ID: 916244579

View in Genome Browser
Species Human (GRCh38)
Location 1:162674793-162674815
Sequence CTCTCTAGGACCTCTTTAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 131}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916244579 Original CRISPR CTCTCTAGGACCTCTTTAAC TGG Intronic
902400357 1:16153925-16153947 TTCTCTAGGGACTCTTTCACGGG + Intronic
905452327 1:38064665-38064687 CTCCCAAGGACCTCTGGAACTGG - Intergenic
905913021 1:41666769-41666791 CTCTCTAGGACACCTTCAAGTGG + Intronic
905959492 1:42032055-42032077 CTCTCCAGCACCTATTTAACAGG + Intronic
908190649 1:61700274-61700296 CTCTTTAAATCCTCTTTAACAGG - Intronic
908612695 1:65880408-65880430 CTCTCTAGGACCTCTTGTTATGG + Intronic
916244579 1:162674793-162674815 CTCTCTAGGACCTCTTTAACTGG + Intronic
924009493 1:239649212-239649234 CTCTCTTGGGCCTCTTTAATGGG - Intronic
924170304 1:241332505-241332527 CTCTCTATGACTTCTTTTAGTGG - Intronic
1066133806 10:32422680-32422702 CTCTCTGGGTCCTCTTTTAAAGG + Intergenic
1066584877 10:36921779-36921801 CTCAGTAGGACCTCTTCAAAGGG - Intergenic
1068910179 10:62372010-62372032 GTCTCTAGGGCCTCTTTATCTGG - Intergenic
1069151893 10:64972669-64972691 CTTTTTAGGACCTCTTTGGCTGG - Intergenic
1069880746 10:71591398-71591420 GTCTTTAGCACCTCTTCAACTGG + Intronic
1071308597 10:84322581-84322603 CTCTCTGGAACCTCTATAGCAGG + Intergenic
1072642365 10:97221579-97221601 CTCTCTGGGGCCTCTTTTAGAGG - Intronic
1074050847 10:109880200-109880222 CTCTCTGTGAACTCTTTAACTGG - Exonic
1075076384 10:119353462-119353484 CTCTCCAGGACCTGTTTCAATGG - Intronic
1078410966 11:11117656-11117678 CTTTCTAGGTCATTTTTAACTGG - Intergenic
1078941743 11:16013943-16013965 CTCACTAGTATCCCTTTAACTGG - Intronic
1080878058 11:36294698-36294720 CTCTCTTGGGCCTCTTTATAAGG + Intergenic
1084736851 11:71110944-71110966 CTCTCTGGGACCTCTTTTGCAGG - Intronic
1085903300 11:80728388-80728410 CTCAGTAGGACCTCTTCAAAGGG + Intergenic
1087856946 11:103103681-103103703 CTCTATTGGTCCTCTTTTACAGG + Intergenic
1087889487 11:103520514-103520536 CTCTCTGGGGCCTCTGTTACTGG - Intergenic
1088211266 11:107459214-107459236 CTCTCTAGAACTTCTTTTATAGG + Intergenic
1089652667 11:119924653-119924675 CTCTCTAGGGCCTCCTAAGCAGG - Intergenic
1091518052 12:1206253-1206275 CTCTTTATGACCTATTCAACTGG - Intronic
1092244030 12:6852954-6852976 CTCTCTAGGAATACTTTAAAAGG - Intronic
1093461454 12:19410721-19410743 CTATCTAGGACCTGTTTCCCAGG + Intronic
1093824635 12:23669131-23669153 CTCTCTAGGAGCTCTGAATCTGG + Intronic
1095931619 12:47631995-47632017 CTCTCCAGGGCCTCTTTAAGGGG + Intergenic
1097470246 12:59981638-59981660 CTCTCTAGGGCTTCTTTCAAGGG - Intergenic
1098017774 12:66124643-66124665 CTCACTGGGACCTCCTTATCAGG + Intronic
1102165037 12:110799268-110799290 CTCTCTCTGACCTCTTTTAAGGG + Intergenic
