ID: 916251330

View in Genome Browser
Species Human (GRCh38)
Location 1:162741485-162741507
Sequence TGTACTCTGCCAACTACATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916251328_916251330 4 Left 916251328 1:162741458-162741480 CCTGTATATATTTTGAGAGTAAT 0: 1
1: 0
2: 3
3: 35
4: 285
Right 916251330 1:162741485-162741507 TGTACTCTGCCAACTACATAGGG 0: 1
1: 0
2: 0
3: 5
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916251330 Original CRISPR TGTACTCTGCCAACTACATA GGG Intronic
901558274 1:10048831-10048853 TGGCTTCTGCCAACTACAGATGG - Intronic
903296951 1:22350095-22350117 TGTAAACTGCCATCTACATTAGG + Intergenic
907061162 1:51426971-51426993 TTTACTCTTCCAATTATATAGGG + Intronic
907119560 1:51996390-51996412 ATTACTCTGGCAACTACAAAAGG - Intergenic
907348519 1:53804903-53804925 TGTACTGTGGCAAATACATTGGG - Intronic
908827053 1:68143422-68143444 GGTGCTCTGCTAACTACATTTGG + Intronic
909514632 1:76493242-76493264 TGGACTTTGCCAACTCTATATGG - Intronic
909973782 1:82021989-82022011 ACTACTATGCCCACTACATATGG - Intergenic
913595399 1:120371334-120371356 GGTAGTCTGCCAGCTACACATGG + Intergenic
914091875 1:144507641-144507663 GGTAGTCTGCCAGCTACACATGG - Intergenic
914306662 1:146426223-146426245 GGTAGTCTGCCAGCTACACATGG + Intergenic
914595387 1:149146579-149146601 GGTAGTCTGCCAGCTACACATGG - Intergenic
914890813 1:151621280-151621302 TGCTCCCTGCCAACTAAATAAGG + Intronic
916251330 1:162741485-162741507 TGTACTCTGCCAACTACATAGGG + Intronic
916531067 1:165657039-165657061 TGTACTTTTCAAACTACAGATGG + Intronic
919086415 1:192925794-192925816 TGTACTCTGCCGACAGCATAGGG + Intergenic
921876577 1:220203084-220203106 TGTGCTCTGCCAAGTATATCAGG - Intronic
1065320563 10:24505253-24505275 TGTTCTCTGCTAGCTACATTTGG + Intronic
1071703485 10:87969176-87969198 TGTACTCTGCCATCAGCATATGG + Exonic
1071740982 10:88357845-88357867 TTGACTCTGCCAACTTCATCAGG - Intronic
1073453700 10:103624008-103624030 TGTAAGATGCCAACCACATAGGG - Intronic
1086970917 11:93079865-93079887 TGTGCTCTGCTAAATACACATGG + Intergenic
1094238105 12:28191030-28191052 TTTACTTTGCCAAGTACATTGGG + Intronic
1095681232 12:44978474-44978496 AGTACTTTGCAAACTGCATAAGG - Intergenic
1101226062 12:102689341-102689363 TGTACTCTGACAACATCATGAGG + Intergenic
1103391920 12:120580708-120580730 TGTACTTTACCAACTATTTAAGG + Intronic
1107388593 13:39939974-39939996 TGTACAATGCCAAATACAAATGG - Intergenic
1111093586 13:83479403-83479425 TGCACCCTCCCAACTAAATAAGG - Intergenic
1119165159 14:72486425-72486447 TGTACTCTGACATGTACACAAGG - Intronic
1122808348 14:104273608-104273630 TGAACTCTACCAACTATGTAAGG - Intergenic
1130639846 15:85662083-85662105 TGAACTGTGGCAACTACCTATGG - Intronic
1134284544 16:12849077-12849099 TGCACTCTGCCAACTACTCATGG - Intergenic
1138392548 16:56681125-56681147 TGCACTCTGCCCACAAAATAGGG + Intronic
1143282802 17:5767244-5767266 GAAACTCTGCCAACTACATTAGG - Intergenic
1143761251 17:9105723-9105745 TGTACTCTACCAACTGCGTGAGG - Intronic
1149398452 17:56269522-56269544 TGTCCTCTCTCAACTACATGAGG + Intronic
1155145364 18:23078689-23078711 TTTTCTCTGCCAACTAGAAAAGG - Intergenic
1157231005 18:45916008-45916030 ATTACTCTACCAACAACATAAGG - Exonic
925604085 2:5640689-5640711 GGTAGTCTGCCAGCTACACATGG + Intergenic
927752805 2:25685077-25685099 TGTTCTCTGCCATTTACAGATGG + Intergenic
931812832 2:65871533-65871555 TGTATTGTTTCAACTACATAAGG - Intergenic
931849894 2:66242219-66242241 TGTGCTTTGGCAACTCCATATGG - Intergenic
935287989 2:101582149-101582171 TGTAGTCTCCCAGCTCCATAAGG - Intergenic
937710053 2:124970123-124970145 TGTTTTCTGCGCACTACATAAGG + Intergenic
943276561 2:185875761-185875783 TGTGGTCTGCCCACTAGATAGGG - Intergenic
944365149 2:198910323-198910345 ACAACTCTGCCTACTACATAGGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
