ID: 916252749

View in Genome Browser
Species Human (GRCh38)
Location 1:162754632-162754654
Sequence CAGAAGAAGGGGATGGAGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1409
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 1345}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916252736_916252749 13 Left 916252736 1:162754596-162754618 CCTCTCTCCCCAACCCTCACCTC 0: 1
1: 1
2: 14
3: 257
4: 2252
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252742_916252749 0 Left 916252742 1:162754609-162754631 CCCTCACCTCTCAAGGCTGGACT 0: 1
1: 0
2: 1
3: 16
4: 196
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252735_916252749 14 Left 916252735 1:162754595-162754617 CCCTCTCTCCCCAACCCTCACCT 0: 1
1: 0
2: 16
3: 203
4: 2167
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252744_916252749 -6 Left 916252744 1:162754615-162754637 CCTCTCAAGGCTGGACTCAGAAG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252739_916252749 5 Left 916252739 1:162754604-162754626 CCCAACCCTCACCTCTCAAGGCT 0: 1
1: 0
2: 0
3: 17
4: 268
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252740_916252749 4 Left 916252740 1:162754605-162754627 CCAACCCTCACCTCTCAAGGCTG 0: 1
1: 0
2: 6
3: 38
4: 365
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252738_916252749 6 Left 916252738 1:162754603-162754625 CCCCAACCCTCACCTCTCAAGGC 0: 1
1: 0
2: 1
3: 45
4: 373
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345
916252743_916252749 -1 Left 916252743 1:162754610-162754632 CCTCACCTCTCAAGGCTGGACTC 0: 1
1: 0
2: 1
3: 22
4: 274
Right 916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG 0: 1
1: 0
2: 2
3: 61
4: 1345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916252749 Original CRISPR CAGAAGAAGGGGATGGAGCC TGG Exonic
900235130 1:1585395-1585417 CAGAAGAATGGCATGAACCCGGG - Intergenic
900315086 1:2052365-2052387 AAGAGGAAGGGGTGGGAGCCTGG - Intronic
900352762 1:2244056-2244078 CAGGAGAATGGGATGAACCCGGG - Intronic
900542797 1:3212502-3212524 CAGAACATGGGGACGGAGGCAGG - Intronic
900601378 1:3504145-3504167 CAGAGGAGGGGGCTGGCGCCGGG + Intronic
900968379 1:5975466-5975488 CTGAAGAAGGGAATGCAGCAAGG - Intronic
901042844 1:6375843-6375865 CAGAAGAATGGCATGAACCCGGG + Intronic
901204298 1:7485065-7485087 CAACAGAAGGGGCTGGATCCAGG - Intronic
901300826 1:8199064-8199086 CAGGAGAATGGCATGAAGCCAGG - Intergenic
901369024 1:8780349-8780371 GAGAAAAAGGGGATGCAACCTGG + Intronic
901669074 1:10843818-10843840 CAGAAGAAGAGGATGGAGATGGG - Intergenic
901804958 1:11732760-11732782 GAGAAGGAGGGGCTGGAGACAGG - Intergenic
902245991 1:15120744-15120766 CAGCTGGAGGGGATGGGGCCCGG - Intergenic
902584927 1:17432863-17432885 CAGGAGAAGGGCATGAACCCGGG + Intronic
902609489 1:17588705-17588727 CAGAGGTAGGGTTTGGAGCCAGG - Intronic
902614680 1:17617394-17617416 CAGAGGAATGGACTGGAGCCTGG - Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902674942 1:18002222-18002244 CAGGAGAAGGGCTTGGAGCCTGG + Intergenic
902689715 1:18103019-18103041 CAGAGAAAAGGGATGGACCCAGG - Intergenic
902712792 1:18252141-18252163 CAGGAGAATGGCATGGACCCAGG - Intronic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
903197204 1:21699604-21699626 CAGAAGAATGGCATGAACCCAGG - Intronic
903289446 1:22298716-22298738 AAGAAGAAGGCAGTGGAGCCAGG + Intergenic
903680462 1:25093040-25093062 CAGAAGCAGATGAGGGAGCCTGG + Intergenic
903857483 1:26345494-26345516 CAGAACAAGGGGAGTGAGCCGGG + Exonic
903877384 1:26484679-26484701 CAGAAGAATGGCATGAACCCAGG + Intergenic
904413215 1:30337523-30337545 CGCAAGTAGGGGAGGGAGCCAGG + Intergenic
904691229 1:32294605-32294627 CAGGAGAATGGCATGGACCCGGG - Intronic
904836124 1:33338098-33338120 CAGGAGTGGGGGATGGAGGCAGG - Intronic
904873214 1:33634818-33634840 GAGAGGAATGGGATGGAGCTGGG - Intronic
905028817 1:34868172-34868194 CAGAAGAGGGAGATTCAGCCAGG - Intronic
905430904 1:37922601-37922623 CAGAAGAATGGCATGAACCCAGG + Intronic
905566806 1:38972001-38972023 CAGAAGAATGGCATGAACCCGGG + Intergenic
905568083 1:38981896-38981918 CAGAAGAATGGCATGAACCCGGG - Intergenic
905578723 1:39067121-39067143 CAGGAGAATGGCATGGACCCCGG - Intergenic
905850655 1:41272158-41272180 CAGAAGCAGGGGAAGCAGCCAGG - Intergenic
906377817 1:45310217-45310239 CAGAAGAATGGCATGAACCCAGG + Intergenic
906550454 1:46661985-46662007 CAGGAGAATGGCGTGGAGCCAGG - Intronic
906643402 1:47455626-47455648 CAGAAGAATGGCATGAACCCAGG - Intergenic
906848762 1:49224522-49224544 CAGAAGAATGGCGTGGACCCAGG + Intronic
907142299 1:52199156-52199178 CAGAAGAATGGCATGAACCCGGG - Intronic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907773385 1:57488307-57488329 CAGAAGAATGGCATGAACCCGGG + Intronic
907861565 1:58358596-58358618 CAGAAGGTGGGGATGCAGCCTGG + Intronic
908806480 1:67937920-67937942 CAGAAGGACAGGAAGGAGCCAGG - Intergenic
909512857 1:76474596-76474618 CAGAAGCAAAGGATGGAGTCAGG + Intronic
909718070 1:78734631-78734653 CAGAAGAATGGCATGAACCCAGG - Intergenic
910028095 1:82682668-82682690 CAGGAGAATGGCATGAAGCCAGG - Intergenic
910106475 1:83636448-83636470 CAGAGCAAGGGGATGGAGCAAGG + Intergenic
910226506 1:84941402-84941424 CAGAAGAATGGCATGAAGCCGGG + Intronic
910383810 1:86659731-86659753 CAAAAGAAAGGGATGGAGGAAGG + Intergenic
910489429 1:87752511-87752533 CAGAAGTCGGGGTTGGAGTCTGG - Intergenic
910565379 1:88637599-88637621 CAGGAGAATGGCATGGACCCGGG - Intergenic
910644499 1:89498779-89498801 CAGAAGTGGGGCCTGGAGCCAGG - Intergenic
911605286 1:99898137-99898159 CAGAAGAATGGCATGAACCCGGG - Intronic
911629820 1:100170692-100170714 AAGAAGAAAGGGATGGAGGGAGG - Intronic
911639794 1:100275926-100275948 CAGAAGAATGGCATGAACCCAGG - Intronic
912056998 1:105614532-105614554 CAGAAGAATGGTATGAACCCGGG - Intergenic
912283426 1:108342136-108342158 TAGAAGAAAGGGATGAATCCTGG + Intergenic
912581517 1:110724992-110725014 CAGAAGAATGGCATGAACCCGGG + Intergenic
912727415 1:112070398-112070420 CAGAAGGCCGGGATTGAGCCAGG - Intergenic
913252081 1:116920039-116920061 CAGAAGATGGGCAGGAAGCCAGG - Intronic
913940078 1:125094628-125094650 CAGAAAAATGGCATGAAGCCGGG - Intergenic
914449815 1:147781137-147781159 CAAATGAAGGCGCTGGAGCCAGG - Intergenic
914821014 1:151103140-151103162 CAGAAGAATGGCATGAACCCGGG - Intronic
915122449 1:153638971-153638993 CAGGAGAATGGTATGGACCCGGG - Intronic
915133104 1:153710085-153710107 CAGAAGAATGGCATGAACCCGGG - Intergenic
915138050 1:153747741-153747763 CAGATAATGGGGGTGGAGCCAGG - Intronic
915548640 1:156618684-156618706 CAGAAGAATGGCATGAACCCGGG + Intergenic
915557779 1:156669890-156669912 CAGGAGGAGGGGAGGGAGCCAGG - Exonic
915596681 1:156900313-156900335 CAGGAGAAGGGGATGGGGGTGGG - Intronic
915725123 1:158011770-158011792 CAGCAGTGGGGGAAGGAGCCTGG + Intronic
916252749 1:162754632-162754654 CAGAAGAAGGGGATGGAGCCTGG + Exonic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916418100 1:164611328-164611350 CAGAAGAATGGCATGAACCCGGG - Intronic
916533179 1:165677763-165677785 CAGAAGAATGGCATGAACCCAGG + Intronic
916548826 1:165830415-165830437 CAGAAGAATGGCATGAACCCGGG - Intronic
916603574 1:166318384-166318406 CAGAAGAATGGTATGAACCCGGG - Intergenic
916604661 1:166328821-166328843 AAGAAGAAGGGGAGGGATGCTGG - Intergenic
916646583 1:166792599-166792621 CAGGAAAATGGGATGGAGCCAGG + Intergenic
916775661 1:167961333-167961355 CAGAAGAATGGCATGAACCCGGG - Intronic
916790738 1:168122798-168122820 GTAAAGAAGGGGATGGGGCCAGG - Intronic
917961445 1:180148838-180148860 CAGGAGAATGGCATGGACCCAGG - Intergenic
917980417 1:180265756-180265778 CATAGGAAGGGGATGGAGGTAGG + Intronic
918121517 1:181545184-181545206 CAGAAGGAGGGGATGAAAACAGG + Intronic
918148934 1:181781591-181781613 CAGAACATGGGGAGGAAGCCAGG + Intronic
918854663 1:189735883-189735905 CAGAAGAATGGCATGAACCCAGG - Intergenic
918874365 1:190020565-190020587 CAGAAGAATGGCATGAACCCGGG - Intergenic
918907964 1:190524379-190524401 CAGAAGAATGGGGTGAACCCAGG - Intergenic
919104563 1:193132992-193133014 CAGAAGAATGGCATGCACCCGGG - Intronic
919144605 1:193617701-193617723 CAGGAGAATGGCATGAAGCCGGG + Intergenic
919235683 1:194839126-194839148 CAGAAGAATGGCATGAACCCAGG - Intergenic
919698859 1:200610415-200610437 CAGAAGAATGGCATGAACCCGGG + Intronic
919745773 1:201008388-201008410 CAGAAGGAAGGGAGAGAGCCAGG + Intronic
920144284 1:203844827-203844849 CAGAAAAAGGGGAGGGAGGAGGG - Intronic
920222064 1:204411401-204411423 AAGAAAAAGGAGATGGAGCCGGG - Exonic
920237787 1:204520182-204520204 CAGAAGAATGGCATGAACCCCGG + Intronic
920277841 1:204821049-204821071 CAGGAGTAGGGCATGGAGCCAGG - Intergenic
920308130 1:205031925-205031947 CAGAAGAATGGCATGAACCCGGG - Intergenic
