ID: 916249888

View in Genome Browser
Species Human (GRCh38)
Location 1:162726759-162726781
Sequence CTACAGAAGAACAACAGTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916249884_916249888 27 Left 916249884 1:162726709-162726731 CCTGCAGAGCTCAGTTTTGCTCA 0: 1
1: 0
2: 1
3: 19
4: 193
Right 916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 180
916249883_916249888 30 Left 916249883 1:162726706-162726728 CCACCTGCAGAGCTCAGTTTTGC 0: 1
1: 0
2: 0
3: 15
4: 197
Right 916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916249888 Original CRISPR CTACAGAAGAACAACAGTGT TGG Intronic
900241671 1:1620269-1620291 CTGCAGAAGGATCACAGTGTGGG + Intronic
903738562 1:25544967-25544989 CCACAGCTGAACAACAGAGTGGG - Intronic
905318571 1:37099359-37099381 CTACCCAAGAACAACCGCGTAGG - Intergenic
907351190 1:53832755-53832777 CAACTCAAGAACTACAGTGTGGG + Intronic
907802714 1:57787217-57787239 AAACAGAAGAACAAAATTGTAGG + Intronic
908520229 1:64934487-64934509 GTAAAGAAAAACAACAGTGAAGG + Intronic
908958044 1:69659667-69659689 TTTCAGAAGAACAACAGAGAGGG + Intronic
909649120 1:77953531-77953553 CTACAGAACAACAACAGAAAAGG + Intronic
909936167 1:81553913-81553935 ATACATAAGCAAAACAGTGTTGG - Intronic
910617343 1:89213839-89213861 CTACAGAAGAAAAAAATGGTGGG + Intergenic
910893695 1:92044953-92044975 CTAAAAAAGAAAAAAAGTGTGGG - Intronic
910958285 1:92731598-92731620 CAAAAAAAGAACAACAGTGGAGG + Intronic
912635151 1:111284990-111285012 CTAAAGAAGAACAACTTTGGAGG + Intergenic
915804738 1:158834003-158834025 CTACAGAAAATAACCAGTGTTGG - Intronic
916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG + Intronic
918179583 1:182074957-182074979 CAACAGAAAAACAACAATATTGG + Intergenic
921348505 1:214211729-214211751 CTACAGAAAATCAGCAGTGGGGG + Intergenic
1068238386 10:54269518-54269540 CTTCAACAGAATAACAGTGTTGG + Intronic
1068717600 10:60205485-60205507 CTAGAGAAGTACTACAGTATAGG + Intronic
1069190014 10:65475741-65475763 CAGCAGAAGAAAAACAGTCTGGG - Intergenic
1070454392 10:76596608-76596630 CTACAAAAAAACAACACTTTGGG + Intergenic
1071399050 10:85251551-85251573 TCACAGAAGGACAACAGTGTGGG - Intergenic
1075428820 10:122363900-122363922 CTACAGCAGGACACCTGTGTTGG + Intergenic
1076034933 10:127191627-127191649 CTAGAGAAGAACAAGGGTGGGGG + Intronic
1078698994 11:13662865-13662887 ACACAGAGGAACAACTGTGTAGG - Intergenic
1079595395 11:22238636-22238658 CTACAGAAGAAGAAAAAAGTTGG + Intronic
1081623448 11:44632796-44632818 CTACAGCAGAGCATGAGTGTGGG + Intergenic
1085428277 11:76424137-76424159 CTAAAGAAAAACAAGAGTGCAGG + Intergenic
1086357893 11:86024461-86024483 CTCCAGAAGAACCACAGTTCAGG + Intronic
1086579318 11:88379143-88379165 CTTCAGGAAAACAACAGGGTTGG - Intergenic
1087008990 11:93495980-93496002 CTACAGAGGCACAGCATTGTTGG - Intronic
1087014977 11:93545733-93545755 CTACAGAAGGACAACTCAGTAGG - Intergenic
1088811064 11:113392830-113392852 CTTTGGAAGAACAGCAGTGTGGG + Intronic
