ID: 916247696

View in Genome Browser
Species Human (GRCh38)
Location 1:162705261-162705283
Sequence GGGGCTGTTAAGACGCAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 75}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916247696_916247702 15 Left 916247696 1:162705261-162705283 CCTGACTGCGTCTTAACAGCCCC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916247696 Original CRISPR GGGGCTGTTAAGACGCAGTC AGG (reversed) Intronic
902781840 1:18709993-18710015 TGTGCTGTTAAGACGCACCCAGG - Intronic
904004360 1:27356096-27356118 GCAGCTGTCAAGAAGCAGTCAGG + Exonic
904872917 1:33633196-33633218 GGGGCGGTGTAGACACAGTCTGG + Intronic
910485674 1:87710930-87710952 GGGGCTGTCAAGACAGAGCCAGG - Intergenic
914373548 1:147051870-147051892 TTGGCTGTTAATACGCACTCCGG + Intergenic
916247696 1:162705261-162705283 GGGGCTGTTAAGACGCAGTCAGG - Intronic
918224603 1:182470242-182470264 GGGGGTGTTGAGAAGCAGTGGGG - Intronic
1065201528 10:23317222-23317244 GGCGCTGTTATGACCCAGCCAGG - Exonic
1068533035 10:58210270-58210292 GGGGCTGTTAACATGCACTGTGG - Intronic
1071533071 10:86403628-86403650 GTTGCTGTTGAGACGGAGTCTGG + Intergenic
1074534607 10:114319935-114319957 GGTGCTGTTAAGAAGCAGATAGG + Intronic
1076288363 10:129323571-129323593 CGGGCTGTTGCCACGCAGTCTGG + Intergenic
1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG + Intronic
1083234975 11:61345476-61345498 GGGGCTGTGCAGCCGCAGTCAGG - Exonic
1086690718 11:89786836-89786858 GAGGCTGTTCAGGCCCAGTCAGG + Intergenic
1101112288 12:101497714-101497736 GGATTTGTTAAGACACAGTCAGG + Intergenic
1103560272 12:121789926-121789948 TGGGCTGTGAAGACACAGACGGG - Intronic
1113755490 13:112808282-112808304 GGGGATGTTAAGAGGGGGTCAGG + Intronic
1116834486 14:49757183-49757205 GTTGTTGTTGAGACGCAGTCTGG + Intergenic
1119886013 14:78142944-78142966 GGTGGTGATAAGACTCAGTCTGG + Intergenic
1120024782 14:79570567-79570589 AAGGCTGTTCAGACCCAGTCAGG + Intronic
1122199188 14:100111898-100111920 GGGTCTTTTGAGAGGCAGTCTGG - Intronic
1128784247 15:70383205-70383227 GGTGATGTTAAGAGGCAGTGCGG + Intergenic
1133855624 16:9546774-9546796 GGTTCTGTTAAGATGTAGTCGGG - Intergenic
1134884054 16:17774242-17774264 GGGGCTGGGAAGACTCAGACAGG - Intergenic
1146633238 17:34485367-34485389 GGGGCTTTGCAGACGCAGACGGG + Intergenic
1147341395 17:39754886-39754908 GGAGCTGTGAAGCCGCAGGCAGG + Intergenic
1148027338 17:44597923-44597945 GGGGCTGTTACCAAGCAGTGTGG + Intergenic
1156905149 18:42343669-42343691 TGGTCTTGTAAGACGCAGTCTGG - Intergenic
1158453953 18:57590626-57590648 GGGTCTTTGCAGACGCAGTCAGG - Intergenic
1163347067 19:16749997-16750019 GGGGCAGTTGAGAGGCAGCCAGG - Exonic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1167616385 19:50536593-50536615 GGGGCTGTTCAGACACAGGAGGG + Intronic
928797066 2:35034933-35034955 GGTGCTGTTATGACCCAGCCAGG - Intergenic
932381400 2:71287133-71287155 GAGGCTGTTAAGACCCAGCTAGG + Intronic
933700941 2:85255174-85255196 GATCCTGTTAAGATGCAGTCTGG - Intronic
936462729 2:112724333-112724355 GGGGGTGATAGGAGGCAGTCAGG + Intronic
937627487 2:124059664-124059686 AGGGCTGTTAAGAAGGAGTTGGG + Intronic