920596841 1:207280240-207280262 CTGAAGAAGGGGATGAAGGAGGG + Intergenic
920887942 1:209951279-209951301 GAGAAGAAGGGAATGGAGAGGGG - Intronic
921046049 1:211478857-211478879 CAGAGGAAGAGGATGGGGCAGGG + Exonic
921141530 1:212311374-212311396 CAGAAGAATGGCATGAACCCGGG + Intronic
921298561 1:213727654-213727676 CAAAAGAAGGGGAGGGGACCAGG + Intergenic
921416107 1:214889176-214889198 CAGAAGAATGGCATGAACCCGGG - Intergenic
921418724 1:214921457-214921479 CAGAAGAATGGCATGAACCCAGG - Intergenic
921596258 1:217056555-217056577 CAGGAGAAAGGAATGTAGCCTGG - Intronic
921709406 1:218358639-218358661 CAGAAGAATGGCATGAACCCCGG - Intronic
921809617 1:219497739-219497761 AAGAAGAAGGGGATGGAAAAAGG - Intergenic
921979192 1:221236575-221236597 CAGGAGAATGGCATGAAGCCGGG - Intergenic
922101650 1:222482134-222482156 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922160650 1:223077416-223077438 CACAAGAAGGGGAGGGGGCGTGG - Intergenic
922262730 1:223957250-223957272 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
922319692 1:224475261-224475283 CAGGAGAAGGGCATGAACCCAGG + Intronic
922452893 1:225750981-225751003 CAGGCGAACAGGATGGAGCCTGG + Intergenic
922457134 1:225784337-225784359 CAGAAGAATGGCATGAACCCGGG - Intronic
922466926 1:225850802-225850824 CAGAAGAATGGCATGAACCCAGG - Intronic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
922949798 1:229549124-229549146 GAGAGGAAGAGAATGGAGCCTGG + Intronic
923085964 1:230703837-230703859 CTGAAGAAGGGGCTGGGCCCAGG + Intronic
923115278 1:230930823-230930845 CAGGAGAATGGGATGAACCCAGG + Intronic
923118882 1:230971251-230971273 CAGGAGAATGGCATGGACCCAGG + Intronic
923245841 1:232131193-232131215 CAAAAAAAGGGGATGCAGGCAGG - Intergenic
923291299 1:232548797-232548819 CAGAAGGATGGCATGGATCCAGG + Intronic
923594086 1:235346702-235346724 CAGAAGAATGGCATGAACCCGGG + Intergenic
923710509 1:236385314-236385336 CAGGAGAATGGCATGAAGCCGGG + Intronic
923737297 1:236622676-236622698 AACAAGCAGGGGATGGAGGCTGG + Intergenic
924115560 1:240742712-240742734 CAGGAGAATGGGATGAACCCAGG - Intergenic
924344568 1:243062251-243062273 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
924362497 1:243255777-243255799 CTGAAGAGTGGGATGGAGGCGGG + Intergenic
924467768 1:244313723-244313745 CATAAGGAGGGAAGGGAGCCTGG - Intergenic
924583602 1:245342719-245342741 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
924727753 1:246686085-246686107 CAGAAGAATGGCATGAATCCGGG - Intergenic
924760148 1:246976699-246976721 CAGAAGAATGGCATGAACCCGGG + Intronic
1062815517 10:497029-497051 CAGAAGAATGGCATGAACCCAGG + Intronic
1063004215 10:1952830-1952852 GGAAAGAAGGGGCTGGAGCCCGG + Intergenic
1063426073 10:5951047-5951069 CAGGAGAATGGCATGGACCCAGG + Intronic
1063494172 10:6491418-6491440 CGGCAGAAGGTGATGGAGCTAGG + Intronic
1064050071 10:12052373-12052395 CAGAAGAATGGCATGAACCCGGG + Intergenic
1064117674 10:12592913-12592935 AAGATGAAGAGGAGGGAGCCAGG - Intronic
1064119622 10:12607223-12607245 AAGAAGAAAGGGAGGGAGGCCGG - Intronic
1064149703 10:12852385-12852407 CAGAAGAATGGCATGAACCCAGG + Intergenic
1064509499 10:16074285-16074307 CAGAAGAGAGGGATGGATACTGG + Intergenic
1064613116 10:17124519-17124541 CAGGAGAATGGCATGGACCCAGG - Intronic
1064661950 10:17616174-17616196 CAGAAGAAAGGCATGAACCCGGG + Intronic
1064678959 10:17789929-17789951 CAGAAGAAAGGCATGAACCCGGG + Intronic
1064724038 10:18259336-18259358 CAGGAGAATGGCCTGGAGCCAGG + Intronic
1064828222 10:19430205-19430227 CAGAAGAATGGCATGAACCCAGG - Intronic
1064918305 10:20486954-20486976 CAGGAGCTGGGGAGGGAGCCTGG + Intergenic
1065435287 10:25699168-25699190 CAGAAGTAGGAGATGAAGTCAGG + Intergenic
1065609834 10:27462049-27462071 CAGGAGAATGGCATGAAGCCGGG + Intergenic
1065710931 10:28517139-28517161 CAGAAGAATGGCATGAACCCAGG - Intergenic
1066200546 10:33139636-33139658 CAGAAGAGGTGGATGGAGAACGG - Intergenic
1066366254 10:34779526-34779548 CAGAAGAATGGCATGAACCCGGG + Intronic
1066564567 10:36707555-36707577 CAGGAGAATGGGGTGAAGCCGGG + Intergenic
1066653436 10:37680141-37680163 AAGATGAAGGGCTTGGAGCCAGG - Intergenic
1066731763 10:38442821-38442843 GAGAATTAGGGGAGGGAGCCAGG + Intergenic
1066757943 10:38729721-38729743 CAGAAGAATGGCATGAACCCGGG + Intergenic
1067037802 10:42932680-42932702 AAGATGAAGGGCTTGGAGCCAGG - Intergenic
1067127112 10:43528056-43528078 CAGAAGAATGGCATGAACCCGGG - Intergenic
1067343528 10:45422277-45422299 CAGAATGAGAGGATGGAGGCTGG - Intronic
1067376746 10:45734130-45734152 CAGGAGAAGGGCATGAACCCGGG + Intronic
1067405788 10:46022551-46022573 CAGGAGAATGGTATGAAGCCGGG - Intronic
1067499884 10:46793830-46793852 CAGAAGAATGGCATGAATCCGGG + Intergenic
1067541936 10:47161122-47161144 AAGAAGAAGAGGAGGGGGCCGGG - Intergenic
1067594747 10:47546493-47546515 CAGAAGAATGGCATGAATCCGGG - Intronic
1067641856 10:48054604-48054626 CAGAAGAATGGCATGAATCCGGG - Intergenic
1067843445 10:49700202-49700224 CAGAACATGGGAATGGGGCCTGG - Intronic
1067850244 10:49749949-49749971 CAGCAGGAGAGGATGGTGCCTGG - Intronic
1068389045 10:56369230-56369252 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1068489535 10:57705724-57705746 CAGAAGAATGGCATGAACCCAGG + Intergenic
1068533417 10:58213592-58213614 CAGGAGAATGGCATGAAGCCAGG + Intronic
1069214667 10:65804386-65804408 CAGGAGAAGGGCATGAACCCGGG + Intergenic
1069748005 10:70728001-70728023 CAGAAGAATGGCATGAACCCAGG + Intronic
1070066645 10:73041446-73041468 CAGAAGAATGGCATGAACCCAGG + Intronic
1070076104 10:73137681-73137703 CAGAAGAATGGCATGAACCCAGG + Intronic
1070125907 10:73621505-73621527 CAGAAGAATGGCATGAACCCAGG + Intronic
1071294901 10:84212366-84212388 CAGAAGAAGACGATGGTGCTAGG + Exonic
1071771711 10:88736117-88736139 AGGAAGAGAGGGATGGAGCCAGG + Intronic
1071982146 10:91014228-91014250 AAGAAGAAAGGGCAGGAGCCTGG + Intergenic
1072523809 10:96253926-96253948 CAGGAGAATGGCATGGACCCAGG + Intronic
1072585436 10:96777587-96777609 CAGGAGAATGGCATGGACCCGGG + Intergenic
1072806987 10:98429930-98429952 CAGAAGGGGTGGAGGGAGCCAGG - Intronic
1072960464 10:99924348-99924370 CAGGAGAATGGCATGGACCCAGG + Intronic
1073066653 10:100764234-100764256 CAGAAGAATGGCATGAACCCGGG - Intronic
1073161856 10:101404903-101404925 CAGGAGAATGGGATGAACCCAGG + Intronic
1073376669 10:103041168-103041190 CGGAAGACGGGGCTGGAGACAGG - Intronic
1073413112 10:103358906-103358928 CAGAAGAATTGCTTGGAGCCAGG + Intergenic
1073778831 10:106815050-106815072 CAGGAGAAGGGCGTGAAGCCAGG - Intronic
1074222687 10:111453789-111453811 CAGTAAAAGGGGATGAAGACTGG - Intergenic
1074517375 10:114182775-114182797 CAGAAGAATGGCATGAACCCAGG - Intronic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1074712669 10:116190441-116190463 CAGGAGAAGGAAAGGGAGCCTGG + Intronic
1074716247 10:116222104-116222126 CGGTAGAAGGGGAAAGAGCCAGG + Intronic
1075344913 10:121674874-121674896 AAGAAGAACGGGAAGGAGACTGG - Intergenic
1076629319 10:131842855-131842877 CAGAGGGAGGGGGTGCAGCCAGG - Intergenic
1076767999 10:132647206-132647228 CAGAAGAATGGCATGAATCCAGG - Intronic
1076800144 10:132817964-132817986 GAGAAGCAGGAGAAGGAGCCTGG - Intronic
1077125844 11:935992-936014 CAGAAGAATGGCATGAACCCAGG - Intronic
1077147424 11:1052388-1052410 CACAAGAAGCTGGTGGAGCCAGG - Intergenic
1077353758 11:2105198-2105220 CAGAGGCAGGGGGTGGAGACTGG + Intergenic
1077552315 11:3206149-3206171 AGGAGGCAGGGGATGGAGCCAGG - Intergenic
1077868412 11:6241364-6241386 CTGAAGGAAGGGATGGAGGCAGG + Intronic
1078044455 11:7900420-7900442 CAGGAGAATGGCATGGACCCAGG + Intergenic
1078146364 11:8724201-8724223 CAGAAGAATGGCATGAACCCGGG + Intronic
1078340473 11:10495111-10495133 CAGAGGGAGGGGAAGGGGCCAGG - Intronic
1078667975 11:13341723-13341745 CAGAATAAGAGGAGAGAGCCTGG - Intronic
1078747745 11:14131529-14131551 CAAAAGAAGGTGGTGGAGCAAGG - Intronic
1079094008 11:17499608-17499630 CAGAAGAAGAAGGTGGGGCCTGG + Intronic
1079491085 11:20989902-20989924 CAGAAGAATGGCATGAACCCGGG + Intronic
1080132631 11:28814673-28814695 CAGGAGAATGGGGTGAAGCCAGG + Intergenic
1081094475 11:38916224-38916246 CAGAAGAAGGGCATGAACCTAGG - Intergenic
1081363277 11:42205517-42205539 CTGAAAAAGGGGCTGAAGCCAGG + Intergenic
1081386026 11:42474377-42474399 CAGGAGAATGGCATGGACCCTGG + Intergenic
1081673248 11:44953510-44953532 CAGGAGAATGGCATGGACCCAGG - Intergenic
1081846596 11:46245169-46245191 CAGAAGAATGGCATGAACCCGGG - Intergenic
1081983217 11:47283184-47283206 CAGGAGAATGGCATGAAGCCGGG - Intronic
1082247504 11:49941875-49941897 CAGAAGAATGGCATGAACCCGGG + Intergenic
1082783218 11:57302567-57302589 CAGAAGACGTGGATGGCACCTGG - Exonic