1090871285 11:130751216-130751238 CTATATAAGAGCATCAGTGTTGG + Intergenic
1096869659 12:54585391-54585413 TGACAAAAGAACAACAGTGGGGG - Intronic
1097806815 12:63974163-63974185 CTGCAGTTGAACAACATTGTAGG - Intronic
1098568867 12:71966827-71966849 CTTTAGAAGAACTTCAGTGTGGG - Intronic
1101718882 12:107334222-107334244 CTCCAGAGGAACAAGAGTGCAGG + Intronic
1102101738 12:110283499-110283521 CTACAGCAGAAAAAGGGTGTTGG + Intronic
1102845030 12:116171481-116171503 CTAGAGAGGAAAAAAAGTGTTGG - Intronic
1106713441 13:32362812-32362834 TGACAGGAGAACAGCAGTGTGGG - Intronic
1108275643 13:48806916-48806938 GTACAGAAGAAAGTCAGTGTTGG - Intergenic
1110521278 13:76479781-76479803 CTAAAGAAGAAAAATAATGTGGG - Intergenic
1110682169 13:78327659-78327681 TATCAGAAGACCAACAGTGTGGG - Intergenic
1111843862 13:93485099-93485121 CTGGAGAAGAACAACAGTAATGG + Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1113494774 13:110718274-110718296 CTACAGAAGCACCACTGTGATGG - Intronic
1116136489 14:40930546-40930568 GTTCAGAAGATAAACAGTGTGGG + Intergenic
1118722425 14:68603980-68604002 CTCCAGAAAAACCACAGTGGAGG + Intronic
1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG + Intronic
1119957427 14:78814250-78814272 TTGCAAAAGAACAACAGAGTTGG + Intronic
1124682570 15:31747636-31747658 ATACAGAAGAATGCCAGTGTAGG + Intronic
1127247051 15:57188517-57188539 ATACTGAAAAAGAACAGTGTTGG + Intronic
1130240099 15:82179901-82179923 TTACAGAAGAGCAAAAGTGCTGG + Intronic
1132284557 15:100652936-100652958 CTATAAAAGATCATCAGTGTGGG + Intergenic
1134444005 16:14317067-14317089 CTACAGATGAACATCACTCTTGG + Intergenic
1139161100 16:64509940-64509962 CAACAGAAGAACAACAAAGAAGG + Intergenic
1139315512 16:66064716-66064738 CTACAGAACAACAGCACAGTGGG + Intergenic
1139874018 16:70130556-70130578 TTAAATAAGAACAGCAGTGTTGG - Intronic
1140108404 16:71982159-71982181 TTTCAGAACAACAACAGTCTGGG - Exonic
1144249102 17:13397527-13397549 CTTCAGCAAAACAAGAGTGTTGG + Intergenic
1144855045 17:18262902-18262924 CTAGAGGAGGACAACAGGGTTGG + Intronic
1147968160 17:44205398-44205420 CCACTGAAACACAACAGTGTAGG + Exonic
1148091333 17:45024151-45024173 CTACAGAACAGCAACCGTGATGG - Exonic
1149577223 17:57722895-57722917 CTCCAGAAGACCAACAATGAAGG + Intergenic
1150364896 17:64573514-64573536 CTACAGAACAGCTAAAGTGTAGG + Intronic
1150875610 17:68966922-68966944 CATGATAAGAACAACAGTGTAGG - Intergenic
1151122364 17:71807553-71807575 CTGCAAAGGAACATCAGTGTGGG - Intergenic
1151849947 17:76684365-76684387 CTGCAGAAGGGCAGCAGTGTGGG + Intronic
1152965936 18:113437-113459 ATATAAAAGAACAACTGTGTAGG + Intergenic
1153087422 18:1303811-1303833 CTAGAGAAGAACTACAATTTGGG - Intergenic
1153599649 18:6767406-6767428 CTACAAAAGAATAAAAATGTGGG - Intronic
1154928033 18:20958616-20958638 ATATAAAAGAACAACTGTGTAGG - Intronic
1155221970 18:23693386-23693408 CTAAGAAAGAACAACAGTATAGG - Intronic
