ID: 916252562

View in Genome Browser
Species Human (GRCh38)
Location 1:162753298-162753320
Sequence CAGGAACTGTTGAGAAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 291}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916252555_916252562 13 Left 916252555 1:162753262-162753284 CCTGACCCTAGGGGCTGGGGAAG 0: 1
1: 0
2: 2
3: 40
4: 338
Right 916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG 0: 1
1: 0
2: 1
3: 26
4: 291
916252558_916252562 8 Left 916252558 1:162753267-162753289 CCCTAGGGGCTGGGGAAGGTGGT 0: 1
1: 0
2: 0
3: 49
4: 400
Right 916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG 0: 1
1: 0
2: 1
3: 26
4: 291
916252548_916252562 27 Left 916252548 1:162753248-162753270 CCTGGGCACAGATTCCTGACCCT 0: 1
1: 0
2: 0
3: 21
4: 226
Right 916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG 0: 1
1: 0
2: 1
3: 26
4: 291
916252559_916252562 7 Left 916252559 1:162753268-162753290 CCTAGGGGCTGGGGAAGGTGGTG 0: 1
1: 0
2: 5
3: 97
4: 695
Right 916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG 0: 1
1: 0
2: 1
3: 26
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916252562 Original CRISPR CAGGAACTGTTGAGAAATGA AGG Intronic
901437648 1:9257797-9257819 CAGAAGCCTTTGAGAAATGATGG + Intronic
901624517 1:10616368-10616390 CAGGCACAGGTGAGAACTGAGGG + Intronic
902125054 1:14202312-14202334 GAGGAACTGATGAAAACTGATGG - Intergenic
904543518 1:31250182-31250204 CAGAAACTGTGGAGAAGGGAGGG - Intergenic
905557166 1:38895871-38895893 CAGTAAATATTGATAAATGAAGG + Intronic
906981537 1:50636277-50636299 AAGGAAATTTTGAGAAGTGATGG - Intronic
909098912 1:71325498-71325520 CAGAACCTGTAGAGAGATGATGG + Intergenic
911304521 1:96216532-96216554 GAGGAATTGTGTAGAAATGATGG + Intergenic
912400184 1:109384542-109384564 CAGGAGCTATTGAGATATGTGGG - Intronic
913136644 1:115897165-115897187 TAGAAAATGCTGAGAAATGATGG - Intergenic
916027640 1:160848523-160848545 CAGGAACTTCTCTGAAATGAGGG - Intronic
916252562 1:162753298-162753320 CAGGAACTGTTGAGAAATGAAGG + Intronic
918479174 1:184959138-184959160 CAGGATCAGTTCAGAAATGAGGG - Intronic
919823920 1:201490466-201490488 CAGGAACTGTCTACAAATGGAGG + Intronic
921408537 1:214809372-214809394 CAAGAACTGTTGTGAAAGGAAGG - Intergenic
921477380 1:215628059-215628081 TAGGAAATGATGACAAATGAGGG - Intronic
923910002 1:238430970-238430992 CAGAAACTTTTGGGAATTGATGG + Intergenic
1063111227 10:3039155-3039177 GAGGAACTGGTGGGAGATGATGG + Intergenic
1063551902 10:7041560-7041582 CAGCAACTGATGAGAAAGGTGGG - Intergenic
1064932902 10:20647148-20647170 CAGGAAAGGTTAAGAACTGATGG + Intergenic
1065902976 10:30224593-30224615 CAGGCACTGTTGAGATATGGAGG - Intergenic
1069865070 10:71497235-71497257 AAGGAAATGTTGAAAAATGACGG - Intronic
1070192879 10:74128538-74128560 AAGGAACTGTTTAGCATTGAGGG - Intronic
1070932596 10:80271854-80271876 CAGGAACTATTAACAAATAAAGG + Exonic
1071068330 10:81663257-81663279 TATGTACTGTTGAGAAATGGTGG + Intergenic