1083687998 11:64388836-64388858 CAGAAGCAGGGGATGCAGAGAGG + Intergenic
1083804228 11:65064323-65064345 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1083903421 11:65654848-65654870 CAGGGGCAGGGGCTGGAGCCTGG + Exonic
1084063502 11:66690388-66690410 AAGAAGCAGGGGGAGGAGCCAGG + Intronic
1084143573 11:67250639-67250661 CAGAGGAGGGGGGTGCAGCCAGG + Exonic
1084498787 11:69522237-69522259 CAGAAGAATGGCATGAACCCAGG - Intergenic
1084506157 11:69569797-69569819 AAGAAGAAGGGGACAGAGACAGG - Intergenic
1084550537 11:69839100-69839122 CAGGAGAAGGGCATGAACCCGGG + Intergenic
1085293151 11:75414516-75414538 CAGGAGAATGGCATGAAGCCAGG + Intronic
1085559173 11:77454481-77454503 GAGAAGAAGGGAATGGATGCTGG - Intronic
1085597555 11:77823120-77823142 CAGGAGAATGGCATGGACCCGGG + Intronic
1086721134 11:90123070-90123092 CAGAAGAATGGCATGAACCCAGG - Intergenic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087360774 11:97156745-97156767 CAGAAGAATGGCATGAACCCGGG + Intergenic
1087446023 11:98254249-98254271 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1087864462 11:103207012-103207034 CAGAAGAATCGCATGAAGCCAGG - Intronic
1087875038 11:103344928-103344950 CAGCAGAACGGGAGGGAGACTGG - Intronic
1088061173 11:105653002-105653024 CAGGAGAAGGGCATGAACCCAGG - Intronic
1088524186 11:110734926-110734948 AAGACGTAGGGTATGGAGCCAGG - Intergenic
1088841601 11:113632040-113632062 TGGAAGAAGAGGTTGGAGCCAGG + Intergenic
1089028605 11:115298376-115298398 AAGAAGAAAGGGAAGGAGGCAGG + Intronic
1089151987 11:116371491-116371513 CAGAGGCAGGGGATGGGGGCAGG + Intergenic
1089567326 11:119378620-119378642 GAGAAGAAGTGGATGGGCCCAGG + Intronic
1090083942 11:123634259-123634281 CACAAGATGGGGAAGGAGCAGGG + Intronic
1090809254 11:130222223-130222245 CAGAAGAAGGGGATGGGAGTAGG - Intergenic
1091168047 11:133497980-133498002 CAAAAGCAGAGGATGGAGCCTGG - Intronic
1091482202 12:844684-844706 CAGAAGATGGGAATGGAGATTGG - Intronic
1091501439 12:1021604-1021626 CAGAAGAATGGCATGAACCCGGG + Intronic
1091860406 12:3776448-3776470 GAGGAGAAGTGGATGGAGTCAGG + Intergenic
1092126676 12:6079515-6079537 CAGGAGAATGGCATGAAGCCGGG + Intronic
1092201436 12:6586306-6586328 CAGAAGAATGGCATGAACCCGGG + Intronic
1092494053 12:8974258-8974280 CAGAAGAATGGCATGAACCCGGG - Intronic
1092547156 12:9462037-9462059 CAGGAGAATGGGATGAACCCAGG + Intergenic
1092650077 12:10625308-10625330 CAGAAGAATGGCATGAACCCAGG - Intronic
1092745626 12:11669641-11669663 AAGAAGATGGGGAGGGACCCGGG - Intronic
1092764713 12:11842100-11842122 AAGAAGAAGGAGATGTAGGCTGG + Intronic
1093456263 12:19367670-19367692 CAGAAGAATGGCATGAACCCAGG - Intronic
1093550845 12:20408978-20409000 CAGAAGAAAGGGAGGGAGAGAGG - Intronic
1093950925 12:25164411-25164433 GAGAAGAAGGGAATGGAGGGCGG - Intronic
1094240633 12:28219562-28219584 CAGAAGAATGGCATGAACCCAGG - Intronic
1094381244 12:29845646-29845668 CAGGAGAATGGCATGGAACCTGG - Intergenic
1094550845 12:31449821-31449843 CAGAAGAATGGCATGAACCCGGG - Intronic
1095044054 12:37479712-37479734 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1095128557 12:38510284-38510306 CAAAATAAAGGGATGGGGCCAGG + Intergenic
1095188528 12:39229501-39229523 CAGGAGAATGGCATGGACCCAGG + Intergenic
1095649916 12:44595517-44595539 CAGGAGAATGGCATGAAGCCGGG - Intronic
1095755860 12:45766604-45766626 CAGGAGAAGGGCATGAACCCAGG - Intronic
1095794037 12:46197412-46197434 CAGAAGAATGGCATGAACCCGGG + Intronic
1095876925 12:47089352-47089374 CAGAAGAATGGCATGAACCCGGG + Intronic
1096243902 12:49973914-49973936 CAGAGGACGTGGGTGGAGCCTGG - Intronic
1096675475 12:53223467-53223489 CAGGAGAGGGGGGTGCAGCCTGG + Intronic
1096731325 12:53615289-53615311 CAGAAGAATGGCATGAACCCGGG + Intronic
1097171941 12:57120190-57120212 CAGAAGAATGGCATGAACCCAGG - Intronic
1097219258 12:57437576-57437598 CAGGAGAATGGCATGGACCCAGG + Intronic
1097279276 12:57834541-57834563 AGGAAGGAGGGGTTGGAGCCAGG + Intronic
1097609377 12:61799727-61799749 CAGAAGAATGGCATGAACCCGGG + Intronic
1097738633 12:63212130-63212152 AAGGAGAAGGGGATGGAAGCAGG - Intergenic
1098489503 12:71059005-71059027 CAGGAGAAGGGCATGAACCCAGG + Intronic
1098820918 12:75227959-75227981 CAGAAGAATGGCATGAACCCAGG - Intergenic
1098850272 12:75587966-75587988 CAGAAGAAGGCCATGGGGCATGG - Intergenic
1100357695 12:93847008-93847030 CAGAAGAATGGCATGAACCCAGG + Intronic
1100371231 12:93970734-93970756 CAGAAGAATGGCATGAACCCGGG + Intergenic
1100445400 12:94655587-94655609 CAGAATAAGGGGTGGGATCCTGG - Intergenic
1100565575 12:95790741-95790763 GAGAAGGACGGGACGGAGCCGGG - Exonic
1100587867 12:95996113-95996135 CAGGAGCAGGGGATGCAGACGGG + Exonic
1100670571 12:96807792-96807814 CCAAAGAAGGGTAAGGAGCCAGG + Intronic
1101279110 12:103232616-103232638 CAGGAGAATGGCATGAAGCCGGG + Intergenic
1101580676 12:106038727-106038749 CAGAAGAGGGGCATGGATGCTGG - Intergenic
1101931173 12:109015452-109015474 CAGCAGAAGGGGTGGGAGTCTGG + Intronic
1101965626 12:109280045-109280067 TAGAAAAAGGGCATGGGGCCGGG + Intronic
1102329009 12:112013500-112013522 CAGGAGAAGGGGAAGCAGCGGGG - Exonic
1102594377 12:113981334-113981356 CACACGAAGGAGATGGAGCCAGG + Intergenic
1102600937 12:114029889-114029911 CAGATGAAGAGGATGGTTCCAGG - Intergenic
1102720570 12:115012854-115012876 GTGAAGAAGAGGAAGGAGCCAGG - Intergenic
1102821280 12:115911039-115911061 CAGAAGAATGGCATGAACCCGGG + Intergenic
1102865938 12:116374009-116374031 CAGGAGAAGCGGACTGAGCCAGG + Intergenic
1103111482 12:118283362-118283384 AAGAAGCAGGGGATGGAGATGGG + Intronic
1103423410 12:120809250-120809272 CAGAAGAATGGCGTGGACCCAGG + Intronic
1103555920 12:121766433-121766455 CAGAACAGGGAGCTGGAGCCGGG - Intronic
1103659980 12:122506447-122506469 TAGAAAATGGGGATGGAGGCTGG + Intronic
1103747998 12:123139406-123139428 CAGAAGAATGGCATGAACCCGGG + Intronic
1103845757 12:123901080-123901102 CAGAAGCATGGGCTGGAGGCTGG - Intronic
1104022139 12:124999708-124999730 CAGAAGAATGGCATGAACCCAGG - Intronic
1104110612 12:125700763-125700785 CAGAAGAGGAGGAGGGAGTCGGG + Intergenic
1104328051 12:127818697-127818719 CAGAAGAATGGCATGAACCCGGG + Intergenic
1104343912 12:127978467-127978489 CAGAAGAATGGCATGAACCCGGG + Intergenic
1104508808 12:129357152-129357174 CAGGAGAATGGCATGGACCCAGG + Intronic
1104510663 12:129374802-129374824 CAGAGAAAGAGGATGGAGGCTGG + Intronic
1104658008 12:130588202-130588224 CATGAGAAGGGGCTGGAGGCTGG - Intronic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105592849 13:21810653-21810675 CAGAAGAAGGAGAGACAGCCAGG + Intergenic
1106049534 13:26177411-26177433 CAGAGGAAGAGGATGCTGCCAGG - Intronic
1106219687 13:27735237-27735259 CAGGAGAATGGCATGGACCCAGG + Intergenic
1106375498 13:29182910-29182932 CAGCTGAAGGGGAGGGAGCAGGG + Intronic
1106641037 13:31584893-31584915 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1106677458 13:31976291-31976313 CAGAAGAATGGCATGAATCCGGG - Intergenic
1106727581 13:32501720-32501742 CAGAAGAATGGCATGAAACCCGG + Intronic
1107379941 13:39845813-39845835 AAGAAGAAGGGGAGAGGGCCAGG - Intergenic
1107556363 13:41519594-41519616 TAGAAGGAGGGGTTGGGGCCAGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1108279369 13:48846118-48846140 TAGAAGCACAGGATGGAGCCAGG - Intergenic
1108368764 13:49745968-49745990 CAGAAGAATGGCATGAACCCGGG + Intronic
1108383789 13:49879539-49879561 CTGAAGAGGGGGCTGAAGCCAGG + Intergenic
1108601301 13:51997543-51997565 CAGAAAAGGGGGCTGGGGCCAGG + Intronic
1108616726 13:52140513-52140535 CAGAAGAATGGCATGAATCCAGG + Intronic
1109226223 13:59699373-59699395 CAGCTGAAGGGGAGTGAGCCAGG + Intronic
1109512314 13:63394331-63394353 AGGAAGAAGGGGATGGAGGAAGG + Intergenic
1109922011 13:69076539-69076561 CACAAGAATGTGATGGAACCTGG - Intergenic
1110576171 13:77057928-77057950 CAGGAGAATGGCATGAAGCCAGG - Intronic
1111127840 13:83935342-83935364 CTGAAGAAGGGCATGGAGGAAGG + Intergenic
1111633249 13:90870481-90870503 CAGAAGAAGGGGAAGGACAAGGG - Intergenic
1111647190 13:91046300-91046322 CAAAAGAAGGGGATTGCCCCAGG - Intergenic
1111967426 13:94875200-94875222 CAGAAGAACGGCATGAACCCGGG - Intergenic
1113367539 13:109690304-109690326 CAGAAGAATGGCATGAACCCGGG + Intergenic
1113520268 13:110935763-110935785 CAGAAGAATGGCATGAACCCAGG - Intergenic
1113570390 13:111350098-111350120 CAGAAGAATGGCATGAACCCGGG - Intergenic
1113855833 13:113445025-113445047 GAGAAGAAGGAGCTGGAGCTGGG - Intronic
1114297657 14:21344390-21344412 CAGAACAAGAGGATGGAGAGAGG - Intronic
1114468675 14:22943407-22943429 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1114538246 14:23436467-23436489 CAGCAGATGGGAGTGGAGCCCGG + Intergenic
1114951003 14:27753327-27753349 CAGAAGAATGGCATGAACCCGGG + Intergenic
