ID: 916245599

View in Genome Browser
Species Human (GRCh38)
Location 1:162685450-162685472
Sequence TACAAACTAGCTTTTTAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916245599 Original CRISPR TACAAACTAGCTTTTTAGAC TGG Intronic
900756184 1:4436539-4436561 TAAGTACTAGCTTCTTAGACTGG - Intergenic
901042804 1:6375638-6375660 TACAAAAAAACTTTTTAGGCCGG + Intronic
901441957 1:9283387-9283409 CACCAACTTGCTTTTCAGACAGG - Intergenic
902412925 1:16222083-16222105 TACAAACTAGTTTGTGAGACAGG + Intergenic
908506395 1:64805587-64805609 AACAAAATAGCTTTTTTGGCAGG + Intronic
909283745 1:73789228-73789250 TACATACTACCTTGTTAGATGGG + Intergenic
911472524 1:98335747-98335769 TACATACTAGCTGTTTGAACTGG + Intergenic
913977657 1:143476285-143476307 TACATACTGACTTTTTAGAGAGG + Intergenic
914072061 1:144301916-144301938 TACATACTGACTTTTTAGAGAGG + Intergenic
914107094 1:144664440-144664462 TACATACTGACTTTTTAGAGAGG - Intergenic
915451497 1:156008556-156008578 TAAGAACTAGCTTTTTGGCCAGG - Intergenic
916245599 1:162685450-162685472 TACAAACTAGCTTTTTAGACTGG + Intronic
921062040 1:211593546-211593568 CCCAAACTAGCTTTCAAGACAGG - Intergenic
922818578 1:228469139-228469161 TACAAACAAGCATTTAATACAGG + Intergenic
1069874714 10:71554627-71554649 TACAGGCTAGCTTTTTAGACAGG + Intronic
1070226026 10:74507314-74507336 TTCAAAATTGCTTTCTAGACTGG + Intronic
1071207857 10:83303068-83303090 TCCTAAATAGCTTTTTAGAAAGG - Intergenic
1071227219 10:83544469-83544491 TACAATCTGGCTTCCTAGACAGG + Intergenic
1072262311 10:93691026-93691048 TACAAGATAGCTTTTTAAATAGG + Intronic
1074345973 10:112686855-112686877 TACAAACTATGTATATAGACAGG + Intronic
1074932030 10:118138207-118138229 TTGAAACTATCTTTTTATACTGG + Intergenic
1075436396 10:122446577-122446599 TATAAATTAACTTTTTATACTGG + Intergenic
1075917400 10:126180746-126180768 TACAAAGAAGCTTCTTAGAAAGG + Intronic
1076073823 10:127515754-127515776 TTCAAGGTAGCTTTTTAGAGAGG - Intergenic
1079734916 11:23984948-23984970 GACAAACTAACATTTTAAACAGG - Intergenic
1086644357 11:89201304-89201326 GATAAACTGGCTATTTAGACAGG - Intronic
1087595742 11:100252782-100252804 TCCAAATTAGCTATTTAGAGAGG - Intronic
1091959562 12:4681367-4681389 TACAAATTATTTTTATAGACAGG + Intronic
1092063463 12:5569533-5569555 TGCAGACTAGCTTTTTAGACAGG - Intronic
1094227822 12:28066176-28066198 CACAAACTTGCTTTCCAGACAGG - Intergenic
1098443560 12:70543154-70543176 TAGAAAATAGCTTTTTAGATAGG - Intronic
1099128112 12:78791980-78792002 TAGGAACTCGCTTTTTAGATAGG - Intergenic
1099788506 12:87298875-87298897 TACAAAATTGCTTTGTAGATTGG - Intergenic
1099842926 12:87989417-87989439 TACAAACTAGCTTTCAATACAGG + Intronic
1102998366 12:117366521-117366543 TCCAACCTAGCGTTTTACACTGG + Intronic
1104694152 12:130851072-130851094 TACAAAAAATCTTTTTAGGCTGG + Intergenic
1105221680 13:18335166-18335188 TACATACTGACTTTTTAGAGAGG - Intergenic
1105607754 13:21941295-21941317 TACTAACTAGCTTTTAAGTCTGG + Intergenic
