intronic
916191752 1:162185962-162185984 AAGCCTGATAAGATGCTGCCTGG + Intronic
916243921 1:162667811-162667833 AAGCCTAACCAGATGCTGACTGG - Intronic
920460750 1:206138157-206138179 AAGCCTCACCAGAAGCTGAGTGG - Intergenic
921179136 1:212617764-212617786 AAGCCGAAACAGATTCTGTCTGG - Intronic
1063254198 10:4308336-4308358 AAGCCTAGCAGGATGCAGACTGG + Intergenic
1066119977 10:32276733-32276755 AAGTCTAACCAAATGCTAAATGG + Intronic
1069380717 10:67841073-67841095 AAGCCTACCCAGAAGCTGAACGG + Intergenic
1073040448 10:100600739-100600761 AAGCCTAAACAGATGTAAACAGG - Intergenic
1078650835 11:13190770-13190792 AGGCCTCACCAGAAGCTGAATGG - Intergenic
1088044569 11:105432461-105432483 ATGCCTCACCAGAAGCTGAGAGG + Intergenic
1090152656 11:124402080-124402102 GAGCCTAAAAAGATGCTGTCAGG - Intergenic
1090920066 11:131199205-131199227 ATGCCTACCCCGAAGCTGACTGG + Intergenic
1093954814 12:25203441-25203463 AAGCCTGATCAAATGCTGATGGG - Intronic
1100020945 12:90069039-90069061 AAGTCTAATCAGCTGCTGACTGG - Intergenic
1101789335 12:107912997-107913019 AGGGCTAAACAGATTCTGACGGG + Intergenic
1114377838 14:22168387-22168409 AAGCCCATTCAGAAGCTGACTGG + Intergenic
1115010334 14:28537784-28537806 AAGGCTAACTAGATGCAGCCAGG - Intergenic
1117953617 14:61106338-61106360 AAGCCAAACCTGATGCTCGCAGG - Intergenic
1122617792 14:103032290-103032312 AGGCCTCACCAGCTCCTGACTGG + Intronic
1123114009 14:105885700-105885722 ACGCCAAACCAGATGGAGACAGG - Intergenic
1123480649 15:20628597-20628619 AAGCTGAACCAGATGTTGCCTGG + Intergenic
1123637360 15:22371770-22371792 AAGCTGAACCAGATGTTGCCTGG - Intergenic
1125714123 15:41809686-41809708 AAGCCTAAAGAGAAGCTGCCTGG + Intronic
1125718800 15:41835327-41835349 GAGCTGCACCAGATGCTGACAGG - Intronic
1126377831 15:48013700-48013722 CAGCCTCAGCAGATGCTGACAGG - Intergenic
1132059984 15:98684617-98684639 AAGCTTATCCAGATGAGGACAGG + Intronic
1135433031 16:22403196-22403218 AAGCCTAAGCTGATGATGAGAGG + Intronic
1138250033 16:55494963-55494985 TAGCCTCACCAGATTCTCACTGG - Intronic
1141059389 16:80851950-80851972 AAGCATAATCAGAAGATGACTGG - Intergenic
1146543825 17:33720894-33720916 AGGCCTCACCAAAGGCTGACTGG - Intronic
1146576024 17:33992287-33992309 CAGCCTAGTCAGATGCTGACTGG + Intronic
1151215761 17:72575426-72575448 AACCCTAACCAGCTGCTGGAAGG + Intergenic
1155170719 18:23265173-23265195 GAGCCTAACCAGAAGCTGGAGGG - Intronic
1156593818 18:38522890-38522912 AAATCTTACCAGCTGCTGACAGG + Intergenic
1157486789 18:48093311-48093333 AAGCCTAGCCAGAAGCCTACTGG + Intronic
1157856101 18:51107076-51107098 CAGCCTTACAAGATGCTGAAAGG - Intergenic
1158143128 18:54278735-54278757 AAGCCTAATCAGATATTCACTGG - Intronic
1160490123 18:79330279-79330301 ATGTCAAACCAGATGCTGATGGG + Intronic
1167067734 19:47199516-47199538 CAGCCTAACGAGCTGCTGGCTGG - Intronic
929405036 2:41631727-41631749 AGGCCTCACCAGAAGCTGAGCGG + Intergenic
931525895 2:63152566-63152588 AAGAGTAACCAGATGTTGGCAGG - Intronic
935284298 2:101550392-101550414 ATGCCTAAACAGATCCTGAGTGG - Intergenic
939061678 2:137430301-137430323 AAGCATAACCTTATGCTTACAGG + Intronic
939967223 2:148622313-148622335 TAGCATAACCAGAAGCTGCCGGG - Intergenic
940738802 2:157483188-157483210 AAGCCTAACCAAAAGATCACAGG + Intronic
948605136 2:239130198-239130220 AAGCTCAAACAGATGCTGATTGG - Intronic
1169394327 20:5216231-5216253 AACCCAAACCAGCTGCTTACTGG - Intergenic
1170318781 20:15070704-15070726 CAGCCTCACCAGAAGCTGAATGG + Intronic
1170785045 20:19460418-19460440 CAGCCTAACCAGATGTGGGCAGG + Intronic
1173393065 20:42652456-42652478 AATCATAACCAGATGCAGGCTGG - Intronic
1175325982 20:58128870-58128892 TGGCCTAACCAGATGATGACAGG - Intergenic
1180055021 21:45353099-45353121 AATCCTACCCTGAGGCTGACAGG - Intergenic
1181661555 22:24353989-24354011 AGGCCTCACCAGAAGCTGAGCGG - Intronic
1183027958 22:35080260-35080282 AAGGCTAAATAGATGCTGATAGG + Intronic
1183960877 22:41411221-41411243 ATGCCTAGCAAGGTGCTGACAGG + Intergenic