1115233133 14:31182756-31182778 CAGAAGAATGGCATGAACCCGGG + Intronic
1116094088 14:40345994-40346016 CAGAAGAATGGCATGAACCCAGG - Intergenic
1116290005 14:43022447-43022469 GAGAAGAAAGGGATGGAGGGAGG - Intergenic
1116391518 14:44397099-44397121 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1116951476 14:50882467-50882489 CAGAAGAATGGCATGAACCCAGG - Intronic
1117202659 14:53408384-53408406 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117202666 14:53408403-53408425 CAGGAGTAGGGGAGGGAGGCAGG - Intergenic
1117253268 14:53955263-53955285 CAGTAGAAGGGGCGGGCGCCCGG + Intronic
1117415330 14:55490339-55490361 CAGAAGAATGGCATGAACCCAGG - Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117762222 14:59041993-59042015 CAGAAGAACGGCATGAACCCGGG - Intergenic
1117793146 14:59362134-59362156 CAGAAGCAGGGGTCAGAGCCAGG - Intronic
1118299897 14:64605933-64605955 GGGAAGATGGGGATGGATCCTGG + Intergenic
1118324935 14:64774346-64774368 CAGGAGATGGGGATTGAGCCAGG - Intronic
1119020322 14:71105633-71105655 CAGAAGAATGGCATGAACCCGGG - Intronic
1119296692 14:73538518-73538540 CAGAAGAATGGCATGAACCCAGG + Intronic
1119491603 14:75038948-75038970 CAGGAGAATGGCATGGAGGCAGG - Intronic
1119747119 14:77052481-77052503 CGGAAGAGGGGCAGGGAGCCGGG + Intergenic
1119924781 14:78482980-78483002 CAGATGCTGGGGATGGAGACAGG - Intronic
1120366714 14:83580566-83580588 CAGGAGAATGGCATGGACCCAGG + Intergenic
1120926460 14:89801899-89801921 CAGAAGAACTGGTTGAAGCCAGG + Intronic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121200476 14:92112666-92112688 CAGGAGAAGGGCATGAACCCGGG + Intergenic
1121432973 14:93900377-93900399 CAGCAGAAGGAGATGGAGTCAGG - Intergenic
1121656101 14:95597022-95597044 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1121703094 14:95971203-95971225 CAGAAGAATGGCATGAACCCGGG - Intergenic
1121704719 14:95982917-95982939 CCGAAGAAGGAGAAGGAGCTAGG - Intergenic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122342324 14:101036642-101036664 CAGGAGAATGGGATGAACCCGGG - Intergenic
1122474682 14:101998972-101998994 CAGGAGAATGGCATGAAGCCAGG - Intronic
1122548065 14:102535748-102535770 CAGGAGAAGGGCATGAACCCGGG - Intergenic
1122614967 14:103010935-103010957 CAGGAGAATGGCATGAAGCCAGG + Intronic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1123106084 14:105841674-105841696 CAGAGGCTGGGCATGGAGCCTGG + Intergenic
1123108891 14:105856094-105856116 CAGGAGAAAGTGATGGAGTCGGG + Intergenic
1202937181 14_KI270725v1_random:101044-101066 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1123396026 15:19936832-19936854 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1123675122 15:22703215-22703237 CAGGAGAATGGCATGGACCCGGG - Intergenic
1123726555 15:23108971-23108993 CAGAAGAATGGCATGAACCCAGG - Intergenic
1123781238 15:23631182-23631204 CAGAAGAATGGCATGAACCCGGG + Intergenic
1123959555 15:25382226-25382248 CAGAAGAATGGCATGAACCCGGG + Intronic
1124038070 15:26074772-26074794 CAGAAGAATGGCAGGAAGCCAGG + Intergenic
1124240913 15:28027039-28027061 CAGAACAAGGTTTTGGAGCCGGG - Intronic
1124327132 15:28776212-28776234 CAGGAGAATGGCATGGACCCGGG - Intergenic
1124423925 15:29546792-29546814 CAGAAGAATGGCATGAACCCGGG + Intronic
1124510437 15:30319872-30319894 CAGAAGAATGGTGTGGACCCAGG - Intergenic
1124529129 15:30488101-30488123 CAGGAGAATGGCATGGACCCCGG - Intergenic
1124732452 15:32210655-32210677 CAGAAGAATGGTGTGGACCCAGG + Intergenic
1124769531 15:32519592-32519614 CAGGAGAATGGCATGGACCCCGG + Intergenic
1124789181 15:32710767-32710789 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1124937914 15:34190035-34190057 CAGAAGAATGGCATGAACCCGGG - Intronic
1125255546 15:37758893-37758915 CAAAAGGAGTGGATGGTGCCAGG + Intergenic
1125367445 15:38932931-38932953 CAGAAGAAAGGTATTGAGACAGG - Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125853281 15:42924782-42924804 CAGGAGAATGGCATGGACCCGGG - Intergenic
1126086568 15:45016070-45016092 CAGAAGAATGGCATGAACCCAGG - Intergenic
1126336723 15:47593310-47593332 CAGGAGAATGGCATGGAGCCGGG + Intronic
1126741336 15:51779471-51779493 CAGAAGAATGGCATGAACCCGGG - Intronic
1126768426 15:52031991-52032013 CAGAAGAATGGCATGAACCCGGG - Intronic
1127072450 15:55299911-55299933 CAGAAGAATGGCATGAACCCAGG - Intronic
1127112479 15:55689479-55689501 AAGAAAAAGGGGAGGGAGTCTGG + Intronic
1127679965 15:61284682-61284704 GAGAAAAAGAGGTTGGAGCCGGG + Intergenic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1128015219 15:64338922-64338944 CAGAAGAATGGCTTGGACCCAGG + Intronic
1128060194 15:64730697-64730719 CAGAAGAATGGCATGAACCCAGG - Intergenic
1128119536 15:65135234-65135256 CAGAAGAATGGCATGAACCCAGG - Intergenic
1128182225 15:65613985-65614007 GAGAGGAAGGGGCTGGAGCTTGG - Intronic
1128391602 15:67186341-67186363 CAAAAGATGGGGGTGGGGCCGGG - Intronic
1128680857 15:69650341-69650363 CAGAGGAAGGAAATGCAGCCAGG - Intergenic
1129274193 15:74434479-74434501 GAGAGGGAGGGGAAGGAGCCAGG - Intergenic
1129371107 15:75096264-75096286 CAGGAGAATGGCATGAAGCCGGG - Intronic
1129440173 15:75575824-75575846 CAGAAGAATGGCATGAACCCAGG + Intronic
1129637195 15:77332505-77332527 CAGAAGAATGGCATGAACCCGGG + Intronic
1129707091 15:77800473-77800495 CCGAAGATGGAGATGGAGCATGG + Intronic
1129882571 15:79016922-79016944 CAGCAGAAGGGGAGGGAGGTTGG - Intronic
1129903036 15:79166279-79166301 TAGGAGAACAGGATGGAGCCTGG + Intergenic
1130006269 15:80101883-80101905 CAGGAGAAGGGCATGAACCCAGG - Intronic
1130007726 15:80117313-80117335 CAGGAGAATGGCATGAAGCCAGG - Intronic
1130301490 15:82682346-82682368 AAGAAGAAGGGCTTGGGGCCGGG - Intronic
1130451087 15:84052900-84052922 CAGAAGAATGGCATGAACCCAGG + Intergenic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1130558372 15:84939398-84939420 CCGAAGGAAGGGAGGGAGCCTGG + Intronic
1131010351 15:89012250-89012272 CAGAAGAATGGCATGAACCCTGG + Intergenic
1131166740 15:90147303-90147325 CAGAAGAACCGGTTGAAGCCTGG + Intergenic
1131172534 15:90188758-90188780 CAGAAGAATGGCATGAATCCGGG - Intronic
1131211787 15:90503887-90503909 CAGAAGAATGGCATGAACCCGGG + Intergenic
1131489759 15:92852416-92852438 CAGGAGAATGGCATGGATCCGGG + Intergenic
1131546591 15:93320939-93320961 CAGAAGAATGGCATGAACCCAGG + Intergenic
1131671358 15:94623098-94623120 CTGAAGAATGGTAGGGAGCCAGG + Intergenic
1131764654 15:95662151-95662173 CAGGAGAATGGGATGAACCCAGG + Intergenic
1131831159 15:96355368-96355390 GAGAAGAAGGGGGTGGAGGGGGG + Intergenic
1132074735 15:98810639-98810661 CAGAAGAATGGCGTGAAGCCGGG - Intronic
1132227208 15:100151641-100151663 CAGAAGTAGGGGAACCAGCCAGG - Intronic
1132249364 15:100322992-100323014 CAGGAGAATGGCATGGACCCGGG + Intronic
1132361227 15:101217602-101217624 CAGAAGGAAGGGATGGAGGGAGG + Intronic
1132369377 15:101283471-101283493 CAGAAGAATGGCATGAACCCAGG + Intronic
1132679789 16:1134989-1135011 CAGAAGGAGTTGATGGAGCACGG - Intergenic
1132696093 16:1202601-1202623 CATAAGAAGGGGAAAGAGGCAGG + Intronic
1132712683 16:1276513-1276535 CAGAAGGAGGTCAGGGAGCCCGG + Intergenic
1132872284 16:2121068-2121090 AAGGAGAAGGGGAAAGAGCCGGG + Intronic
1132917096 16:2355529-2355551 CAGAAGAATGGCGTGGACCCGGG - Intergenic
1133373167 16:5261640-5261662 CAGAAGAATGGCATGAACCCGGG - Intergenic
1133474074 16:6102902-6102924 TAGAAGAAAGTGATGGAGTCTGG + Intronic
1133537855 16:6719531-6719553 CAGAAGAATGGCATGAACCCAGG - Intronic
1133722146 16:8504728-8504750 CAGAAGAATGGCATGAACCCGGG - Intergenic
1133798319 16:9064552-9064574 CAGAAGAATGGCATGAACCCGGG + Intergenic
1134212102 16:12286436-12286458 CAGAAGAATGGCATGAACCCGGG - Intronic
1134213491 16:12297500-12297522 CAGGAGAAGGGAAGGAAGCCAGG - Intronic
1134542412 16:15078355-15078377 TGGAAGGAGGGGATGGAGCAGGG - Intronic
1134551333 16:15140147-15140169 AAGGAGAAGGGGAAAGAGCCGGG + Intergenic
1134799068 16:17067826-17067848 CAGAAGCAGAGGCTGGTGCCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135314735 16:21434926-21434948 CAGGAGAATGGGATGAACCCGGG - Intronic
1135340370 16:21640672-21640694 CAGAAGAATGGCATGAACCCGGG + Exonic
1135359993 16:21804438-21804460 TGGAAGGAGGGGATGGAGCAGGG - Intergenic
1135367658 16:21867206-21867228 CAGGAGAATGGGATGAACCCGGG - Intronic
1135444156 16:22503956-22503978 CAGGAGAATGGGATGAACCCGGG + Intronic
1135490954 16:22908980-22909002 CAGAAGAAAGGGGAAGAGCCAGG + Intronic
1135588391 16:23688682-23688704 CAGAAGATGGGGATGCAGGCAGG - Exonic
1135610852 16:23865907-23865929 CAGAAGAGGAGGATGGAGAGTGG - Intronic
1135708626 16:24696253-24696275 CAGGAGAATGGCATGGACCCAGG + Intergenic
1136262811 16:29092501-29092523 TGGAAGGAGGGGATGGAGCAGGG + Intergenic