1155266957 18:24103735-24103757 ATCCAGGAGAAAAACAGTGTTGG - Intronic
1156401211 18:36742145-36742167 CCACAGAATAACAGCAGTGAGGG + Intronic
1156686688 18:39657585-39657607 CAACAGAAGTACCACAGTGAGGG - Intergenic
1157347228 18:46850396-46850418 CTCCAGTAGAACAACAGCATTGG - Intronic
1157635847 18:49153608-49153630 CAACAGAATAATAACAGTATTGG + Intronic
1158071705 18:53478073-53478095 ATACAGAATAACACCAGTGAGGG + Intronic
1158460069 18:57638558-57638580 CTGCAGAAGAAAAACAAAGTTGG - Intergenic
1158871606 18:61693713-61693735 GTATAGGAGAAAAACAGTGTTGG + Intergenic
1161584474 19:5097732-5097754 CTCCAGAAGAACAAAAGGGAAGG - Intronic
1164493357 19:28735347-28735369 CTGCTGAAGAACAGCAGTGCTGG - Intergenic
1164805562 19:31113770-31113792 CTATACAAGCACAACAGTTTGGG + Intergenic
1167642498 19:50689226-50689248 CTGCAGAAGAAGGACAGTGAGGG - Exonic
925881467 2:8356378-8356400 CTACAGAAGGACATAAGTATTGG - Intergenic
926546963 2:14254227-14254249 ATACAAAAGAATTACAGTGTGGG - Intergenic
928565496 2:32543218-32543240 CTAAAGAAAAAGAAAAGTGTTGG - Intronic
929021158 2:37554647-37554669 TTACACAAGAAAAACAGAGTTGG + Intergenic
929709713 2:44254459-44254481 CTAGAGAAGAACAAAATTGAAGG + Intergenic
930643866 2:53882856-53882878 CTACTGACAAACAACTGTGTAGG + Intronic
937237581 2:120440127-120440149 CTACTGACAAACAACAGGGTAGG - Intergenic
940732594 2:157410531-157410553 ATACTGAAGAACAACAAAGTTGG - Intergenic
942200806 2:173569325-173569347 CTGGAGCAGAACAAAAGTGTAGG - Intergenic
942590914 2:177546075-177546097 CTACAGAAGGGCACAAGTGTTGG + Intergenic
942712560 2:178853162-178853184 CTAGAGATGAACAACAGGGATGG + Intronic
943993356 2:194727185-194727207 TTACTGAAGAAGAAAAGTGTAGG - Intergenic
944187202 2:196962119-196962141 CTCCTGAAGAGCAACAGGGTAGG + Intergenic
944685470 2:202113582-202113604 CTACAGAAGCACCTCTGTGTCGG - Intronic
945123560 2:206484531-206484553 GCACAGAATAAGAACAGTGTAGG + Intronic
946573811 2:221052567-221052589 CAACAGAAGAAGCAAAGTGTAGG + Intergenic
948409856 2:237750650-237750672 CTACAGCAGAGCAGCAGAGTTGG + Intronic
1171164837 20:22960532-22960554 AGACAGAAGGACAACAGTGATGG - Intergenic
1171315857 20:24194141-24194163 CTACATATGAATTACAGTGTAGG + Intergenic
1174844732 20:53933092-53933114 CAACAGAAGGACAAATGTGTCGG - Intergenic
1175555510 20:59852431-59852453 CTACAGGAGAACAACATTTTAGG - Intergenic
1175859122 20:62140554-62140576 ATACAGAAAAATAACAGTGGAGG + Intronic
1176183409 20:63764564-63764586 ATTCAGAAGAACAACAGTGATGG - Intronic
1180692829 22:17731681-17731703 CTACAAAAAAACAAGAGTGAGGG + Intergenic
1182219951 22:28750449-28750471 CCACAAAAGAACAACAGACTAGG - Intronic
1184965775 22:47971057-47971079 CTCCACAAGGACAACAGGGTCGG - Intergenic
949673130 3:6423412-6423434 CAACAAAAAAACAACTGTGTTGG - Intergenic
950205834 3:11079813-11079835 CCAAAGAAGAGAAACAGTGTTGG + Intergenic
951291746 3:20879160-20879182 CTAATGAACAAAAACAGTGTTGG + Intergenic
953143058 3:40247520-40247542 CAAAAGAAGAAAAAGAGTGTGGG - Intronic