1073918886 10:108436268-108436290 CAGGAGCTGGTAAGAACTGAAGG - Intergenic
1076725180 10:132409759-132409781 CAGGAACTGCTGAGAAGGAAGGG + Intronic
1076825627 10:132966162-132966184 CAAGAACTGTTGAAGAAGGATGG - Intergenic
1077820688 11:5736940-5736962 AAGGAACTGGTGACAATTGATGG - Exonic
1078313391 11:10269424-10269446 CTGGAACCGTAGAGAAAAGAAGG + Intronic
1078572029 11:12467637-12467659 CTGGAACTATTTAGAAATTAAGG + Intronic
1080124462 11:28716002-28716024 CAGGAAATGTTCATAAATAAGGG - Intergenic
1080319048 11:30985027-30985049 AAAGAATTGTTCAGAAATGAAGG - Intronic
1081000502 11:37664612-37664634 CAGGAACAGATGGGAAATGTAGG + Intergenic
1081371443 11:42309377-42309399 CAGGAGCTCATGAGAAAGGATGG - Intergenic
1083313263 11:61796974-61796996 GAGGAACTGCTGAGAGAAGATGG + Exonic
1083449501 11:62733510-62733532 CAAGAACTGTGGTGAAATGGGGG + Intronic
1084655289 11:70511634-70511656 GAGAAACTGTTGAGAAATCATGG + Intronic
1084805040 11:71572836-71572858 CAGGAAAGGTTGAGAAATGAGGG + Intergenic
1085102298 11:73811411-73811433 CAGGAACTGAAGAGAGATGTAGG + Intronic
1085191911 11:74633690-74633712 CTGCAATTGTTGAGAAATGATGG + Intronic
1086472233 11:87126903-87126925 CAGGAAATGGTGAGAAATTGTGG + Intronic
1089996598 11:122913717-122913739 CAGGAGATGTTCAGGAATGAGGG - Intronic
1091022868 11:132116477-132116499 CAGAGAATGTTGGGAAATGAAGG + Intronic
1091815414 12:3434192-3434214 TAGGGACTGTTGAGAAATCCGGG + Intronic
1092038620 12:5363471-5363493 CAGGAACTTGCCAGAAATGAAGG + Intergenic
1092983598 12:13822524-13822546 GAGGAACAGTTAAGAAATGAAGG + Intronic
1093156348 12:15690767-15690789 AAGGAACAGTTAAGAATTGAGGG - Intronic
1093930771 12:24953160-24953182 CAGGAACTGTTAATAACTCAAGG - Intergenic
1094071060 12:26413102-26413124 AAGGATCTGTTGAGAAGTGGAGG - Intronic
1094483310 12:30902422-30902444 CAGGAATTATTGAGAAATAGGGG + Intergenic
1094525031 12:31225794-31225816 CATGAAATGGTGAGACATGACGG + Intergenic
1095260798 12:40097030-40097052 AAGGAAGTGTAGAGAAATTAGGG - Intronic
1096340024 12:50790021-50790043 CAGAAACCTTTGAGGAATGATGG + Intronic
1097335840 12:58382513-58382535 TTGGGACTGGTGAGAAATGATGG + Intergenic
1098834044 12:75399128-75399150 CAGGATATTTTGAAAAATGAGGG + Intronic
1099281151 12:80647952-80647974 CAGGAATTGTTGAAAAATATGGG - Intronic
1099676563 12:85768081-85768103 AAGGAACAGTTGAGAAAGGAGGG + Intergenic
1100178361 12:92056747-92056769 CAGGGTCTGTTGAGGGATGAAGG - Intronic
1100869069 12:98892128-98892150 CAGCATCTGGTCAGAAATGAGGG + Intronic
1101083936 12:101215914-101215936 AAGAAAATGTTGTGAAATGATGG - Intergenic
1101867257 12:108529405-108529427 AAGGAACCTTGGAGAAATGATGG + Intronic
1102670480 12:114614781-114614803 CAGGAACTGTTTGTAAATAAAGG + Intergenic
1102855218 12:116287705-116287727 CAGTAACCGTTGTGAAATGCTGG - Intergenic
1103669785 12:122603921-122603943 CAGGAACTGGTTAGAAAATAGGG + Intronic
1105915855 13:24915205-24915227 CAGGAAATTTTAAGAAATGAGGG - Intronic
1108018339 13:46098840-46098862 CAGCATCTGTGGAGGAATGAAGG - Intronic