1104025133 12:125020379-125020401 TTCTCTGGGACCTCTTTATAAGG + Intronic
1105064458 12:133184520-133184542 CTCTCTGAAACCTCTTTAAGAGG + Intronic
1106077738 13:26475668-26475690 CTCTCTAGGACCTGGCTAAATGG + Intergenic
1107298382 13:38939329-38939351 CTCTCTAGGAACTCTGTATAAGG - Intergenic
1107792784 13:44018773-44018795 CTCACTAGGAGCCCATTAACTGG + Intergenic
1108238688 13:48437701-48437723 CTCTCTAGGATCTCTTCCACTGG - Intronic
1109478102 13:62911539-62911561 CTCTCTGGGGTCTCTTTTACAGG + Intergenic
1112303953 13:98256433-98256455 CTCTCTAGAACATCTTCATCTGG - Intronic
1113380696 13:109803023-109803045 CTCTCAAGGTCCTTTTTAAGGGG - Intergenic
1113565804 13:111319031-111319053 CTCTCTGAGGCCTCTTTAATGGG + Intronic
1115346585 14:32349020-32349042 CCCTCTAGGACCTTTGTTACTGG + Intronic
1116386755 14:44340343-44340365 CTCTCTAGGGACTCTTTTATAGG + Intergenic
1119909013 14:78332940-78332962 CTCTCCAGGACCACTTTAATCGG + Intronic
1122361700 14:101171105-101171127 CTCTCTGGGGTCTCTTTATCAGG + Intergenic
1124124650 15:26928588-26928610 CTCTCTGGGACCTCTTTTATAGG - Intronic
1125124919 15:36208937-36208959 CTCTCTGGAACCTCTTTGATGGG + Intergenic
1125215194 15:37264007-37264029 CTCTCTAGGGCCTATTTATAAGG - Intergenic
1125526615 15:40380208-40380230 CTCTCTGGCACTTCTTTATCAGG + Intergenic
1126706731 15:51413396-51413418 CTCTCTAGTGCCTCTTTCAGTGG - Intergenic
1127435824 15:58957314-58957336 CTCTCAAGGACCCCTGTAGCTGG + Intronic
1129800697 15:78411893-78411915 CTCTCTGGGGCCTCTTTATAAGG - Intergenic
1129946584 15:79543721-79543743 CTCTCTGGGTCCTCTTTTATAGG + Intergenic
1137660017 16:50197186-50197208 CTCTTTATCAGCTCTTTAACAGG - Intronic
1138249921 16:55493987-55494009 GTATCTAGGACCTCATTAAAGGG + Intronic
1138377439 16:56575376-56575398 CTCTCTTTCACCTCTTTAAGTGG + Intergenic
1141083646 16:81076190-81076212 GTCTTCAGGACCTATTTAACTGG - Intronic
1143774602 17:9189813-9189835 CTCACCAGAACCCCTTTAACTGG - Intronic
1146592276 17:34137820-34137842 CTCTCTAGGACCTCTTTATAAGG + Intronic
1151635202 17:75342598-75342620 CTTTCTAGGATCTATTTAAGAGG - Intronic
1153464330 18:5372195-5372217 CTTTCTGGGGCCTCTTTTACAGG - Intergenic
1153950037 18:10050771-10050793 ATCTCTAGGACCACTGTAAGTGG - Intergenic
1155528365 18:26740816-26740838 CTCTCTGGGCCCACTTTATCTGG - Intergenic
1157888769 18:51394494-51394516 CTCTCTGGGACCTCTTCTAAAGG - Intergenic
1159280860 18:66283505-66283527 CTTTCTAGGACCTCATAACCTGG + Intergenic
1161064031 19:2228821-2228843 CTCTCCAGGACCTCTGCAGCCGG - Intronic
1161982572 19:7637507-7637529 CACTCTAGGATCTCTTAAGCCGG + Intronic
929129032 2:38547937-38547959 CTCCCTGGGACCTCTTTTATAGG - Intergenic
936450159 2:112627756-112627778 CTCTGTAGGACCTCTTTTTAAGG - Intergenic
937786268 2:125902854-125902876 CTCTTTAGCTTCTCTTTAACTGG + Intergenic