1107863829 13:44684311-44684333 TACAAAGTTTCTTTGTAGACAGG + Intergenic
1110995964 13:82110058-82110080 TGCAAAATAGCTTTTTAAAAAGG - Intergenic
1112040420 13:95541658-95541680 TCCACACTCACTTTTTAGACGGG + Intronic
1114352942 14:21874376-21874398 CACAAACTAGCTTGCTACACCGG + Intergenic
1116521694 14:45855982-45856004 TACAAAGTAGTTTTTTGTACAGG - Intergenic
1117723509 14:58649504-58649526 TACAAACTAGCTGGTCACACTGG - Intergenic
1118201267 14:63676061-63676083 TATATACAAACTTTTTAGACAGG + Intergenic
1118371188 14:65138475-65138497 TACAAACTATCTTTTTTGCAAGG + Intergenic
1119609024 14:76046115-76046137 GAAAAAGTTGCTTTTTAGACAGG + Intronic
1119784804 14:77304867-77304889 TACAACCTAACATTTAAGACAGG + Intronic
1120768274 14:88351821-88351843 TACAAAATAGCTTTTTAATTTGG + Intergenic
1121163226 14:91765549-91765571 TAAAAAGTAGCCTTTTAAACTGG - Intronic
1124024662 15:25954304-25954326 TACAAACTGGTTTTATATACAGG + Intergenic
1126058876 15:44759208-44759230 TAGAAAACAGCTTTTCAGACAGG - Intronic
1130166016 15:81460085-81460107 TAAAAAATATTTTTTTAGACAGG + Intergenic
1130712385 15:86296162-86296184 TACGAACTAGCTTTTGAAAATGG + Intronic
1130917403 15:88316394-88316416 TAAAAACTAGGTTTATAGCCAGG - Intergenic
1133548025 16:6827004-6827026 TGTAAACTAACTTTTTAGTCTGG + Intronic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1134486284 16:14661299-14661321 TTCAAAATAGCTTTTTAAAAAGG + Intronic
1135071853 16:19358912-19358934 TAAAAATTATTTTTTTAGACAGG - Intergenic
1137811362 16:51355947-51355969 TAAAGACTAGATGTTTAGACAGG + Intergenic
1139045980 16:63060768-63060790 TACAAACTGGCTTTGTGGTCCGG + Intergenic
1143223412 17:5281189-5281211 TTCAAAATAGCTTTTTAGGCCGG + Intergenic
1144538691 17:16116577-16116599 GACAAACTATGTTTTCAGACTGG - Intronic
1146083159 17:29801512-29801534 TTGAAACTAGCTTTGAAGACTGG - Intronic
1149198671 17:54155847-54155869 TACAGCCTAGCTTTTTTAACAGG + Intergenic
1150317610 17:64182651-64182673 GACAAACTAGTTTCCTAGACTGG - Intronic
1155398298 18:25410031-25410053 TAGTATGTAGCTTTTTAGACTGG + Intergenic
1156072356 18:33227995-33228017 TTCAAAATGGCTTTGTAGACTGG + Intronic
1156639317 18:39071116-39071138 TACAAACCAGCTTCAGAGACTGG - Intergenic
1161223381 19:3130055-3130077 CAGAAAGTAGCTTTTGAGACTGG - Intergenic
1164071626 19:21774654-21774676 TACAATCAAACTGTTTAGACTGG - Intergenic
934182365 2:89637278-89637300 TACATACTGACTTTTTAGAGAGG + Intergenic
934292662 2:91711486-91711508 TACATACTGACTTTTTAGAGAGG + Intergenic
938087690 2:128412170-128412192 CACAAACTTGCATTTTAGAAAGG + Intergenic
938951482 2:136258671-136258693 TGCAAACTAGATTTTATGACAGG + Intergenic
939333448 2:140793340-140793362 TACAAACTAGCACTTTAATCTGG + Intronic
941150720 2:161911819-161911841 AACAATCTAGCTTTTTAGGGGGG - Intronic
941580029 2:167284516-167284538 TGAAAACTATCTTTTTAGAAAGG - Intergenic
941686157 2:168451219-168451241 TACAAAGTAGCTTTCTTGAGAGG + Intergenic