1108415607 13:50195497-50195519 CAGAATCTATTGACAAATGATGG + Intronic
1109384220 13:61606995-61607017 CAGGTACTTTTGAGCAATGCTGG - Intergenic
1109531996 13:63662221-63662243 CAGGGATTCTTGAGAAAAGAGGG - Intergenic
1110066370 13:71111649-71111671 CAGGGACTGCTGAAAATTGAAGG + Intergenic
1110436030 13:75479519-75479541 CAGCAGCTGTTGAGAACTAAAGG + Intronic
1111941157 13:94608457-94608479 CAGGAATTTTAGAGGAATGAAGG + Intronic
1115079713 14:29436160-29436182 CAGGACCTGATGAGAAAAAAAGG - Intergenic
1115535530 14:34369499-34369521 GGGGAAGTGTTGAGAAATGAAGG + Intronic
1116043813 14:39718290-39718312 TAAGAACTGTGGAGAAATGGAGG + Intergenic
1117331772 14:54719507-54719529 AAGGGAATGTTGAGAAATAAGGG - Intronic
1118945706 14:70385156-70385178 CTGGAGCTGCTGATAAATGATGG - Intronic
1120298721 14:82678684-82678706 CAGGAACAATGGAGAAATGATGG - Intergenic
1120555487 14:85925035-85925057 CAGGTACTGCTGAGAAATATAGG + Intergenic
1122108169 14:99475798-99475820 CAGGAAATGTGCAGGAATGAGGG - Intronic
1122289834 14:100674616-100674638 TAGGAACTGCTGAGAAGTGGTGG + Intergenic
1122412361 14:101532165-101532187 CAGAACCTTTTGGGAAATGAAGG + Intergenic
1123705914 15:22951163-22951185 CAGGAACTGACTGGAAATGAGGG + Intronic
1125786940 15:42327207-42327229 CATGGTCTGTTGAGAAGTGAAGG - Intronic
1127219758 15:56866632-56866654 CAGGAACTCTTGATAGATTATGG - Intronic
1127747305 15:61992289-61992311 CAGGATTTGTTGAGAAAAGAGGG - Intronic
1127751795 15:62052866-62052888 CAGGAAGTTTTGACAAAGGAAGG + Intronic
1128122023 15:65157329-65157351 CAAGAACAGATGATAAATGAAGG + Intronic
1128761383 15:70218269-70218291 CAGGAAGTATTGTGAGATGAAGG + Intergenic
1129600023 15:76993398-76993420 CAGGTACAGTTGGGAAAGGAAGG + Intronic
1131000498 15:88936271-88936293 CAGGCCCTGTTGAGAACTGGAGG - Intergenic
1131742253 15:95405914-95405936 CAGCAGCTGATGAGAAGTGATGG + Intergenic
1134133538 16:11665636-11665658 CGGGAACTTTTGAAAAATGCAGG + Intergenic
1135405552 16:22195133-22195155 CAACAACTGTTTATAAATGAAGG + Intergenic
1135769023 16:25202090-25202112 CAAGAAGGGTTGAGAACTGAAGG - Intergenic
1137405662 16:48187308-48187330 CAGGAACTGCTCTGAAAAGATGG + Exonic
1138153672 16:54683323-54683345 CAGGAACTGATCAGAAAAGGTGG - Intergenic
1138208394 16:55142323-55142345 CAGTAAAGGTTGTGAAATGAAGG + Intergenic
1141331927 16:83118632-83118654 CAGAAACGGTAGAAAAATGAAGG - Intronic
1141355388 16:83340652-83340674 CAGGAGCTGGTTAGAAATGCAGG - Intronic
1141598707 16:85112582-85112604 CAGGAGCTGCTGAGAGAAGAGGG + Intergenic
1141807777 16:86353385-86353407 CAGGCACTGTTGAGCAAGCAGGG - Intergenic
1141811072 16:86376466-86376488 CAGGCACTGCAGAGAGATGAGGG + Intergenic
1144095941 17:11900844-11900866 CAGGCAGAGTTGAGTAATGAAGG + Intronic
1145190006 17:20831142-20831164 CAGGAACTCCTCAGAAGTGAAGG + Intergenic
1145401206 17:22535012-22535034 CAGGAACTCCTCAGAAGTGAAGG + Intergenic
1150542345 17:66115661-66115683 CAGGAACTAGGGAGAAATAAAGG - Intronic