1136311401 16:29413608-29413630 CAGGAGAATGGGATGAACCCGGG - Intergenic
1136324847 16:29515400-29515422 CAGGAGAATGGGATGAACCCGGG - Intergenic
1136439532 16:30255385-30255407 CAGGAGAATGGGATGAACCCGGG - Intergenic
1136480185 16:30536369-30536391 CAGAAAAAGTGGCTGAAGCCAGG + Intronic
1136563757 16:31057251-31057273 CAGGAGAATGGGATGAACCCAGG - Intergenic
1136769107 16:32818858-32818880 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1136901486 16:34043451-34043473 CAGAAGAATGGCATGAAGCTGGG + Intergenic
1136956683 16:34795223-34795245 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1136997862 16:35203057-35203079 AAGATGCAGAGGATGGAGCCAGG - Intergenic
1137028735 16:35502718-35502740 AAGATGCAGAGGATGGAGCCAGG - Intergenic
1137352745 16:47727925-47727947 GAGAAGAAGTGGATGGAATCTGG + Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137700413 16:50493921-50493943 CAGAAGCCAGGGATGGAGCCTGG + Intergenic
1137941907 16:52696162-52696184 CAGAAGAAGAGGTTGCAGGCTGG - Intergenic
1138046644 16:53732139-53732161 CAGGAGAATGGCATGAAGCCCGG - Intronic
1138437780 16:57015223-57015245 CACAAGAAGAGGCTGGAGGCCGG - Intronic
1138479176 16:57290429-57290451 CAGAAAAAGGGCAGGGAGCCAGG + Intergenic
1138827734 16:60341408-60341430 CAGAAGAATGGCATGAACCCAGG - Intergenic
1139092213 16:63662152-63662174 CAGGAGAATGGCATGAAGCCGGG + Intergenic
1139154463 16:64423760-64423782 CAGAAGAATGGCATGAACCCGGG + Intergenic
1139172601 16:64649240-64649262 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1139282287 16:65781105-65781127 TAGAAGATGGGGATGGATTCTGG + Intergenic
1139587991 16:67916639-67916661 CAGAAAGTGGGAATGGAGCCTGG + Intronic
1139776849 16:69321774-69321796 CAGAGGATGGAGATGGAGCAGGG + Intronic
1139840169 16:69872307-69872329 CAGAAGAATGGCATGAACCCGGG - Intronic
1139899376 16:70315292-70315314 CAGAAGAATGGCATGAACCCGGG + Intronic
1140288312 16:73625948-73625970 CAGAAGAATGGCATGAACCCGGG - Intergenic
1140291777 16:73665906-73665928 CAGAAGAATGGCATGAACCCGGG - Intergenic
1140382456 16:74502634-74502656 CAGAAGAAAGGCATGAACCCAGG - Intronic
1140774030 16:78233617-78233639 CAGAAGAATGGCATGAACCCGGG - Intronic
1141178174 16:81734384-81734406 CAGGAGGAGGGGATGCAGCCAGG + Intergenic
1141275453 16:82583662-82583684 GAGATGAAGAGGATGGAGACAGG - Intergenic
1141443400 16:84043441-84043463 CAGAAACAGGGGCTGGGGCCTGG - Intergenic
1141445968 16:84058531-84058553 CTGAGAAAGGGGATGAAGCCAGG - Intronic
1141900400 16:86987036-86987058 CAGAGGAGGGGGCTGGGGCCAGG - Intergenic
1142115530 16:88354261-88354283 GAGAAGCAAGGGATGGTGCCTGG + Intergenic
1142300060 16:89252174-89252196 CAGAAGAATGGCATGAACCCAGG - Intergenic
1203071526 16_KI270728v1_random:1080965-1080987 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1142615088 17:1129437-1129459 CAGAAGAATGGTGTGGACCCAGG + Intronic
1142788254 17:2242435-2242457 CAGAAGAATGGCATGAACCCGGG + Intronic
1142827541 17:2523394-2523416 CAGAAGAATGGCATGAACCCAGG - Intergenic
1142863844 17:2778685-2778707 CAGCAGTAGGTGATGGAGCTGGG - Intronic
1142876933 17:2856802-2856824 CAGAAGAACGGGATGAAGCCAGG - Intronic
1142983093 17:3682542-3682564 CTGGAGAAGGGGATGGGGACTGG + Intronic
1143076656 17:4349748-4349770 CAGAAGAATGGCATGAACCCGGG + Intronic
1143280485 17:5750656-5750678 AAGAAGAAGTCAATGGAGCCAGG - Intergenic
1143582506 17:7835176-7835198 CAGAAGACGGGGAGGGGGCTGGG + Intergenic
1143591072 17:7885958-7885980 GAGATGAAGGGGGTGGAGCCGGG - Intronic
1143649909 17:8256960-8256982 GAGAGGAAGGAGATGGAACCTGG - Exonic
1143780760 17:9228135-9228157 CAGAAGGAGGGGGTGTGGCCGGG + Intronic
1143812416 17:9482819-9482841 CAGAAGAATGGGTTGAACCCGGG + Intronic
1143877891 17:10006420-10006442 CAGGAGAATGGCATGGACCCAGG - Intronic
1144106841 17:11993729-11993751 CAGAAGAATGGGGTGAACCCAGG + Intronic
1144247519 17:13382119-13382141 CAGGAGAATGGCATGAAGCCAGG - Intergenic
1144249005 17:13396856-13396878 CAGAAGAATGGCATGAACCCAGG - Intergenic
1144409232 17:14984445-14984467 CAGGAGAATGGCATGAAGCCAGG - Intergenic
1144442265 17:15294193-15294215 CAGGAGAATGGGAGCGAGCCCGG - Intergenic
1144461950 17:15465796-15465818 GGGAAGAGGGGGAGGGAGCCTGG + Intronic
1144479256 17:15615412-15615434 CAGCAGAAGGGCGTGAAGCCGGG - Intronic
1144681397 17:17198098-17198120 CAGAAGAATGGCATGAACCCGGG - Intronic
1144912265 17:18693313-18693335 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1144919046 17:18748316-18748338 CAGCAGAAGGGCGTGAAGCCGGG + Intronic
1144931598 17:18863623-18863645 CAGAAGAATGGCATGAACCCAGG - Intronic
1145158557 17:20558801-20558823 CAGAAGAATGGCATGAACCCAGG + Intergenic
1145181321 17:20755363-20755385 CAGGAGAAGGGGGTGAACCCGGG - Intergenic
1145412373 17:22680183-22680205 CAGGAGAATGGCATGGACCCAGG - Intergenic
1145952730 17:28832095-28832117 CAGAAGAAAGGCATGAACCCGGG + Intronic
1146074839 17:29718638-29718660 CAGAAGAATGGCATGAACCCGGG + Intronic
1146287402 17:31583070-31583092 CAGAAGAATGGCATGAACCCAGG + Intergenic
1146357737 17:32148170-32148192 CAGAAGAATGGCATGAATCCGGG + Intronic
1146884110 17:36459504-36459526 ATGAGGAAGGAGATGGAGCCTGG + Intergenic
1147171016 17:38618921-38618943 GAGATGAAGGGGATAGGGCCAGG - Intergenic
1147193570 17:38750282-38750304 AAGAATAAGTGGATGGACCCCGG - Exonic
1147566517 17:41539540-41539562 CAGAAGAAAGGGCTGGAGCATGG + Intergenic
1147804745 17:43122962-43122984 CAGAAGAATGGCATGAACCCGGG + Intronic
1147944402 17:44072420-44072442 CAGGAGAATGGCATGAAGCCGGG - Intronic
1147960199 17:44162694-44162716 CAGAAGAAAGGCATGAACCCGGG - Intergenic
1148041776 17:44713130-44713152 CAGAAGAATGGCATGAACCCGGG - Intronic
1148102417 17:45100473-45100495 CAGGAGAATGGCATGGACCCGGG + Intronic
1148507683 17:48141080-48141102 TAGAAGAGGGGGATGGGGCTGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148711313 17:49683321-49683343 CAGAAGAATGGGATGCACCCAGG - Intergenic
1148730396 17:49831751-49831773 CAGAAGAATGGCATGAACCCGGG - Exonic
1148858620 17:50592614-50592636 GTGACGAAGGTGATGGAGCCTGG - Intronic
1149623570 17:58064054-58064076 CAGAAGAAAGGCATGAAACCAGG + Intergenic
1149635830 17:58168501-58168523 CAGAAGAAGATGGAGGAGCCGGG - Intergenic
1149686632 17:58539299-58539321 CAGAAAAAGGGGATGAAGGTGGG + Intronic
1149825079 17:59821061-59821083 CAGGAGAATGGCATGGACCCAGG - Intronic
1149920721 17:60656358-60656380 CAGAAGAATGGCATGAACCCGGG + Intronic
1149971307 17:61221005-61221027 CAGAAGAATGGCATGAACCCGGG + Intronic
1150029659 17:61719630-61719652 CAGAAGAATGGCATGAACCCAGG + Intronic
1150244650 17:63665256-63665278 CAGAAGAAGGGCATGAACCTGGG - Intronic
1150456202 17:65308807-65308829 CAGAACAAGAGGATTTAGCCTGG + Intergenic
1150531599 17:65989140-65989162 CAGAAGAATGGCATGAACCCAGG + Intronic
1150602225 17:66660814-66660836 CAGAAGAATGGCATGAACCCGGG + Intronic
1150667255 17:67152829-67152851 CAGAAGCTGGGAAAGGAGCCTGG + Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151204722 17:72497804-72497826 CAGAAGAATGGCATGAACCCAGG + Intergenic
1151232055 17:72692101-72692123 CAGAAGAATGGCATGAACCCAGG - Intronic
1151259443 17:72905078-72905100 CAGAAGAATGGCATGAACCCGGG + Intronic
1151260763 17:72914221-72914243 CAGAAGAATGGCATGAACCCGGG + Intronic
1151635513 17:75345133-75345155 CAGGAGAATGGGATGAACCCAGG - Intronic
1151725813 17:75883618-75883640 CAGGAGAATGGGATGAACCCGGG - Intronic
1151793517 17:76325696-76325718 CAGGAGAATGGCATGGAGGCAGG - Intronic
1151848984 17:76678550-76678572 CAGAAGAGTGAGATGCAGCCAGG - Intronic
1152161836 17:78673664-78673686 CAGAAGCAGGGGAAGGCGCTTGG - Intergenic
1152235586 17:79136640-79136662 CAGAAGATGGGGAAGGTGCTGGG + Intronic
1152347944 17:79765473-79765495 CAGAAGAATGGCATGAATCCGGG + Intergenic
1152537349 17:80958501-80958523 CAGAAGAATGGCATGAACCCAGG - Intronic
1152605901 17:81289909-81289931 CAGGAGACTGGGATGGAGCGGGG - Intronic
1152620448 17:81361679-81361701 CAGAAGAATGGTGTGAAGCCGGG - Intergenic
1152701497 17:81822072-81822094 CAGAAGAAGGGGGTGCCGCTGGG - Intergenic
1153644952 18:7187097-7187119 CAGAAGAATGGCATGAACCCGGG + Intergenic
1153957333 18:10108967-10108989 CAGAAGAATGGCATGAACCCAGG - Intergenic
1154200263 18:12294835-12294857 CAGGAGAATGGCATGGACCCGGG + Intergenic
1154242868 18:12668293-12668315 CAAAAAAAGTGGATGGAGGCTGG + Intronic
1154261098 18:12833543-12833565 CAGAAGAATGGGAGGGAGTTAGG + Intronic
1154365898 18:13708766-13708788 GAAAAGAAGGGAATGGAGGCTGG - Intronic
1154518875 18:15204875-15204897 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1155786355 18:29906616-29906638 CAGAAGAATGGCATGAACCCAGG - Intergenic
1155846790 18:30718277-30718299 AAGAAGAAGAGGCTGGAGACAGG - Intergenic