953114511 3:39978625-39978647 AAGCCTGACCATGTGCTGATTGG + Intronic
953920198 3:46946548-46946570 CAGCCTCACCTGATGCTGTCAGG + Intronic
954405976 3:50345306-50345328 AAGCCTAACCTGATCCTGAGGGG + Intronic
955860509 3:63324830-63324852 TAGCCTGGCCAGATGGTGACGGG + Intronic
960055603 3:113274449-113274471 AACCCTGAGCAGATGCTGAGGGG + Exonic
965216816 3:165874517-165874539 AAGCCTACCCAGCTCCTGGCTGG + Intergenic
967342994 3:188421727-188421749 AAGCTTAAGCAGATGGAGACAGG - Intronic
970117802 4:12718797-12718819 AAGCCTCCCCAGAAGCTGAGCGG + Intergenic
970716746 4:18935588-18935610 AGGACTAACCAGCTGATGACTGG - Intergenic
971804381 4:31336269-31336291 AAGCCTCCCCAGAAGCTGAGCGG - Intergenic
972161929 4:36237641-36237663 AGGCCTCACCAGAAGCTGAGTGG + Intronic
983098115 4:163589932-163589954 AAGTCTCAACATATGCTGACTGG - Intronic
985715781 5:1460239-1460261 GATCCTAACCAGAAGCTGGCTGG - Intronic
994409560 5:99389614-99389636 AAGCCAAGACAGATGATGACTGG + Intergenic
995110088 5:108419146-108419168 AAGCCTTAGCAGATCTTGACTGG + Intergenic
999954581 5:156686609-156686631 AAGCTTACTCAGATGCTGACAGG + Intronic
1000138907 5:158382139-158382161 ATGGCTATGCAGATGCTGACTGG - Intergenic
1000219107 5:159194769-159194791 AAGCTGAACCAGATGCTGCCTGG + Exonic
1005589424 6:27309628-27309650 ATGCCTGACCAGGTGCTGGCAGG + Exonic
1005681176 6:28210064-28210086 AAACCTAAACAGTTGGTGACAGG - Intergenic
1008272803 6:49509285-49509307 TACCATAACCAGAGGCTGACAGG - Intronic
1011713368 6:90078080-90078102 CAGATTGACCAGATGCTGACAGG - Intronic
1012553086 6:100482042-100482064 AAACCCAACCAGAAGCTGAAGGG - Intergenic
1012607938 6:101181485-101181507 CAGCCTACCCAAATGCTGAGAGG + Intergenic
1014130846 6:117830315-117830337 AAACCTAACTAGATGGTGATGGG + Intergenic
1015209680 6:130683057-130683079 GAGCCTAGGTAGATGCTGACAGG + Intergenic
1015227741 6:130877246-130877268 AAGCCAGACTAGATGCTGAAAGG + Intronic
1024096235 7:45985011-45985033 AAGACAAAGCAGAGGCTGACAGG - Intergenic
1024658759 7:51473805-51473827 AAGCCTGACCAGGTGCTCAGTGG - Intergenic
1024696008 7:51857366-51857388 AACCCTGACCTGATCCTGACAGG + Intergenic
1028993506 7:97075584-97075606 AAGTCTAACCAGCTCCTGGCTGG + Intergenic
1029091116 7:98049235-98049257 GAGCCTAAGCAGGTGTTGACTGG + Intergenic
1031003802 7:116449078-116449100 AAGCCTAACTAGATAATTACTGG + Intronic
1033447670 7:141436732-141436754 AAGCCAAGCCAGATGCTGAGTGG + Intronic
1037398902 8:18473242-18473264 AAGACTAACTAGATGATGAATGG + Intergenic
1038203043 8:25433963-25433985 AACACTAACAAGATGCTGGCTGG + Intronic
1039269154 8:35862006-35862028 AAGCATAACCAGATGGGGAGAGG - Intergenic
1039831825 8:41221481-41221503 CAGCCTTACCAGACACTGACAGG + Intergenic
1046488446 8:114916389-114916411 CAGCCTACCCAGAAGCTGAGTGG + Intergenic
1046861947 8:119102772-119102794 CAGCCTGACCAGATGCAGACAGG + Intronic
1048300932 8:133250705-133250727 ACGCCCAACCAGGTGCAGACAGG + Intronic
1051495903 9:17722717-17722739 AAGCCTTATCAGATGCTGAAGGG - Intronic
1052406950 9:28073165-28073187 AAGGCTTACCAGCAGCTGACGGG + Intronic
1052722182 9:32185478-32185500 AAGCCTACTCAGAAGCTGAGTGG - Intergenic
1057242885 9:93427859-93427881 AAGACTGACCTAATGCTGACTGG - Intergenic
1058142532 9:101372432-101372454 AAGCAAAACTAGAAGCTGACAGG + Intronic
1059100653 9:111468956-111468978 AAATCTAACCAGATACTAACCGG + Intronic
1059656972 9:116366146-116366168 AGGCCTAGTCAGATTCTGACAGG + Intronic
1059741472 9:117154750-117154772 AAGGGTAAGCAGATGCTAACAGG - Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1061809608 9:133154754-133154776 AAGCATGACCAGATGATGAATGG - Intronic
1187358548 X:18602128-18602150 AAGCCCAACCAGAAGCTAGCTGG + Intronic
1190404308 X:50071146-50071168 AAGCCTTTCCAGCTCCTGACTGG + Intronic
1195173000 X:102286852-102286874 ATGGCTGACCAGATGCAGACAGG - Intergenic
1195185866 X:102400243-102400265 ATGGCTGACCAGATGCAGACAGG + Intronic
1196805048 X:119575728-119575750 AAACCCAACCAGTTGCTGATAGG + Intronic