942000324 2:171640058-171640080 TAAAAAGTGGCTTTTTCGACAGG - Intergenic
944238409 2:197461971-197461993 TAAAAACTACCTCTTTAGGCCGG + Intronic
945582828 2:211617588-211617610 TACAAACCAGCTTTTCGGATTGG - Intronic
948742600 2:240057422-240057444 TACAAACCAGCTCTCAAGACTGG - Intergenic
1170282590 20:14667618-14667640 CACACACAAGCATTTTAGACGGG + Intronic
1172539575 20:35700514-35700536 GAGAAACCAGCTTTTTTGACTGG - Intronic
1172599209 20:36172024-36172046 TACAAGTTGGCTTTTTAGAAAGG - Intronic
1174660986 20:52212780-52212802 AAAAAACTAGCTTTTAACACTGG - Intergenic
1176155033 20:63615088-63615110 TACACCCTGGCTTTGTAGACTGG + Intronic
1176211183 20:63922836-63922858 TAAAACCTAGATTTTTAGAAAGG - Intronic
1177320268 21:19512036-19512058 TACAAATTTGCTTTATATACGGG - Intergenic
1183173641 22:36205830-36205852 CACACACCAGCTTTTGAGACAGG + Intergenic
951690132 3:25386444-25386466 AAAAAAGTAGCTTTTTAGAAAGG + Intronic
952585001 3:34881427-34881449 TAAAAATTAGCTTTTAAGAGAGG + Intergenic
954935493 3:54323045-54323067 TACAAACTCTCTTTAAAGACGGG - Intronic
956604191 3:71055512-71055534 TACAAATTATCTTTTTAAAAGGG - Intronic
957120251 3:76081190-76081212 TACAAACTACATTTTTAAGCAGG + Intronic
958194115 3:90220673-90220695 TAGAAATTAGCATTTTAGGCTGG - Intergenic
958983411 3:100752112-100752134 TGCTAACTAACTTTTTAGAGAGG + Intronic
962022976 3:131519054-131519076 AACAAAATGGCTTTTTAGAGTGG + Intergenic
963553832 3:146760370-146760392 TTGATACTAGCTTTTTAGGCAGG + Intergenic
964137222 3:153358060-153358082 TACAATGTGGCTTTTTGGACTGG + Intergenic
964386868 3:156156710-156156732 TAGGAACTTACTTTTTAGACAGG + Intronic
964479859 3:157129837-157129859 TATAAACTAGCTTCCTACACTGG + Intergenic
964897002 3:161610581-161610603 AACAAACTACCTTTTTTGAATGG - Intergenic
965055135 3:163701407-163701429 TACAAATAAGCTTTTAACACTGG + Intergenic
966544741 3:181133230-181133252 CACAAAATAGCTTTTTATTCAGG + Intergenic
967722670 3:192831906-192831928 TCCAAACTAGCTAATTAAACTGG + Intronic
972797193 4:42433360-42433382 GACAAACTAGCTCTTCAGAATGG + Intronic
975000850 4:69222426-69222448 TGCAAACTTGCATTTTAGATGGG - Intergenic
975410395 4:74042145-74042167 TACCTGCTAGCTTTCTAGACAGG + Intergenic
976653630 4:87463098-87463120 TAAAAAATACCTTTTTAGACTGG + Intergenic
979293961 4:119009827-119009849 TACACACTAGTGTTTGAGACTGG - Intronic
981775178 4:148358804-148358826 TACAAATTAACTTATTAGCCAGG - Intronic
982158287 4:152541591-152541613 TATAAACTTTTTTTTTAGACAGG + Intergenic
985892603 5:2727352-2727374 AACGAACTAGCATTTTAGAGAGG + Intergenic
988191549 5:27943341-27943363 TGCAAATTAGCTTTTCAGTCAGG + Intergenic
988987588 5:36635944-36635966 TACAACCTCCCTTTCTAGACAGG - Intronic
989971380 5:50529029-50529051 TTCAAATTAATTTTTTAGACAGG + Intergenic
990578057 5:57142595-57142617 TAAAAACTAACTTTTTGGCCGGG + Intergenic
993581427 5:89666409-89666431 TACAAACTCAGTTTTTACACTGG + Intergenic
994705550 5:103201027-103201049 TACCTTCTAGCTTTTTAGAGAGG + Intronic