1155937202 18:31766378-31766400 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1155944564 18:31833907-31833929 CAGAAGAATGGCATGAACCCAGG + Intronic
1155975717 18:32127985-32128007 CAGGAGAATGGGATGAACCCGGG + Intronic
1156328650 18:36098742-36098764 CAGAAGAATGGCATGAACCCGGG - Intergenic
1156640623 18:39092421-39092443 CAGGAGAATGGGATGAACCCAGG + Intergenic
1157328409 18:46685821-46685843 CAGAAGCAGTGGTTGGAACCAGG - Intronic
1157523067 18:48358475-48358497 CAGAAGCAGATGCTGGAGCCAGG + Intronic
1157556855 18:48618540-48618562 CAGAGGAAGGGGAGGGTCCCTGG + Intronic
1157721765 18:49930797-49930819 CAGAAGAATGGCATGAATCCGGG + Intronic
1157987811 18:52459558-52459580 CAGAAGAATGGCATGAACCCGGG - Intronic
1158059381 18:53320163-53320185 CAGGAGAATGGCATGGACCCGGG - Intronic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1158242114 18:55389031-55389053 CAGAAGAATGGCATGAACCCGGG + Intronic
1158300431 18:56046271-56046293 GAGAAGAAGGGGTTGCATCCTGG - Intergenic
1158715924 18:59879714-59879736 CAGAAGAATGGCATGAACCCGGG + Intergenic
1158860782 18:61590186-61590208 ATGAAGAAGGGGAGGGAGGCAGG - Intergenic
1160065582 18:75571004-75571026 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1160072891 18:75643676-75643698 CAGCAGCAGGTGAGGGAGCCAGG - Intergenic
1160135301 18:76266355-76266377 GAGAAGAAGGGGAGGGAGGAAGG + Intergenic
1160167089 18:76523417-76523439 CAGAAGAATGGCATGAATCCGGG - Intergenic
1160374531 18:78401452-78401474 GAGATGAAGAAGATGGAGCCTGG + Intergenic
1160461803 18:79044502-79044524 CAGAAGAATGGCATGAACCCGGG + Intergenic
1160912788 19:1482543-1482565 GAGCTGAAGGGGAGGGAGCCCGG - Intronic
1160959133 19:1710199-1710221 CAGAAGAATGGCATGAACCCGGG + Intergenic
1161007039 19:1941955-1941977 CAGGAGGAGGCGATGGGGCCAGG - Intronic
1161101137 19:2422486-2422508 CAGGAGAATGGCATGAAGCCGGG + Intronic
1161156695 19:2735529-2735551 CAGGAGAAGGGCATGAAGCGAGG - Intronic
1161159154 19:2752145-2752167 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1161365116 19:3874397-3874419 CAGAAGAATGGCATGAACCCGGG + Intergenic
1161657071 19:5522896-5522918 CAGAAGAATGGCATGAACCCGGG + Intergenic
1161691259 19:5735871-5735893 CAGAAGAATGGCATGAACCCAGG - Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1161969664 19:7570463-7570485 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1162098732 19:8326702-8326724 CAGAAGAATGGCATGAACCCGGG + Intronic
1162300714 19:9843289-9843311 CAGAAGGAGGGGCTAGAGGCTGG - Intronic
1162510186 19:11113274-11113296 AAGAGGTAGGCGATGGAGCCTGG - Exonic
1162748927 19:12816210-12816232 CAGAAGAATGGCATGAACCCGGG + Intronic
1162975415 19:14205350-14205372 CAGGAGGAGGGGGTGCAGCCGGG - Intronic
1163405525 19:17119742-17119764 CAGAAGAATGGCATGAACCCGGG - Intronic
1163442345 19:17328433-17328455 GTGGAGAAGGGGCTGGAGCCGGG - Exonic
1164133010 19:22383167-22383189 CAGAAGAATGGCATGAACCCGGG + Intergenic
1164165806 19:22673567-22673589 CAGAAGAATGGCATGAACCCGGG - Intergenic
1164535625 19:29084718-29084740 CAGAAGGAGGGGCTGGGGTCGGG + Intergenic
1164866727 19:31610540-31610562 CAGAAGAACGGCGTGAAGCCAGG + Intergenic
1165737020 19:38183337-38183359 CAGACGAAGGGGCGGGAGCAGGG + Intronic
1165765385 19:38347283-38347305 CAGGAGAATGGCATGAAGCCGGG + Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165906254 19:39196591-39196613 AAGAAGGAGGGGCTGGTGCCTGG + Intergenic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166073094 19:40397924-40397946 AAGAAGAAGAAGATGGTGCCTGG - Exonic
1166079269 19:40433816-40433838 CAGAAAATGGAGACGGAGCCAGG + Intergenic
1166223608 19:41381451-41381473 CAGAAGAATGGCATGAACCCGGG - Intronic
1166319974 19:42011458-42011480 CAGAAGAATGGCATGAACCCGGG + Intronic
1166397645 19:42453713-42453735 CAGAAGAATGGCATGAACCCGGG - Intergenic
1166443503 19:42837702-42837724 CAGGAGAATGGCATGGACCCAGG - Intronic
1166463193 19:43008363-43008385 CAGAAGAATGGCATGAACCCGGG - Intronic
1166510347 19:43403944-43403966 CAGGAGAATGGCATGAAGCCAGG + Intronic
1166664946 19:44673837-44673859 CAGAAGAAGGTGATTGAGGGAGG + Intronic
1166937822 19:46345570-46345592 CATAAGAAGGTGACAGAGCCAGG - Intergenic
1167387425 19:49171957-49171979 CAGGAGTTGGGGATGGAGGCGGG + Intronic
1167569106 19:50275993-50276015 CAGAAGACGAGGGTGGGGCCCGG + Exonic
1167752888 19:51391096-51391118 AAGAAGGAGGGGCTGGAGCCTGG - Intergenic
1168028061 19:53658019-53658041 CAGGGGAAAGGGCTGGAGCCAGG - Intergenic
1168092537 19:54095514-54095536 AGGAAGAAGGGGCTGGGGCCTGG + Exonic
1168246245 19:55114289-55114311 GAGTAGGAGGGGCTGGAGCCAGG - Intronic
1168249712 19:55134775-55134797 AAGAAGAAGGGGAGGGAGGGAGG + Intronic
1168295451 19:55375406-55375428 AGGGAGAAGGGGCTGGAGCCTGG - Intergenic
1168561034 19:57383513-57383535 CAGAAGAATGGGATGGTGGGGGG - Intronic
1168589289 19:57619187-57619209 TAGAGGAAGCGGGTGGAGCCTGG - Intronic
1168664703 19:58194906-58194928 CAGGAGAATGGCATGAAGCCGGG + Intronic
1168722064 19:58559597-58559619 CTGGAAAAGGGGATGGAGGCGGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
926075077 2:9936154-9936176 CAGGAGAATGGCATGAAGCCGGG - Intergenic
926443070 2:12910226-12910248 CAGAAGAATGGCATGAACCCAGG + Intergenic
926723183 2:15977882-15977904 CAGAAGAATGGCATGGACCTGGG + Intergenic
927021855 2:19025451-19025473 CAGAAGAATGGCATGAACCCAGG - Intergenic
927353765 2:22150777-22150799 CAGGAGAATGGCATGAAGCCAGG - Intergenic
927670971 2:25068720-25068742 CAGAAGAATGGCATGAACCCGGG - Intronic
927729055 2:25454055-25454077 CAGGAGAATGGCATGAAGCCGGG + Intronic
928022213 2:27714124-27714146 CAGGAGAATGGCATGGACCCGGG + Intronic
928087166 2:28353027-28353049 CAGAAAAAGGGGCTGGAGGGAGG + Intergenic
928098357 2:28419696-28419718 CAGCAAAAGGGGATGGTCCCAGG - Intergenic
928124317 2:28605386-28605408 CAGATGAAGAGGCTGGAGTCAGG + Intronic
928442207 2:31301900-31301922 CAGAAGAGGGGAATGAAGCCTGG - Intergenic
928623901 2:33119647-33119669 CAGAAGAATGGCATGAACCCGGG - Intronic
928743421 2:34383046-34383068 CAGAAGAATGGCATGAACCCGGG + Intergenic
929105518 2:38361259-38361281 CAGAAGAATGGCATGAACCCGGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929489519 2:42384031-42384053 GGGAAGAAGGGGATTGAGGCTGG - Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929518464 2:42626033-42626055 CAGGAGAATGGCATGAAGCCGGG - Intronic
930078302 2:47425927-47425949 CAGGAGAATGGCATGGACCCGGG - Intronic
930081436 2:47452306-47452328 CAGAAGAATGGCATGAACCCGGG - Intronic
930511111 2:52346616-52346638 GAGAAAACGGGGAGGGAGCCAGG - Intergenic
930708774 2:54530449-54530471 CAGCAGAATGGCATGAAGCCAGG - Intronic
931428426 2:62191612-62191634 CAGAAGAATGGCATGAACCCGGG - Intergenic
931815721 2:65898591-65898613 CAGAAGAATGGTATGAACCCAGG - Intergenic
932228821 2:70065296-70065318 CAGAAGAATGGCATGAACCCAGG + Intergenic
932323408 2:70838276-70838298 CATAGGAAGGGGCTGGAGCAGGG + Intergenic
933652711 2:84862189-84862211 AGGAAGAAGGGCAAGGAGCCAGG - Intronic
933794567 2:85909321-85909343 CAGAGGAAGGGAATGGAGTTGGG - Intergenic
933837309 2:86256418-86256440 CAGAGGCAGTGGCTGGAGCCTGG - Intronic
934151893 2:89154931-89154953 CAGAATAACGGGAATGAGCCTGG - Intergenic
934215367 2:90026976-90026998 CAGAATAACGGGAATGAGCCTGG + Intergenic
934249149 2:90333015-90333037 CAGAAAAATGGCATGAAGCCGGG - Intergenic
934260429 2:91470458-91470480 CAGAAAAATGGCATGAAGCCGGG + Intergenic
934467729 2:94280265-94280287 CAGAAAAATGGCATGAAGCCGGG - Intergenic
934602319 2:95666994-95667016 CAGAAGAATGTAATGGAGACAGG + Intergenic
934856036 2:97730960-97730982 CAGGAGAATGGCATGGACCCAGG + Intronic
935023357 2:99252952-99252974 CAGAAGAATGGTATGAACCCAGG + Intronic
935352703 2:102167538-102167560 CAGAAGAATGGCATGAACCCGGG - Intronic
935478843 2:103560173-103560195 CAGGAGAATGGCATGGACCCGGG + Intergenic
935703807 2:105838959-105838981 CAGAAGAAAGGAATGGAGAGTGG + Intronic
935723042 2:105996698-105996720 CAGATGAAGGGCAAGGAGCAGGG - Intergenic
935965270 2:108466563-108466585 CAGAAGAATGGCATGAACCCGGG - Intronic
936030179 2:109064361-109064383 CAGAAGAATGGTATGAACCCGGG + Intergenic
936535682 2:113309148-113309170 CAGAAGAATGTAATGGAGACAGG + Intergenic
937155160 2:119713910-119713932 TAGAAAATGGAGATGGAGCCTGG - Intergenic
937464636 2:122121207-122121229 CAGGAGAACGGCATGGACCCGGG - Intergenic
938117028 2:128609054-128609076 CTGAAGAAGGGGTTGGATCTGGG + Intergenic
938174306 2:129110400-129110422 CAGGAGAATGGCATGAAGCCAGG - Intergenic
938321850 2:130371291-130371313 AAGAATCCGGGGATGGAGCCGGG - Intronic
938384789 2:130857137-130857159 CAGAAGAATGGCATGAACCCGGG + Intronic
938518872 2:132045386-132045408 CAGAAGAATGTCATGAAGCCAGG - Intergenic