1150663970 17:67112831-67112853 CAGGAACTTTTTAAAAAAGACGG + Intronic
1151563335 17:74882749-74882771 CAGGCACAGTTGAGCAATGCAGG + Intronic
1151649776 17:75459508-75459530 TAGAAACTAATGAGAAATGAAGG + Intronic
1153105989 18:1527611-1527633 CAGAAACTTTTGAGAATTTAAGG + Intergenic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1154310825 18:13265133-13265155 CAAGAAATGTTGAGAATTGAAGG - Intronic
1154475739 18:14755556-14755578 CAGGGACTGTTGAGGGGTGAGGG - Intronic
1155269351 18:24124404-24124426 CAGGACCTAGTGAGAAATGCAGG + Intronic
1157747389 18:50147750-50147772 CAGGCACTGGAGAGAGATGAGGG - Intronic
1158881103 18:61780453-61780475 CAGGACCTCTTTTGAAATGAGGG - Intergenic
1159295690 18:66484774-66484796 CAGGAAGTGCTAAGAGATGATGG - Intergenic
1160014359 18:75129090-75129112 CTGGAACTGCTGAGAAAGAAAGG - Intergenic
1160454114 18:78985589-78985611 CATGAAGTGCTGACAAATGATGG + Intronic
1160630783 18:80245882-80245904 CAGGATCTTATGATAAATGAGGG + Intronic
1162937499 19:13988563-13988585 CAGGAGCTGATGGGACATGATGG + Intronic
1166253671 19:41587516-41587538 TGGGAACTGATGGGAAATGAGGG - Intronic
1166257699 19:41618338-41618360 TGGGAACTGATGAGCAATGAGGG + Intronic
1166283937 19:41811978-41812000 TGGGAACTGATGGGAAATGATGG - Intergenic
1166410345 19:42552470-42552492 TGGGAACTGATGGGAAATGAGGG + Intronic
1168571499 19:57474858-57474880 GAGGAACAGGTGAGACATGAAGG + Intronic
925099997 2:1236123-1236145 CATGAACAAATGAGAAATGATGG + Intronic
926033503 2:9614268-9614290 CTGGAAATGTTGTTAAATGATGG - Intronic
926457239 2:13081891-13081913 CTGGGACTATGGAGAAATGAAGG - Intergenic
926639012 2:15215216-15215238 CTCAAACTGTTGAAAAATGAAGG + Intronic
927099057 2:19773554-19773576 CAGGAACTCTTCAGAAAAGCAGG - Intergenic
927251859 2:21002943-21002965 CAGGAACTGTTGACTCAGGAAGG - Exonic
927496560 2:23555292-23555314 CAGTTCCTGTTGAGACATGAGGG + Intronic
928052214 2:28010921-28010943 CTGGGACTGCTGAGAAATAAAGG - Intronic
928664149 2:33533717-33533739 CAGGAACCGGTCAGAAATCAGGG - Intronic
930544451 2:52748746-52748768 CTGAAACTGTAAAGAAATGAAGG - Intergenic
931806795 2:65814965-65814987 GAAGAACTGTTGAGGAAAGAAGG - Intergenic
932592359 2:73075084-73075106 CAGGGACTGGAGGGAAATGAAGG + Exonic
932970592 2:76536271-76536293 CAGGAACTTTAGAAAATTGAAGG + Intergenic
933241490 2:79926157-79926179 CAGGAACTGCTGAGAAACTTAGG - Intronic
933997708 2:87682068-87682090 CAGGACCTGCTCTGAAATGAAGG - Intergenic
934147095 2:89105516-89105538 CAGAAACTGGTGTGAAATGAAGG - Intergenic
934222171 2:90095078-90095100 CAGAAACTGGTGTGAAATGAAGG + Intergenic
935106599 2:100050746-100050768 CAGGGACTGCTGGGAGATGAGGG - Intronic
935306139 2:101738361-101738383 CAGGATATGTTGAGAAAGAAAGG + Intronic
936296146 2:111268802-111268824 CAGGACCTGCTCTGAAATGAAGG + Intergenic
936389254 2:112056309-112056331 CAGGAACTGTAGAGAAATTCAGG - Intronic
936622514 2:114115238-114115260 CAGAAAATGTACAGAAATGATGG + Intergenic
936929779 2:117776501-117776523 CAAGAACTGCTGAGAGATAAAGG + Intergenic