996457058 5:123696707-123696729 TAAAAGCAAGCTTTTTAGCCAGG - Intergenic
996510494 5:124310522-124310544 GAAAAACTAGGTTTTAAGACAGG - Intergenic
1001730680 5:173953916-173953938 TACAAACTAAGTTTACAGACTGG - Intronic
1002004829 5:176223679-176223701 TACAAACTATCTTATTATAATGG - Intergenic
1002221544 5:177686945-177686967 TACAAACTATCTTATTATAATGG + Intergenic
1008096539 6:47345011-47345033 TAGAATCTAGCTTCTTAGATGGG - Intergenic
1008515041 6:52310832-52310854 TACAAAATAGATTTTTCAACTGG + Intergenic
1010462450 6:76128529-76128551 TACAAACACACTTTTTAGGCCGG - Intergenic
1014974956 6:127868791-127868813 TAGAATCTAGCTTTTCAGAGAGG + Intronic
1015359107 6:132315906-132315928 AAAAAACTGGCTTTTTAGAAAGG + Intronic
1017169109 6:151439213-151439235 TACATACTATCTATGTAGACAGG + Intronic
1020954393 7:14722343-14722365 TACAGACTGGCTATTTAGACTGG + Intronic
1021346615 7:19537247-19537269 TAAAAACTAACTTTTTGGCCGGG + Intergenic
1027360427 7:77402790-77402812 TTTAAACTAGCTTTGTAAACAGG - Intronic
1029426833 7:100500227-100500249 TACAAAATATTTTTTTAGGCTGG - Intergenic
1031439400 7:121774536-121774558 GACAAATGAGCTTTTAAGACAGG + Intergenic
1031620491 7:123929044-123929066 TCCAAAGTAGCTTTTTTGTCTGG - Intronic
1034339846 7:150345608-150345630 TAAAAACTATTTTTTGAGACAGG + Intergenic
1034599469 7:152235563-152235585 TACATACTGACTTTTTAGAGAGG + Intronic
1036734884 8:11303834-11303856 TAGAAACTATGTTTTTAAACTGG + Intronic
1037378741 8:18261715-18261737 TTCAAACTAGCTCTGCAGACTGG + Intergenic
1037532087 8:19787451-19787473 TACAAAATACCTATATAGACTGG + Intergenic
1038511864 8:28145065-28145087 TACTATCTAGCTTTTGATACAGG - Intronic
1040503965 8:48030422-48030444 TAAAACCTAGCTTTTCAGGCTGG + Intronic
1042257265 8:66817646-66817668 TAAAAATTAGCTTTTTTGGCTGG - Intronic
1043589728 8:81816050-81816072 TCCAAACTTGCTTTTTAGAAAGG - Intronic
1045944306 8:107778410-107778432 GACACACAAGCTTTTTAGAGTGG + Intergenic
1046320438 8:112567410-112567432 AACAAACTAACTTTTTAGTGGGG - Intronic
1047791545 8:128208772-128208794 TTCAACCTTACTTTTTAGACAGG + Intergenic
1049948928 9:625615-625637 TAAAAATTAGTGTTTTAGACAGG + Intronic
1057458824 9:95240260-95240282 TACAAAATAGATTTTGAGAGAGG + Intronic
1058808985 9:108620676-108620698 TACACAGTAGGTTTTTAGCCTGG + Intergenic
1058952827 9:109919381-109919403 TACAAACTAATTTTTTAAACTGG + Intronic
1059856711 9:118406804-118406826 TACAAACTAGTATTTTAGATGGG - Intergenic
1059907387 9:119003246-119003268 CACAAACCAGCTTTGTAGAAAGG - Intergenic
1188627347 X:32301629-32301651 TACAAACTAACTTTTTTAAATGG + Intronic
1192783882 X:74319499-74319521 TACAAACCAGCCTTTGAAACAGG + Intergenic
1194406873 X:93507252-93507274 TACAAAGGAGCTTTAAAGACAGG - Intergenic
1195273771 X:103258333-103258355 TAAAAACTATCTTTTTAAAAAGG + Intergenic
1195675767 X:107506383-107506405 CACAAGGTAGCTTTTGAGACAGG + Intergenic
1201865470 Y:18648578-18648600 TATAGACTAGCTTTTTGGATAGG + Intergenic