ID: 916247702

View in Genome Browser
Species Human (GRCh38)
Location 1:162705299-162705321
Sequence TCATTCCAGCTACGAGCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916247693_916247702 18 Left 916247693 1:162705258-162705280 CCCCCTGACTGCGTCTTAACAGC 0: 1
1: 0
2: 0
3: 3
4: 63
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247695_916247702 16 Left 916247695 1:162705260-162705282 CCCTGACTGCGTCTTAACAGCCC 0: 1
1: 0
2: 0
3: 3
4: 76
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247694_916247702 17 Left 916247694 1:162705259-162705281 CCCCTGACTGCGTCTTAACAGCC 0: 1
1: 0
2: 0
3: 3
4: 92
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247698_916247702 -4 Left 916247698 1:162705280-162705302 CCCCTGCCATTGGTGATTTTCAT 0: 1
1: 0
2: 2
3: 20
4: 239
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247701_916247702 -10 Left 916247701 1:162705286-162705308 CCATTGGTGATTTTCATTCCAGC 0: 1
1: 0
2: 1
3: 15
4: 208
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247700_916247702 -6 Left 916247700 1:162705282-162705304 CCTGCCATTGGTGATTTTCATTC 0: 1
1: 0
2: 1
3: 24
4: 244
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247696_916247702 15 Left 916247696 1:162705261-162705283 CCTGACTGCGTCTTAACAGCCCC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58
916247699_916247702 -5 Left 916247699 1:162705281-162705303 CCCTGCCATTGGTGATTTTCATT 0: 1
1: 0
2: 0
3: 25
4: 271
Right 916247702 1:162705299-162705321 TCATTCCAGCTACGAGCCAATGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916247702 Original CRISPR TCATTCCAGCTACGAGCCAA TGG Intronic