955252328 3:57296650-57296672 CTAAAGTAGAAGAACAGCGTTGG + Intronic
957413326 3:79868505-79868527 TTAGAGAAGAACAAAAGTATAGG - Intergenic
964011517 3:151898069-151898091 CAAGAGAAGAACAAAAGTGAAGG - Intergenic
968250408 3:197205752-197205774 CTACAGAACTACAAAAATGTGGG - Intronic
969435093 4:7184724-7184746 CTACAGAACAACCACTTTGTAGG + Intergenic
969683925 4:8658583-8658605 CTCCTGAAAAACAACATTGTGGG - Intergenic
970874742 4:20856445-20856467 CTATACAAGAACCAGAGTGTGGG - Intronic
974604032 4:64125689-64125711 CTACAGAAGCACAAGAGAGTTGG - Intergenic
975400653 4:73934186-73934208 CTAAAGAAGAAAAACAATTTTGG + Intergenic
975426006 4:74228639-74228661 CTCAAGGAGGACAACAGTGTTGG - Intronic
979619649 4:122784494-122784516 CTACAGAAAAACAACTGGATTGG - Intergenic
979882705 4:125982416-125982438 ATAAAGAAGAAAAACAGTATAGG + Intergenic
980116209 4:128681319-128681341 CAACAGAAAAACAACATTTTTGG + Intergenic
984106569 4:175555350-175555372 CTTCACAAGAACAGCAGTATGGG - Intergenic
984795941 4:183659792-183659814 CAAAAGAGGAACGACAGTGTGGG - Intronic
986258452 5:6121826-6121848 CTTCAGAAAAACAACATTTTGGG + Intergenic
987241787 5:16007396-16007418 CTACAGAAGAACTAGGGTGTGGG + Intergenic
987405436 5:17519383-17519405 CTGCAGAAGAACAACAATCGGGG - Intergenic
987405881 5:17522817-17522839 CTACAGAAGAACAACAATCGGGG - Intergenic
987406329 5:17526251-17526273 CTACAGAAGAACAACAATCGGGG - Intergenic
987406777 5:17529685-17529707 CTACAGAAGAACAACAATCGGGG - Intergenic
987407368 5:17584720-17584742 CTACAGAAGAACAACAATCGGGG + Intergenic
987408070 5:17589922-17589944 CTACAGAAGAACAACAATCGGGG + Intergenic
987408515 5:17593356-17593378 CTACAGAAGAACAACAATCGGGG + Intergenic
987408970 5:17596790-17596812 CTACAGAAGAACAACAATCGGGG + Intergenic
990101568 5:52196134-52196156 CCAGAGAAGAAAAACAGGGTGGG - Intergenic
990644531 5:57829298-57829320 CTATATAAGCACAAAAGTGTGGG + Intergenic
990851750 5:60212895-60212917 CCAAAGAAGAACAAAAGTTTAGG - Intronic
991067264 5:62437296-62437318 CACCTGAAGAACAACAGTGCTGG - Exonic
993508282 5:88738424-88738446 CTTCACAAGAACAACCCTGTGGG + Intronic
993542681 5:89172045-89172067 ATCCAGAGGAACAAGAGTGTAGG - Intergenic
994123026 5:96138414-96138436 CTAAAGAAGAAGAACAGTGTTGG - Intergenic
994944464 5:106368228-106368250 CCACAGAAGAAACACAGTTTTGG + Intergenic
995094205 5:108216135-108216157 CAAAAAAAGAAAAACAGTGTTGG - Intronic
997415511 5:133725154-133725176 TTAAAAAAGAAGAACAGTGTTGG - Intergenic
998744087 5:145237073-145237095 GGACAGAAGAACAAGAGGGTTGG - Intergenic
1000415202 5:160977103-160977125 CAACAGAAGAACAATTCTGTGGG - Intergenic
1000570969 5:162913129-162913151 ATACAGAAGAAGACCAGTTTGGG - Intergenic
1001199842 5:169706073-169706095 CTTCAGAGAAATAACAGTGTTGG - Intronic
1004957196 6:20741286-20741308 CCACAGAACAACAAAGGTGTGGG - Intronic
1005187327 6:23177609-23177631 CTACAGTTGGACAACAGTGCAGG - Intergenic