939286814 2:140141608-140141630 CTCTCTATGACCTATTTATAAGG - Intergenic
940322178 2:152389347-152389369 CTCTCTGGGACCTCTTTTTTAGG + Intronic
941349862 2:164418801-164418823 CTTTCTGGGATCTCTTTAAAAGG + Intergenic
941705641 2:168656098-168656120 CCCTCTAGGACCTATTTAGGAGG - Intronic
942307049 2:174618849-174618871 CTCTGTAGGGCCTCTTTAATAGG - Intronic
944318121 2:198305301-198305323 CTCTCTAGGAACTCTAGAACTGG - Intronic
945558503 2:211308511-211308533 ATCTCTAGGAACTGTTTACCTGG - Intergenic
946724895 2:222652521-222652543 CTCTCTCGGACCTCTCCATCTGG + Intronic
947004457 2:225494578-225494600 CTCTCTAGGACCTAATTTTCTGG - Intronic
947264981 2:228268532-228268554 CTCTCTGGGGCCTCTTTATAAGG + Intergenic
948332098 2:237177758-237177780 CTCGCTAGCTCCTCTTTAACTGG + Intergenic
948517557 2:238513502-238513524 CTCTCTGGGGCCTCTTTTAAAGG - Intergenic
1175530553 20:59671904-59671926 CTCTCTAGGACATCTGCATCTGG + Intronic
1177403588 21:20637813-20637835 CTCTCTTGGGTCTCTTTCACAGG + Intergenic
1177667354 21:24178013-24178035 CTTTCTAGGAGCTCTTCAAATGG + Intergenic
1179041705 21:37808864-37808886 CTCTCTAGCACCTGTTAAAAGGG - Intronic
1184947918 22:47817382-47817404 CTCTATATGACCTCTATTACTGG + Intergenic
1203248112 22_KI270733v1_random:88772-88794 CTCTCTAGGAACTCTGTCCCAGG - Intergenic
953364201 3:42328213-42328235 CTCTCTGGGACTTCTTTATAAGG - Intergenic
961121384 3:124374110-124374132 CTTTCTAGAACCTCTTTAAAAGG - Intronic
962702622 3:138014158-138014180 CTCTCTAAGAGCTCTTTGTCTGG - Intronic
962895868 3:139714245-139714267 CTCTCTGGAACCGCTTGAACAGG - Intergenic
963698386 3:148591943-148591965 CTTTCTGGGACCTCTTTAATAGG + Intergenic
967443390 3:189535537-189535559 CTCTGTAAGAACTCTGTAACTGG - Intergenic
969299103 4:6287119-6287141 CTCTCCAGGACTTCTTCAAAGGG - Exonic
969951004 4:10835554-10835576 CTCTCTGGATCCTCTTTTACAGG + Intergenic
970539845 4:17066594-17066616 CTCTTTAAGACTTCTTTATCAGG - Intergenic
970721164 4:18990523-18990545 CTCTCTAGGATAGGTTTAACAGG + Intergenic
972084585 4:35199985-35200007 CTCTCTGGGTTCTCTTTAATAGG + Intergenic
974986070 4:69027106-69027128 CTCTCTGGGAGCTCTGTCACAGG + Intronic
978371452 4:108033461-108033483 CTGTCTAGTGTCTCTTTAACAGG + Intronic
978841923 4:113224464-113224486 CTCTCCTGAACCTCTGTAACTGG + Intronic
979936587 4:126705291-126705313 CTCTCTGGGGCCTCTTTTAGAGG + Intergenic
989089825 5:37718592-37718614 CTCTCTAGGACCACATTAGGAGG + Intronic
990170679 5:53045887-53045909 CTCTCTAAGACAATTTTAACAGG - Intronic
990845613 5:60135144-60135166 CTCTCTTGGACCTCTTTTATAGG - Intronic
991953716 5:71971758-71971780 CTCTCTGGGGCCTCTTTTATAGG + Intergenic
994057213 5:95431052-95431074 ATCTCTAGGAGCTCTTTATATGG + Intronic
994090437 5:95805294-95805316 CCCTCTGGGTCCTCTTTAAAAGG + Intronic
999664011 5:153894114-153894136 CTCTCCAGGACCTCTGAAACAGG + Intergenic