938195512 2:129324157-129324179 GGGGCTATTTAGAAGCAATCTGG + Intergenic
945644925 2:212479249-212479271 GGGGCTTTAAAGAGGCAATCAGG - Intronic
1171029299 20:21662957-21662979 GGGGGTGACAAGAAGCAGTCAGG + Intergenic
1174917405 20:54668236-54668258 TGGGCAGTTAAGAAGCAGCCTGG + Intergenic
1176138833 20:63536382-63536404 GAGGCTGTAAAGAGGCCGTCGGG - Intronic
1180952325 22:19726132-19726154 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952347 22:19726232-19726254 GGGGCCGTGAGGACGCTGTCGGG + Intergenic
1180952353 22:19726252-19726274 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952432 22:19726652-19726674 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952462 22:19726772-19726794 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952467 22:19726792-19726814 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952479 22:19726832-19726854 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952507 22:19726970-19726992 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952542 22:19727148-19727170 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1180952585 22:19727346-19727368 GGGGCTGTGAGGACGCTGTGGGG + Intergenic
1180952596 22:19727386-19727408 GGGGCGGTGAGGACGCTGTCGGG + Intergenic
1183068175 22:35378038-35378060 GGGGCTGTTCTAACGAAGTCTGG + Intergenic
951389751 3:22088368-22088390 GGGCCTGGTAACACTCAGTCTGG + Intronic
954859035 3:53671979-53672001 GGAGGTGTTAAGAACCAGTCAGG - Intronic
956250810 3:67231840-67231862 GGGGCTGTCAAATCGCAGTCAGG + Intergenic
962476951 3:135763262-135763284 GGGGCTGGGAACAGGCAGTCAGG + Intergenic
962763900 3:138543382-138543404 GGTGCTGTCATGACCCAGTCAGG - Intronic
962884132 3:139607912-139607934 GGGGTTGTCAAGACGGAGTTAGG - Intronic
968733935 4:2285605-2285627 GGGGCTGTGGAGCTGCAGTCAGG - Intronic
1001435707 5:171697645-171697667 GGGGCTGAGAACAAGCAGTCGGG + Intergenic
1007076875 6:39073918-39073940 GGTGCTGTTAAGATGCCGTAGGG + Intronic
1007754578 6:44090574-44090596 GGGGCTCTTAAGACCAACTCAGG - Intergenic
1022048728 7:26644300-26644322 GGGGGTGTGAAGAGGCAGCCTGG + Intronic
1027224521 7:76235418-76235440 GGGGCTATTAGGGCGGAGTCGGG + Intronic
1030703057 7:112662268-112662290 GGGACTCTGAAGAGGCAGTCTGG + Intergenic
1031918565 7:127585232-127585254 AGGGCCGTGAAGACGCAGGCGGG + Exonic
1032891523 7:136199921-136199943 GGGGCTGTCAGGATGCAGTCTGG + Intergenic
1040384317 8:46903416-46903438 GGAGCTGTGAAGACGCTTTCTGG - Intergenic
1046550629 8:115711613-115711635 GAGGATGCTAAGAGGCAGTCTGG - Intronic
1048164073 8:132046559-132046581 GGGGGTGTGAAGATGCAGCCTGG + Intronic
1052267915 9:26595556-26595578 GAGGCTGTTAAAACCCAGCCTGG - Intergenic
1059476840 9:114554147-114554169 GGGGATGGTAATACTCAGTCTGG + Intergenic
1059774393 9:117461199-117461221 GGGGCTGTGAGGATGCAGACAGG - Intergenic
1061727509 9:132589700-132589722 GGGGCTGGGGAGACGCAGTCCGG - Exonic
1062286616 9:135775876-135775898 GGAGTTGCTAAGACGCAGCCGGG - Intronic
1186783221 X:12934244-12934266 GGGCTTGTTAAAACACAGTCTGG + Intergenic
1189152773 X:38725263-38725285 GGGGCTGTAATGAGGCACTCCGG - Intergenic
1190718590 X:53127565-53127587 GGGGCTGTGAAGAAGCAGTGAGG + Intergenic