938935433 2:136123549-136123571 CAGGAGAATGGGGTGGACCCAGG - Intergenic
939218873 2:139276376-139276398 CAGGAGAAGGGGAGTGAACCTGG + Intergenic
939904135 2:147889652-147889674 CAGGAGAATGGCATGGACCCAGG + Intronic
940114390 2:150192340-150192362 CTGGAAAAGGGGATGAAGCCAGG + Intergenic
940149495 2:150583900-150583922 CAGAAGAATGGCATGAACCCAGG - Intergenic
940372921 2:152922683-152922705 AAGAAGAAAGGGATGGAGGGAGG - Intergenic
940778343 2:157907359-157907381 CAGAAGAATGGCGTGAAGCCGGG - Intronic
941274990 2:163479879-163479901 CAGATGGAGGTGATGGAGCTAGG + Intergenic
941856188 2:170233643-170233665 CAGAAGATGGGGCTGGGGCCAGG + Intronic
941859127 2:170260955-170260977 CAGAAAAATGGGATGGTACCTGG + Intronic
942286395 2:174421708-174421730 CAGAAAATGGGGAGGGAACCTGG - Intronic
942571715 2:177322146-177322168 CAGAAGAATGGCATGAACCCGGG + Intronic
942586813 2:177489175-177489197 CAGAAGAATGGCATGAACCCGGG - Intronic
942657401 2:178228440-178228462 CAGAAGAATGGCGTGAAGCCGGG + Intronic
942678974 2:178457059-178457081 CAGAAGAATGGCATGAACCCGGG - Intronic
942809463 2:179980508-179980530 CAGAAGAATGGCATGAACCCAGG - Intronic
943495550 2:188616642-188616664 CAGAAGAATGGCATGAACCCAGG - Intergenic
943503211 2:188718592-188718614 CAGAAGAATGGCATGAACCCGGG - Intergenic
944059222 2:195554522-195554544 CAGAAGAATGGCATGAATCCAGG + Intergenic
944181065 2:196894707-196894729 CAGAAGAATGGCATGAACCCGGG + Intronic
944732233 2:202528278-202528300 CAGGAGAATGGCATGAAGCCGGG - Intronic
945085508 2:206128256-206128278 CAGAAGAATGGCATGAACCCAGG - Intronic
945288904 2:208108769-208108791 CAGGAGAATGGGATGAACCCAGG + Intergenic
945433437 2:209792438-209792460 CAGAAGAATGGCATGAACCCGGG - Intronic
946040293 2:216777100-216777122 CAAAAGAACTGGATGGAGTCTGG + Intergenic
946198350 2:218053600-218053622 CAGGAGAATGGGATGAATCCGGG - Intronic
946230530 2:218288334-218288356 CAGAAGAATGGCATGAACCCGGG + Intronic
946852187 2:223918536-223918558 CAGAAGAATGGCATGAACCCGGG + Intronic
947357835 2:229315699-229315721 CAGAAGTGAGGGAAGGAGCCAGG + Intergenic
947571970 2:231243152-231243174 CAGAAGAATGGCATGAACCCGGG + Intronic
947674242 2:231962525-231962547 CAGAAGAATGGCATGAACCCAGG - Intronic
947776028 2:232710050-232710072 CAGAAGAATGGCATGAACCCGGG - Intronic
948079686 2:235195637-235195659 CAGAATGGTGGGATGGAGCCAGG - Intergenic
948114197 2:235481776-235481798 CAGGAGAATGGCATGAAGCCAGG + Intergenic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948490569 2:238310056-238310078 CAGGAGAAGGGCATGAACCCGGG - Intergenic
948560321 2:238847648-238847670 CAGAAGATGAGGACGCAGCCAGG - Intergenic
948911889 2:241009035-241009057 CAGGACATGGGGATGGAGCTTGG + Intronic
1169016800 20:2298910-2298932 TGGAAGAAGGCCATGGAGCCGGG - Intronic
1169220219 20:3818309-3818331 CAGAAGCATGGGTTGGACCCAGG + Intergenic
1169233978 20:3913879-3913901 CAGAAGAATGGCATGAACCCAGG - Intronic
1169786631 20:9366302-9366324 CAGGAGAATGGCATGGAACCTGG + Intronic
1169834924 20:9867541-9867563 GAGAAGAAGGGGATGAAGATTGG - Intergenic
1170412676 20:16107834-16107856 CAGAGGAAGGGATTGGGGCCAGG + Intergenic
1170531749 20:17300158-17300180 CAGCAGAAGGGGTGGGAGTCAGG - Intronic
1170672209 20:18444891-18444913 CAGGAGAATGGCATGGACCCGGG - Intronic
1170680589 20:18522078-18522100 GAGAAGAAGGGAATGGAGGGCGG + Intronic
1170708382 20:18766647-18766669 CAGGAGAATGGGGTGGACCCGGG + Intergenic
1170916562 20:20632115-20632137 CAGGAGAAAGGCATGGACCCAGG - Intronic
1171200670 20:23239137-23239159 GAGAAGAAGGAGATAGAGACAGG - Intergenic
1171365835 20:24624161-24624183 CAGAAGAATGGCATGAACCCGGG + Intronic
1171423245 20:25032898-25032920 CAGAAGAGGCCGCTGGAGCCAGG - Intronic
1171427583 20:25058243-25058265 CAGAAGAAGGGGTGGGACCCGGG - Intronic
1171453942 20:25256026-25256048 CAAAAGAAAGAGCTGGAGCCAGG - Intronic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1171954531 20:31450450-31450472 CAGGAGAAGGGCATGAACCCGGG - Intergenic
1171996630 20:31736662-31736684 CAGAAGAATGGCATGAACCCGGG - Intergenic
1172019401 20:31902471-31902493 CAGGAGAAGGGCATGAAACCGGG - Intronic
1172103490 20:32500444-32500466 CAGAAGAATGGCATGAACCCGGG - Intronic
1172106498 20:32520191-32520213 CAGAAGAATGGCATGAACCCGGG + Intronic
1172190769 20:33060660-33060682 CAGAAGAATTGCATGAAGCCGGG - Intronic
1172472352 20:35209147-35209169 TAGAATAAGGGTATGTAGCCTGG + Intergenic
1172502543 20:35437471-35437493 CTGAAGAAGGCCAGGGAGCCCGG - Exonic
1172559134 20:35870209-35870231 CAGAAGAATGGCATGAACCCGGG + Intronic
1172579679 20:36037024-36037046 CTCAGGAAAGGGATGGAGCCTGG - Intergenic
1172645101 20:36464103-36464125 AAGAAGAAGGGCTTGGTGCCTGG + Intronic
1172781161 20:37437736-37437758 TGGGAGAAGGGGATGGAACCTGG - Intergenic
1172893998 20:38286731-38286753 CAGAAGAAGTGGATGGAGGGTGG + Intronic
1172979286 20:38928706-38928728 CGTGAGGAGGGGATGGAGCCAGG + Intronic
1173096963 20:40042921-40042943 CAGGAGAATGGCATGGACCCAGG + Intergenic
1173505134 20:43580966-43580988 CAGAAGAATGGCATGAACCCAGG - Intronic
1173649288 20:44652673-44652695 CAGGTGAAAGGGAAGGAGCCGGG + Intergenic
1173807620 20:45936265-45936287 CAGAAGAATGGCATGAACCCAGG - Intronic
1173998405 20:47357232-47357254 CAGAAAAAGGGGCTTGAGGCAGG + Intergenic
1174213023 20:48894933-48894955 CAGGAGAATGGCGTGGAGCCGGG + Intergenic
1174298391 20:49565061-49565083 CAGGAGAATGGCATGAAGCCGGG - Intronic
1174349708 20:49958235-49958257 CAGAAGAATGGCGTGGACCCGGG - Intergenic
1174389911 20:50212628-50212650 CAGAATCAAGGGATGGGGCCAGG - Intergenic
1174488348 20:50875029-50875051 CAGAAGAAGGAGAGGGCTCCCGG - Intronic
1174505903 20:51017428-51017450 CAGAGGAAGGGGAAGAAGCGCGG + Intronic
1174513988 20:51077015-51077037 GAGAAGTTTGGGATGGAGCCAGG + Intergenic
1174521931 20:51138330-51138352 CAGAAGAATGGCATGAACCCGGG + Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174717672 20:52777248-52777270 CAAAAGAAGGGGATGATTCCGGG + Intergenic
1174829465 20:53799349-53799371 CAGAAGAAGGGCTTGCAGGCTGG + Intergenic
1175019268 20:55827038-55827060 CAGAAGAAGGGGTTAGAGGAAGG - Intergenic
1175071165 20:56335179-56335201 CAGAAGAATGGCATGAACCCGGG - Intergenic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175329712 20:58155195-58155217 CAGCAGGAGGGGATGGAGATGGG + Intronic
1175345074 20:58267055-58267077 GAGAAGAATGGGATGGAGGAGGG + Intergenic
1175603181 20:60291369-60291391 CAGGAGAAGTGGAGGGAGACAGG + Intergenic
1175783475 20:61697956-61697978 CAGAAGTCAGAGATGGAGCCAGG + Intronic
1175850036 20:62085359-62085381 CAGCAGATGCGGATGGGGCCTGG + Intergenic
1176032006 20:63017267-63017289 CTGAAGAAGGGGGTGGTGCCTGG + Intergenic
1176136689 20:63525795-63525817 CAGAAGAATGGCATGAACCCGGG + Intergenic
1176150051 20:63586098-63586120 CACAAGAAGGGGATGCATCGTGG + Intergenic
1176184595 20:63771381-63771403 CAGAAGGAGGGGAGGGAGAGAGG + Intronic
1176237620 20:64061366-64061388 CAGAAGAATGGCATGAACCCAGG - Intronic
1176586137 21:8588066-8588088 CTGAAGAATGGCATGAAGCCGGG + Intergenic
1176615886 21:9028128-9028150 CAGAAGAATGGCATGAACCCAGG - Intergenic
1176742841 21:10620765-10620787 CTGAAGAATGGCATGAAGCCGGG + Intergenic
1177114863 21:17073343-17073365 AAGAAGAAGGGGAAGGAGAAGGG + Intergenic
1177368276 21:20167711-20167733 GAGAAGCAGGGGAAGGTGCCAGG + Intergenic
1177678463 21:24333675-24333697 CAGGAGAATGGCATGGACCCAGG + Intergenic
1177697149 21:24588281-24588303 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1177699518 21:24619079-24619101 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1178239640 21:30883740-30883762 CAGAAGAATGGCATGAACCCGGG + Intergenic
1178270608 21:31186215-31186237 CTAAAGAAGGGGAGGGAGGCTGG + Intronic
1178293475 21:31388678-31388700 CAGAGAAAGTGGAGGGAGCCAGG + Intronic
1178321950 21:31612676-31612698 CAAAAGAAGGGGAACGAGGCAGG - Intergenic
1178442518 21:32610498-32610520 CAGAAGACAAGGATGGGGCCGGG - Intronic
1178546018 21:33493637-33493659 CAGAAGAGGGGGATGGCTACTGG - Intergenic
1178663384 21:34525026-34525048 AGGAAGAAGGGGATGGCGCAGGG + Intronic
1178667837 21:34564423-34564445 CAGAAGGAAGGAATGCAGCCAGG + Intronic
1178990525 21:37351449-37351471 CAGGAGAATGGCATGGACCCGGG + Intergenic
1179000369 21:37452195-37452217 CTGAGGGAGGGCATGGAGCCTGG + Intronic
1179289330 21:40005112-40005134 CAGAAGAATGGCATGAACCCGGG + Intergenic
1179653548 21:42830964-42830986 CACAGGAAGGTGCTGGAGCCAGG - Intergenic
1180268944 22:10564973-10564995 CTGAAGAATGGCATGAAGCCGGG + Intergenic
1180280770 22:10692188-10692210 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1180743093 22:18067359-18067381 CAGAAGCTGGGTGTGGAGCCAGG - Intergenic
1180863719 22:19103521-19103543 CAGGAGAAGGGCATGAACCCGGG - Intronic