938953528 2:136278574-136278596 CAGGAAATCTTGACAAATAAGGG + Intergenic
939110425 2:138000195-138000217 CAGAAACTGTGGGGAAGTGAGGG - Intronic
939350990 2:141037135-141037157 CAGGAAATATTGAAAACTGAGGG + Intronic
939377109 2:141382603-141382625 CAGGACCTGCTGTGAGATGAAGG - Intronic
940744529 2:157553007-157553029 AATGGACTGATGAGAAATGATGG - Intronic
942304622 2:174594073-174594095 CAGTACATTTTGAGAAATGAGGG - Intronic
942329097 2:174803356-174803378 CAGGAACTGTGAAGAAATTTGGG - Intronic
942418122 2:175780180-175780202 CAGCCATTTTTGAGAAATGATGG - Intergenic
942441610 2:176042688-176042710 CAGGAACAGTTGACCACTGAAGG + Intergenic
943442366 2:187941841-187941863 CAGAAACTGTTGAGTAATGTGGG - Intergenic
943608957 2:190009367-190009389 GAGGAAATGTTAAGAAATGTTGG + Intronic
943887243 2:193234933-193234955 GAGGAAATGTTGGGAAGTGATGG + Intergenic
944379316 2:199089054-199089076 TAGGAAGTGCTGAGAAATTATGG - Intergenic
944929622 2:204502927-204502949 CTGCAAATGTTGAGAAATTATGG + Intergenic
945486289 2:210400280-210400302 CAGGAATTCCTGAGAAGTGAAGG - Intergenic
945849356 2:214986723-214986745 CAGGACCTGGAGAGAAATCAAGG + Exonic
947252139 2:228119232-228119254 GAGGAAGTGATGGGAAATGAAGG + Intronic
947473450 2:230418862-230418884 CAGGAACTCTTGACATCTGAGGG + Intronic
948105333 2:235408952-235408974 AAGGAAATGTAGAGAAATGAAGG + Intergenic
1168978120 20:1983081-1983103 CAGGAATTGCTGAGACAGGATGG - Exonic
1169763409 20:9121406-9121428 CAGAAAATGGTGAGAAATTAGGG - Intronic
1170354582 20:15478262-15478284 CAGTAAGTGATGAGAATTGATGG - Intronic
1170935361 20:20804987-20805009 CAGGAAGTGTTGAGCACTTAAGG - Intergenic
1173026207 20:39309791-39309813 CAGGAACTCATTAGAAATGCAGG - Intergenic
1173236198 20:41247865-41247887 AAGGAACTGTTCAGAAAGGGTGG - Intronic
1178558745 21:33617987-33618009 CTGGAACTTTATAGAAATGATGG + Intronic
1182063267 22:27412950-27412972 CCTGAACTGTTGTGAGATGAAGG - Intergenic
1184073177 22:42159478-42159500 CAGGACCTGCACAGAAATGATGG - Intergenic
1184355016 22:43974038-43974060 CAGGAACAGTGGCGAAAGGAAGG - Intronic
1184587390 22:45457184-45457206 AAGGAAGTGTCGAGAGATGAAGG - Intergenic
1184665053 22:45983978-45984000 CAGGATCTGTTTTGGAATGAGGG - Intergenic
950670692 3:14523693-14523715 CAGGAGCTGGGGAGAAATGGAGG + Exonic
951370885 3:21846334-21846356 AAGGAACTTTTGAGTAATTAAGG - Intronic
951772488 3:26274186-26274208 TAGGAGCTGTTGAGATGTGATGG + Intergenic
951802915 3:26616609-26616631 CAATAACTGATGAGAAATGATGG - Intergenic
953090925 3:39725549-39725571 CAGGAATTTATGAGAAATGCAGG - Intergenic
953642860 3:44726048-44726070 CAGGAACTGAAGAGTAATGCTGG + Intergenic
954877381 3:53811096-53811118 CAGGACCTGTACAGAAAAGAGGG - Exonic
956899843 3:73703953-73703975 CAAAAAATGTTGAGAAATGCAGG - Intergenic
958053608 3:88381794-88381816 GAGGAACTGTTTGGAAGTGATGG + Intergenic
958560401 3:95742132-95742154 GGGGTACTGTTGAGAAAGGATGG - Intergenic
959016648 3:101142334-101142356 CAGGAAGTGAAGATAAATGAAGG + Intergenic