1005815426 6:29548174-29548196 CTACAGAAGAAGCACATTGTGGG + Intergenic
1010480512 6:76347311-76347333 CTAAAGCAGAAGAACAGTTTTGG + Intergenic
1013197783 6:107860746-107860768 CTACATAATAAAAACAGAGTGGG - Intergenic
1014056153 6:117017205-117017227 ATACAGAAAACCAACAGAGTGGG + Intergenic
1014787524 6:125635400-125635422 CAACAGGAGAATCACAGTGTAGG - Intergenic
1014802935 6:125797083-125797105 CTACAGAAGAAAACTAGAGTGGG - Intronic
1016886567 6:148964870-148964892 CTTAAGAAGAACAAAGGTGTTGG + Intronic
1017546465 6:155456575-155456597 CTATAGAAGACAAAGAGTGTGGG + Intergenic
1020844059 7:13260331-13260353 CAAATGAAGAACAACAGGGTAGG - Intergenic
1024121165 7:46242471-46242493 TCACAAAAGAAAAACAGTGTTGG + Intergenic
1027717318 7:81689190-81689212 CCACAGAAGGACTATAGTGTTGG + Intergenic
1029354088 7:100038068-100038090 CTACAGATGAAAAAAAATGTGGG + Exonic
1033832436 7:145270166-145270188 CTAGAGAAGAACAACGGTCCAGG - Intergenic
1039147935 8:34470861-34470883 CTGCAGAACCACAACAGAGTTGG - Intergenic
1039402118 8:37278940-37278962 CCACATAAGAACTACAGTGACGG + Intergenic
1045633403 8:104154820-104154842 CTAAACAAGAAAAACAGTTTAGG - Intronic
1046653121 8:116861662-116861684 TTACAGAAGAACAACTTTCTAGG + Intronic
1046763345 8:118043902-118043924 CTACAGAATAATAACAATATTGG + Intronic
1046825084 8:118680454-118680476 ATATTGAAGAACAACAGTGAAGG - Intergenic
1047062318 8:121241489-121241511 CTACAGAACTGCAACTGTGTTGG - Intergenic
1048280286 8:133100799-133100821 CTACAGAAAAAAAAGAATGTGGG - Intronic
1048330882 8:133470117-133470139 CAATAAAAGAACAACAGTGCTGG + Intronic
1050043024 9:1515274-1515296 ATACAGAAGAAAAACAGGTTAGG + Intergenic
1055150142 9:72987145-72987167 TTAAAGAAGAACAACAAGGTTGG + Intronic
1057914127 9:99042697-99042719 CTGCAGTTGAACAACAGTCTTGG + Intronic
1059670681 9:116489167-116489189 CCATAAAAGAACAATAGTGTTGG + Intronic
1060505633 9:124196470-124196492 CTACACAAAAACAACAGCCTAGG + Intergenic
1060784320 9:126437958-126437980 CTACATTAGAATAACTGTGTTGG - Intronic
1062406252 9:136398006-136398028 GTACAGAAAGACACCAGTGTTGG + Intronic
1187426850 X:19185560-19185582 CTACAGAAAACCAACTCTGTTGG + Intergenic
1189337339 X:40177971-40177993 CTACAGAACAGGAACAGGGTTGG - Intergenic
1190136751 X:47805410-47805432 CTACAGAAGAGCATCATTTTTGG - Intergenic
1190777140 X:53562031-53562053 CTGCAGAAAACCAACAGTCTGGG - Intronic
1192972646 X:76250228-76250250 CTCCAGAAGATCATCAGTGAAGG - Intergenic
1193642706 X:84030967-84030989 TTACAGAAGAACAATACTTTTGG + Intergenic
1196634364 X:117984245-117984267 CTACAGAAGCACTACAGTATAGG + Intronic
1197077012 X:122364547-122364569 CAGCTGGAGAACAACAGTGTGGG + Intergenic
1197149590 X:123205610-123205632 CTACAAAAGCACAACAGTCTGGG + Intronic
1199867985 X:151871473-151871495 CTACAGATGAAGCACAGTGTGGG - Intergenic
1201853783 Y:18518502-18518524 CAATAGAAAACCAACAGTGTAGG - Intergenic
1201879538 Y:18801882-18801904 CAATAGAAAACCAACAGTGTAGG + Intronic