1001441591 5:171747967-171747989 CTCTCTGGGGCCTTTTTTACAGG + Intergenic
1001541027 5:172539504-172539526 CTCTCTAGGGCTTCTTTTATAGG - Intergenic
1007796825 6:44355785-44355807 CTCTTTAGGTCCTCTGCAACAGG + Intronic
1013786717 6:113789473-113789495 CTCTCTGGGGCCTCTTTCATAGG + Intergenic
1014140782 6:117939626-117939648 CCCTTTAGGTCCTTTTTAACTGG - Intronic
1014558512 6:122862618-122862640 CTCTCCTGGACCTCTTTTAAAGG - Intergenic
1014838150 6:126183562-126183584 CTCCCTGGGACCTCTTTAAAAGG - Intergenic
1021494228 7:21256434-21256456 ATATTTAGCACCTCTTTAACTGG - Intergenic
1023624735 7:42104780-42104802 TTCTCTGGGGCCTCTTTAAAAGG - Intronic
1023909394 7:44542531-44542553 CTCTCTAGGTCCTCTGTTCCCGG + Intergenic
1026248008 7:68640056-68640078 CTCTCTAGGGCCTCTTTTATAGG - Intergenic
1027730871 7:81870831-81870853 CTCTCTTGTCCCTATTTAACTGG + Intergenic
1036234001 8:7022519-7022541 CTCTCTGGGACCTCTTCTACAGG - Intergenic
1039094007 8:33863830-33863852 CTTTCTAGGACCTATTTTATAGG - Intergenic
1039384317 8:37118914-37118936 CTCTCCAGGATCTCTTTTATAGG + Intergenic
1041623460 8:59999572-59999594 CCCTCTAGGAGCTCTTTCCCAGG - Intergenic
1041724951 8:61009629-61009651 GTCTGTAGGACCTCTTTATGGGG + Intergenic
1041979807 8:63844618-63844640 CTCTCTATGATCTCTTTATTAGG - Intergenic
1044076939 8:87833395-87833417 CTGTCTGAGACCTCTTTTACAGG - Intergenic
1048927025 8:139280586-139280608 CTCTCTGGGACCTCTTTTATAGG + Intergenic
1048929015 8:139296160-139296182 CTCTCTGGGGCCTCTTTATGAGG - Intergenic
1049911047 9:268405-268427 CTCTCTAGCCCTTCTTAAACAGG - Intronic
1050055788 9:1652543-1652565 CTCTCTTGCACCTCTTTGGCAGG - Intergenic
1051589859 9:18766726-18766748 CTCTCTGGAACCTCTTTTAGAGG + Intronic
1051602216 9:18886672-18886694 CTCTCCAGGGCCTCTTTTATGGG + Intronic
1052059651 9:23944962-23944984 CTCTCTAGGGCCTGCTAAACAGG + Intergenic
1052137468 9:24931534-24931556 ACCTCTAGGCCCTCTTTAAAAGG - Intergenic
1052243924 9:26310392-26310414 CTCTCGAGATCATCTTTAACAGG - Intergenic
1052366103 9:27614225-27614247 CACTCCAGGACCTGTTTGACTGG + Intergenic
1055836930 9:80454889-80454911 CTCTCTGGGGCCTCTTTTATAGG + Intergenic
1060045708 9:120338492-120338514 TTCTCTAGAACCACATTAACAGG + Intergenic
1187563344 X:20423345-20423367 CTCTCTCAGTCCTCTTTTACAGG - Intergenic
1188418886 X:29972390-29972412 ATCTCCAGGACGTCTTTAATAGG + Intergenic
1188491458 X:30742489-30742511 CAGTGTGGGACCTCTTTAACTGG - Intergenic
1191023581 X:55889256-55889278 CACTCCAGGCCCTCTTTGACTGG + Intergenic
1193061790 X:77214929-77214951 CTCTCTAGGAGCTCCATCACAGG + Intergenic
1194247886 X:91537731-91537753 CCCTCTAGGACCTCTGTCCCAGG - Intergenic
1197824563 X:130575132-130575154 CTCTCTAGGATCCCTTTTATAGG + Intergenic
1200566903 Y:4779260-4779282 CCCTCTAGGACCTCTGTCCCAGG - Intergenic