961184467 3:124902577-124902599 CAGGACCAGTTGGGACATGAAGG + Intergenic
961434857 3:126909904-126909926 CAGGAGCTCTCGAGAACTGACGG + Intronic
961944783 3:130674396-130674418 CAGGACAGGTTGAGAAATCAGGG - Intronic
963206439 3:142640816-142640838 AAAGAATTTTTGAGAAATGAAGG - Intronic
964094244 3:152913027-152913049 TAGAAACTGTTGAGAAACGGCGG + Intergenic
964878907 3:161401530-161401552 AAGGAAATATTGAGAAATGGAGG - Intergenic
966051585 3:175622825-175622847 CAGTAAATTTTAAGAAATGATGG + Intronic
969549717 4:7856683-7856705 CAGGAACATTTAAGAAAAGAGGG - Intronic
969607690 4:8210788-8210810 CAGGAACCATTGTGGAATGATGG + Intronic
969843518 4:9901206-9901228 CAGGACCTTAGGAGAAATGAGGG - Intronic
970061392 4:12038337-12038359 CAGGACCTGTTGGGAGGTGATGG + Intergenic
973138344 4:46734259-46734281 CAGAAACTGTGGAGACAAGAAGG + Intergenic
973680553 4:53313933-53313955 CAGAAAATATTGAGAAATTAAGG + Intronic
977048516 4:92096974-92096996 CAGGAAATTTTGAGACATAAAGG + Intergenic
978977221 4:114892897-114892919 CAGGGACTGTTGAGGGGTGAAGG - Intronic
979443150 4:120776689-120776711 CAGGAAGTGCTAAGAAAAGAAGG + Intronic
979520359 4:121659269-121659291 CAATAACTCATGAGAAATGAAGG - Intergenic
979649241 4:123110821-123110843 CAGGAACTAGTAAGTAATGAAGG + Intronic
979744934 4:124200691-124200713 CAGGAACTTTTAATAAAAGAAGG - Intergenic
981250045 4:142590092-142590114 CAGGAACTGATGAGACAAGCAGG + Intronic
982494422 4:156072811-156072833 GATAAAATGTTGAGAAATGAAGG - Intergenic
983765170 4:171471334-171471356 CAGGAACTTTTTAAAAATTAAGG - Intergenic
985019933 4:185677193-185677215 CGGGGCCTTTTGAGAAATGACGG + Intronic
985026220 4:185741944-185741966 CATGAACTGTTGGGAAATGTAGG - Intronic
985884161 5:2663543-2663565 CAGGAACTGTGTAGCAATGAGGG - Intergenic
986824489 5:11505869-11505891 CAGGAACCATAGAAAAATGACGG - Intronic
987194453 5:15511586-15511608 CAGGGACTGGTGAGAAAGAAGGG - Intronic
987213434 5:15708231-15708253 CAGACAATGTTGAGAAAGGATGG - Intronic
987684346 5:21177921-21177943 CATAACCAGTTGAGAAATGATGG - Intergenic
988280534 5:29140442-29140464 CAGGTAATGTTGTTAAATGATGG + Intergenic
989076829 5:37572741-37572763 AAAGATCTGTTGAGAACTGATGG - Intronic
992082719 5:73250545-73250567 TAGAAACTGTTGTTAAATGATGG + Intergenic
992989205 5:82266781-82266803 CAAGTACTGGTGAGAAAGGAGGG - Intronic
993127411 5:83852227-83852249 ACAGAACTTTTGAGAAATGAGGG + Intergenic
993750475 5:91659945-91659967 CAGGAACTATGGTGAAATGTGGG + Intergenic
994776936 5:104047416-104047438 CAGGAATTGTGGAAAAATGTTGG + Intergenic
995181018 5:109230315-109230337 CATGAAGAGATGAGAAATGATGG + Intergenic
996395169 5:123006380-123006402 GAGGAATTCTAGAGAAATGAAGG - Intronic
997891432 5:137680459-137680481 AAGAAACTCTTTAGAAATGAAGG + Intronic
999795848 5:154989161-154989183 CAGGAGCTGCTGATAAAGGATGG + Intergenic
999928008 5:156400319-156400341 CAAGCACTTTTGGGAAATGATGG - Intronic
1000156766 5:158559966-158559988 AAGGAAAAGTTGAGAAATTAAGG + Intergenic