948647793 2:239418956-239418978 TGAACTCTCCTAACTACACAGGG + Intergenic
948938662 2:241185029-241185051 TGCACTCTGCCAACATCATGAGG - Intergenic
1176551501 21:8224573-8224595 TGTGCTCTGTGAACTAGATATGG - Intergenic
1176570410 21:8407572-8407594 TGTGCTCTGTGAACTAGATATGG - Intergenic
1176578319 21:8451747-8451769 TGTGCTCTGTGAACTAGATATGG - Intergenic
1179241544 21:39597467-39597489 ATTATTCTGCCAACTACACAGGG - Exonic
1180865397 22:19115832-19115854 TGTACTCTGCCACCTCCTGAGGG + Intronic
1203256523 22_KI270733v1_random:141495-141517 TGTGCTCTGTGAACTAGATATGG - Intergenic
952782357 3:37113885-37113907 AGTACACAGCCAAGTACATATGG + Intronic
957339652 3:78878865-78878887 TGTCATCTGCTAACTATATAGGG - Intronic
974213408 4:58812840-58812862 TGTAATCTGGCAAGTAAATAAGG - Intergenic
978712404 4:111800218-111800240 TTTTCTCAGCCAACTCCATATGG - Intergenic
981020211 4:140019568-140019590 TGAACACGGCCAACAACATAAGG + Intronic
982455846 4:155608712-155608734 TGAACTCTGCCAACAACCCAAGG + Intergenic
982895257 4:160913361-160913383 TGTATTCTGCCTACAACTTAAGG - Intergenic
987872462 5:23638412-23638434 GGTACTCTGTTAACTACAAAGGG + Intergenic
993888201 5:93441852-93441874 TGTACTTTGCTAACTTCTTAGGG - Intergenic
996612711 5:125402329-125402351 TGTAATCTACCATTTACATAAGG + Intergenic
1001771862 5:174302827-174302849 TGTATATTGACAACTACATATGG - Intergenic
1003010814 6:2425751-2425773 TGAATTCTGCCAACAACCTAAGG - Intergenic
1004675272 6:17835900-17835922 AGTACTCTCCCAACTACAGTGGG + Intronic
1005117394 6:22353958-22353980 GGTACTCTGCCAGCTGCATGAGG - Intergenic
1009880083 6:69556047-69556069 CGTACTCTGAGACCTACATAAGG + Intergenic
1014826381 6:126052570-126052592 TGAGCTCTGCCAAATGCATAAGG - Intergenic
1015221370 6:130807364-130807386 TGTACTCTGAAAACTACAAAAGG + Intergenic
1016149266 6:140718582-140718604 TGTACTGTTCCAAATAAATAAGG - Intergenic
1018564824 6:165140039-165140061 TGAACTCTGACAATTACCTAAGG + Intergenic
1020845925 7:13283498-13283520 TCGACTCTGCCATATACATATGG - Intergenic
1021517711 7:21505878-21505900 TGTTCTCTGCAAACTACTTCTGG + Intronic
1021665279 7:22970957-22970979 TTTACTCTGCCAAATTCACAAGG + Intronic
1032938942 7:136766586-136766608 TGTATTCGTCCAAATACATAGGG - Intergenic
1032955043 7:136960832-136960854 TGTGCCCTGCCAAATGCATATGG - Intronic
1038956510 8:32474101-32474123 TGTACTCTGCCACAAATATATGG - Intronic
1039822888 8:41149360-41149382 TGAATTCTGCCAACAACCTAAGG - Intergenic
1041440666 8:57892852-57892874 TGTACTTTACCAATTACATTAGG + Intergenic
1041654094 8:60331162-60331184 TGTATGATGCCAGCTACATAGGG - Intergenic
1042041887 8:64600557-64600579 TGTACTCTGCCATCTTGCTAAGG - Intronic
1045382205 8:101638327-101638349 TATAGTCTGCAAACTACAAATGG + Intronic
1046535716 8:115507286-115507308 TTTACTCTGCAAAATATATAAGG + Intronic
1046567160 8:115916771-115916793 TTTACTATGCCATCTACAAATGG - Intergenic
1048541037 8:135342318-135342340 TGAACTCTGCCTACTGCAAAAGG + Intergenic
1062700504 9:137899413-137899435 TGTAGTCTGCCAACTCCTGAGGG + Intronic
1203472680 Un_GL000220v1:123205-123227 TGTGCTCTGTGAACTAGATATGG - Intergenic
1186946267 X:14571244-14571266 TGTGCTCTGTAAACTACAGAAGG - Intronic
1187711368 X:22057863-22057885 TGCACTCAGCCAACCACAGAGGG - Intronic
1187768387 X:22668319-22668341 TGTACTCTGTCAACAATATATGG + Intergenic
1188381037 X:29492808-29492830 ATTATTCTGCCTACTACATATGG + Intronic
1188625583 X:32280601-32280623 TGTATCTTCCCAACTACATATGG + Intronic
1193917725 X:87386445-87386467 TTTATTCTGTCATCTACATAAGG + Intergenic
1196393027 X:115229384-115229406 TGTACTCTGCCAAGCTCACAGGG + Intronic
1196501089 X:116383373-116383395 TGTACTCTGCTGAATACTTAAGG + Intergenic
1201354716 Y:13084633-13084655 TATACTCTACCATTTACATAGGG - Intergenic
1201962994 Y:19702681-19702703 TCTACTCTGCCTACTTCACAGGG - Intergenic