1000303691 5:159977071-159977093 CAGGAAAAGTTGAGAACTGCTGG - Intergenic
1000448705 5:161357694-161357716 AAAGAAATGATGAGAAATGATGG + Intronic
1001579593 5:172789739-172789761 CAGGAACTTAAGAGAAATGAAGG + Intergenic
1002932571 6:1644573-1644595 CAGGAGATGCTGAGAAATGTTGG - Intronic
1003495124 6:6657100-6657122 GAAGAACTGTGGAGAAATGGAGG - Intergenic
1003799472 6:9647241-9647263 AAGAAATTGTTCAGAAATGAGGG - Intronic
1005364607 6:25064465-25064487 CAGGAAGAATTGAGAAATTATGG + Intergenic
1005515393 6:26549839-26549861 CAACAACTATTGAGAAAAGAAGG - Intergenic
1008081545 6:47199913-47199935 CTGGAACTGTAGACAAATCATGG + Intergenic
1008531386 6:52463777-52463799 CAGGAAGTGATGGGCAATGAGGG - Intronic
1011910700 6:92433836-92433858 TAGGTACTATTGATAAATGATGG - Intergenic
1012427325 6:99128996-99129018 CGGGAACTGGGGAGAAAAGAGGG - Intergenic
1012651597 6:101761469-101761491 CATGAGCTCTGGAGAAATGAAGG - Intronic
1013292955 6:108734376-108734398 CCAGACCTGTTGAGAAATAATGG - Intergenic
1014239843 6:119004455-119004477 CAGTAAGTATTGAGAATTGAAGG + Intronic
1015270950 6:131338486-131338508 CAGGAAGTGTTGAGCAATGGGGG + Intergenic
1016699157 6:147034300-147034322 GAGGAACAGTTGAGTTATGATGG - Intergenic
1017801297 6:157898710-157898732 CAGGAATTGTTAAAAAATAATGG - Intronic
1017812821 6:157996471-157996493 CAGGAAATGGTGGGAGATGAGGG - Intronic
1018651463 6:165994991-165995013 AAGGAAGTGTTTAGAAGTGATGG - Intergenic
1020911115 7:14132727-14132749 CAGGAACTCTTCTGAAATAAAGG - Intergenic
1021158875 7:17246983-17247005 CAGGACCTCTTCTGAAATGAGGG - Intergenic
1024378324 7:48664534-48664556 AAATATCTGTTGAGAAATGAAGG - Intergenic
1024969389 7:55054547-55054569 GAGCAACTGTTGAGAGACGAGGG - Intronic
1026082188 7:67231797-67231819 CTGGAAATGTTAAGAAGTGAAGG - Intronic
1026614633 7:71890429-71890451 CAGGAACTGTTTGGAAAGGAGGG - Intronic
1026694883 7:72582202-72582224 CTGGAAATGTTAAGAAGTGAAGG + Intronic
1026912767 7:74101107-74101129 TAGGCACTGTTGAGATGTGAAGG + Intronic
1028856579 7:95599915-95599937 CAGGAACTCTGAAGACATGATGG + Intergenic
1029127939 7:98308065-98308087 CAGGGACTGTTGAGAAACAGAGG + Intronic
1029206214 7:98870512-98870534 CAAGAACTGTTGAGAGCTTAAGG + Intronic
1030874566 7:114797166-114797188 CAGAAACTGTTTGGAAATTATGG - Intergenic
1031367103 7:120915545-120915567 AAGCAAGTTTTGAGAAATGATGG + Intergenic
1031539331 7:122974633-122974655 CAGGAGTCTTTGAGAAATGATGG + Intergenic
1032315629 7:130835963-130835985 CGGGTACTGGTGAGAGATGATGG - Intergenic
1032429041 7:131846082-131846104 TCAGAACTGTTGAGAAATGAGGG - Intergenic
1033608608 7:142944896-142944918 AAGGATCTGTGGAGAAAGGAAGG + Intronic
1033714182 7:143982391-143982413 CAGAAAATATTGAGAAATCATGG + Intergenic
1034066616 7:148143183-148143205 CAGGAACTTTTGGGAAACTATGG + Intronic
1034922889 7:155098505-155098527 CAGGATCTGGTAACAAATGATGG + Intergenic
1035831366 8:2697913-2697935 CAGGAAAAGTTGTGTAATGAGGG - Intergenic
1037974747 8:23201246-23201268 CAGGACTTATTGAGAAATCAGGG + Intronic
1038794883 8:30701152-30701174 TAATAACTGATGAGAAATGAGGG - Intronic
1039261795 8:35779887-35779909 CAGGTACTGTTAAGATCTGAGGG - Intronic
1039855385 8:41407689-41407711 CAGAGACTGTGGAGAATTGATGG - Intergenic
1040513474 8:48115969-48115991 TAGAAACTGTTGATAAATGTTGG + Intergenic
1041623220 8:59997856-59997878 CAGGATCTGATGATCAATGAGGG + Intergenic
1042333052 8:67602602-67602624 CAGGACTTGATGAGATATGAGGG - Intronic
1044608902 8:94072806-94072828 CAGGAACTGTAGTGAAAAGGAGG + Intergenic
1045320247 8:101077054-101077076 CAGGCCCTGCTGAGACATGAGGG - Intergenic
1047014803 8:120712481-120712503 CAGGAATTGTTGAAAAATTTAGG - Intronic
1047756940 8:127926239-127926261 CAGGAAATGTTAAAAAATGGGGG + Intergenic
1048058757 8:130895446-130895468 CAGGAACTTCAGAGAAAGGAAGG + Intronic
1050002892 9:1097435-1097457 CAGGAGCTGGTTAGAAATGTAGG - Intergenic
1050080394 9:1909694-1909716 GATGAACTGTTCAGAAAGGAAGG + Intergenic
1050193972 9:3060926-3060948 CAGGAATTTTTCAGAAATCAAGG + Intergenic
1050541366 9:6673350-6673372 GAGGAAATGTGGAAAAATGAAGG - Intergenic
1051760478 9:20458042-20458064 CAGGCACTGGTGGGAAATGCTGG - Intronic
1052200818 9:25777533-25777555 GAGGAACTGATGATTAATGAGGG + Intergenic
1055628609 9:78200235-78200257 CAGTAAATGTTTGGAAATGAGGG + Intergenic
1055879495 9:80982977-80982999 GAGGAACTTTTGATAAATGTTGG - Intergenic
1057133769 9:92672191-92672213 CAGGGATGGTTGAGAAATGGGGG + Intergenic
1057776158 9:98011673-98011695 CTGGACATGTTGAGAATTGATGG + Intronic
1058776100 9:108285451-108285473 CAGAAAGTGTTTATAAATGATGG - Intergenic
1060052855 9:120389656-120389678 AAGGACCTCTTGAAAAATGAAGG - Intronic
1060370038 9:123060084-123060106 AGAGAACTGTTGAGAAATGTTGG + Intronic
1062584767 9:137244283-137244305 CAGGAACTGGGGAGACAGGAAGG + Exonic
1185988196 X:4860291-4860313 CAGGACCTGTTGGGGGATGAGGG + Intergenic
1186255413 X:7713136-7713158 CAGGAAAGGCTGAGAAATCAGGG - Intergenic
1186562793 X:10630732-10630754 CAGGAGATGTTAAGAGATGATGG + Intronic
1188870844 X:35369284-35369306 GAGGAACTCAGGAGAAATGAGGG - Intergenic
1189057284 X:37711406-37711428 CAGGTACTGATGAGAAGTGTGGG + Intronic
1189324259 X:40103458-40103480 CAGCAGCTTTTGAGAGATGAAGG + Intronic
1191767561 X:64714881-64714903 AAGCTACTGTTAAGAAATGAAGG + Intergenic
1193104797 X:77658345-77658367 AAGGAACAGTTGAGAAAATAAGG + Intronic
1195399412 X:104445878-104445900 TATGAACTATTGAGAAATCAGGG + Intergenic
1195634828 X:107102338-107102360 AAGGAACTGTTAAGAAAAAAGGG + Intronic
1197605974 X:128585831-128585853 CAATAACTGTTGAGAAACAAAGG - Intergenic
1197916712 X:131543548-131543570 CTGGAACTATGGAAAAATGAAGG + Intergenic
1198066001 X:133097311-133097333 CAGGAACTGTGGGGAATGGAAGG + Intergenic
1198561809 X:137858414-137858436 CAAGAAGTATTGACAAATGATGG + Intergenic
1201750609 Y:17427849-17427871 CAGGGACTGTTGTGGAATGAGGG - Intergenic
1202073578 Y:21016774-21016796 CAGGTACTCTTGAGGGATGAGGG - Intergenic
1202078278 Y:21058628-21058650 CAGGTACTCTTGAGGGATGAGGG - Intergenic