1180915243 22:19481469-19481491 CAGAAGAATGGCATGAACCCAGG - Intronic
1181411041 22:22719951-22719973 GAGAAGGAGGAGATGGAGCAGGG + Intergenic
1181420903 22:22797945-22797967 CAGAAGAATGGCATGAACCCGGG + Intronic
1181422035 22:22808217-22808239 CAGGAGAATGGCATGGACCCAGG + Intronic
1181560706 22:23697936-23697958 AAGATGTAGAGGATGGAGCCAGG - Intronic
1181562842 22:23715631-23715653 CAGAAAAAGAGGATGTAGGCTGG + Intergenic
1181582853 22:23837529-23837551 AGGAAGATGGGGATGGAGCCAGG + Intronic
1181599083 22:23938242-23938264 CAGAAGAATGGCATGAACCCGGG + Intergenic
1181963152 22:26637587-26637609 CAGGAGAATGGCATGAAGCCTGG + Intergenic
1182044320 22:27262492-27262514 AAGAAGCAGGGGTGGGAGCCAGG + Intergenic
1182223113 22:28774158-28774180 CAGGAGAATGGCATGAAGCCGGG - Intronic
1182294542 22:29305373-29305395 GAGAAGACAGGGATGGAGCCGGG - Intergenic
1182318775 22:29464860-29464882 CGGGAGAAGGGGAAGGGGCCTGG - Intergenic
1182758708 22:32703542-32703564 CAGAAGAATGGCATGAACCCGGG + Intronic
1182978206 22:34643143-34643165 CAGCAGATGTGGAGGGAGCCAGG + Intergenic
1183034309 22:35129517-35129539 CAGGAGAATGGCATGGACCCGGG + Intergenic
1183322390 22:37172989-37173011 CAGAAGGAAGGGATGGTTCCTGG - Intronic
1183462466 22:37960488-37960510 CAGGAGAAGGGCGTGAAGCCAGG - Intronic
1183503335 22:38194402-38194424 CAGAGGGAGGGGATGGGGACTGG + Intronic
1183580144 22:38720019-38720041 CAGAAGAATGGCATGAACCCGGG - Intronic
1183792056 22:40079886-40079908 CAGGAGAATGGCATGAAGCCGGG - Intronic
1183799734 22:40152417-40152439 CAGAAGAATGGCATGAACCCGGG - Intronic
1183838327 22:40476049-40476071 CAGAAGAATGGCATGAACCCGGG + Intronic
1183948882 22:41341648-41341670 CAGAAGAATGGCATGAACCCGGG + Intronic
1183956300 22:41382307-41382329 CAGCGGAGGGGGATGGGGCCTGG + Intronic
1184169730 22:42751908-42751930 AAGAAGAAGGGCTTGGGGCCAGG - Intergenic
1184280535 22:43435068-43435090 CAGACGAAGCGGGTGTAGCCTGG - Exonic
1184283378 22:43451885-43451907 CACAAGAAAGGCATGGAGGCGGG - Intronic
1184472944 22:44706093-44706115 AAGAGAAAGGGGAGGGAGCCTGG - Intronic
1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG + Intergenic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1185108922 22:48890017-48890039 CACATGGAGGGGACGGAGCCTGG + Intergenic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185354504 22:50359309-50359331 CAGGAGAATGGCATGAAGCCGGG - Intronic
1185385008 22:50527561-50527583 CAGAAGCAGGCCATGGAGTCAGG + Intronic
949496301 3:4635431-4635453 CAGGAGAAAGGGGTGGACCCGGG - Intronic
949515144 3:4800733-4800755 CAGAAGCAGGGGATGGCTGCAGG + Intronic
949545792 3:5071090-5071112 CGGCAGGAAGGGATGGAGCCCGG - Intergenic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
949919091 3:8987455-8987477 CAGATGGTGGGGTTGGAGCCTGG + Intronic
949998367 3:9637175-9637197 CAGGAGAATGGCATGCAGCCGGG - Intergenic
950022401 3:9796846-9796868 CAGGAGAAGGGCATGAACCCGGG + Intronic
950059657 3:10059711-10059733 CAGGAGAATGGCATGAAGCCGGG + Intronic
950081778 3:10227759-10227781 CAGAAGAATGGCATGAACCCGGG - Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
951998856 3:28761190-28761212 CAGGAGAATGGGATGAACCCGGG + Intergenic
952039649 3:29246625-29246647 CAGAAGAATGGCATGAACCCGGG + Intergenic
952270628 3:31827541-31827563 CAGAAGAATGGCATGAATCCGGG + Intronic
952275958 3:31876994-31877016 CAGAAGAATGGTATGAACCCAGG - Intronic
952629114 3:35443198-35443220 CAGAAGAATGGCATGAACCCAGG + Intergenic
953038020 3:39229834-39229856 CAGAAGAATGGCATGAACCCGGG - Intergenic
953282513 3:41572671-41572693 CAGAAGAATGGCATGAACCCAGG + Intronic
953316440 3:41931555-41931577 CATAGGAAGGGAATGGTGCCTGG - Intronic
953440888 3:42916455-42916477 CAGAAGAATGGCATGAACCCAGG - Exonic
953640056 3:44698495-44698517 CAGAAGAATGGCATGAACCCGGG - Intergenic
953703613 3:45215133-45215155 CAGAACAAGGGGATTGGGGCAGG - Intergenic
953803942 3:46051931-46051953 CAGGAGAATGGCATGGACCCGGG + Intergenic
953937532 3:47058885-47058907 CAGAAGAATGGCATGAACCCGGG - Intronic
954115389 3:48464371-48464393 CAGAATAGGGGGCTGGAGGCAGG + Intronic
954144689 3:48628757-48628779 CAGGAGAACAGGATGCAGCCAGG - Intronic
954171632 3:48808344-48808366 CAGGAGAATGGCATGAAGCCGGG - Intronic
954672980 3:52300362-52300384 TAGGAGAAGGGGAGGGAGCGAGG + Intergenic
954822362 3:53341360-53341382 CAGGAGAAGGGCATGAATCCGGG + Intronic
955158383 3:56440453-56440475 CAGGAGAATGGCATGGACCCAGG + Intronic
955330182 3:58040819-58040841 CACATGAATGGGATGGAGCGGGG - Intronic
955703886 3:61708545-61708567 CAGAAGAATGGCATGAACCCAGG - Intronic
955715103 3:61821260-61821282 CAGGAGAAGGGCATGAACCCAGG - Intronic
956012997 3:64851544-64851566 CAGAAGAATGTAATGGATCCTGG - Intergenic
956021061 3:64933761-64933783 CAGAAGAATGGCATGAACCCAGG - Intergenic
957991862 3:87636387-87636409 TGGAAGAATGGGGTGGAGCCAGG + Intergenic
958430318 3:94032587-94032609 CAGGAGAAGGGCATGAACCCGGG - Intronic
958443112 3:94180392-94180414 CAGGAGAATGGCATGAAGCCGGG - Intergenic
959049225 3:101508504-101508526 CAGGAGAATGGGATGAACCCAGG + Intronic
960051450 3:113242556-113242578 AAGCAGAAAGGGAAGGAGCCAGG - Intronic
960390471 3:117071957-117071979 CAGAAGAATGGCATGAACCCAGG - Intronic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960904812 3:122589976-122589998 CAGAAGAATGGCATGAACCCAGG - Intronic
961148766 3:124618200-124618222 CAGGAGAAGGGCATGAACCCCGG - Intronic
961268493 3:125669408-125669430 CAGGAGAATGGCATGAAGCCAGG - Intergenic
961777691 3:129301097-129301119 CAGAAGAATGGCATGAACCCGGG + Intronic
961883366 3:130078955-130078977 CAGAAGAATGGCATGAACCCGGG + Intergenic
962559980 3:136595582-136595604 CAGAAGAATGGCATGAATCCGGG + Intronic
962571889 3:136721829-136721851 CAGAAGAATGGCATGAACCCGGG + Intronic
963071674 3:141310017-141310039 CAGAAGAATGGCATGAACCCGGG - Intergenic
963262953 3:143211249-143211271 CAGGAGAATGGCATGAAGCCGGG - Intergenic
963813975 3:149809476-149809498 CAGGAGAATGGCATGAAGCCGGG + Intronic
963853692 3:150232751-150232773 CAGGAGAATGGCATGGACCCGGG + Intergenic
963899266 3:150718491-150718513 CAGGAGAATGGCATGAAGCCAGG - Intergenic
964141428 3:153405621-153405643 CAGAAGAATGGCATGAACCCAGG - Intergenic
964556583 3:157946135-157946157 CAGAAGAGGGGGAGGGAGGGAGG + Intergenic
964592406 3:158379291-158379313 CAGAAGAATGGCATGAACCCGGG - Intronic
965369873 3:167848504-167848526 CAGGAGAATGGCATGGACCCAGG - Intergenic
965386277 3:168050069-168050091 TAGAGGAAGGGGATGGGGCAGGG - Intronic
965618261 3:170616703-170616725 CAGAAGAATGGCATGAACCCAGG + Intronic
965761166 3:172078497-172078519 CAGAAGAAGGTAGAGGAGCCAGG + Intronic
966157863 3:176936649-176936671 CAGAAGAATGGCATGAACCCGGG - Intergenic
966202882 3:177376096-177376118 CAGAAGAATGGCATGAACCCGGG - Intergenic
966246594 3:177815227-177815249 CAGAAGAAGAAGATGGAACCAGG - Intergenic
966297539 3:178441299-178441321 CAGAAGAACGGCATGAACCCGGG + Intronic
966373632 3:179273793-179273815 CAGAAGAATGGGGTGAACCCGGG + Intergenic
966417423 3:179704002-179704024 CAAAGGCATGGGATGGAGCCAGG + Intronic
967251527 3:187544925-187544947 CAGGAGAATGGCATGGACCCGGG + Intergenic
968004019 3:195226972-195226994 CACAAGCAGGGGATGGGGCTAGG + Intronic
968028235 3:195461131-195461153 CAGGAGAATGGCATGGACCCAGG + Intergenic
968414460 4:418214-418236 CAGGAGAATGGCATGAAGCCGGG + Intergenic
968773742 4:2526031-2526053 CAGGAGAATGGCATGGAGGCAGG + Intronic
968812453 4:2806102-2806124 CAGGAGGAGGGGATTGAGCCAGG + Intronic
968847979 4:3057724-3057746 CAGAAGAATGGCATGAACCCGGG - Intergenic
969177643 4:5411126-5411148 CAGAAGAATGGCATGAACCCAGG - Intronic
969225503 4:5795353-5795375 CATCAGAAGAGGATGGAGGCTGG + Intronic
969240996 4:5897514-5897536 CAGAAAAAGGCAATGGAGCTAGG - Intergenic
969333210 4:6491964-6491986 CAGAGCCAGTGGATGGAGCCCGG - Intronic
969376525 4:6767090-6767112 CAGAAGAATGGCATGAACCCGGG - Intergenic
969385503 4:6844030-6844052 CAGAAGAATGGCATGAACCCAGG - Intronic
969509989 4:7612298-7612320 AAGGAGAAGGGCATGGAGACAGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969608840 4:8216055-8216077 CAGAAGAGGGGCAGGGAGGCAGG - Intronic
969854895 4:9991173-9991195 AAGCAGCAGGGGAAGGAGCCAGG - Intronic
970924974 4:21441232-21441254 CAGGAGAATGGCATGAAGCCGGG - Intronic
971136413 4:23873103-23873125 CAGAAGAATGGCATGAACCCAGG + Intronic
971326169 4:25645725-25645747 CAGAAGAATGGCATGAACCCAGG - Intergenic
971675979 4:29629949-29629971 CAGAAGAATGGCATGAACCCGGG + Intergenic
971999226 4:34008408-34008430 CAGGAGAATGGCATGGACCCGGG + Intergenic
972379915 4:38510104-38510126 CAGCAGATGAGGCTGGAGCCAGG - Intergenic
972533147 4:39977928-39977950 CGGAGGAAGGGGAGGGAGCGAGG - Exonic
972763328 4:42128529-42128551 CAGAAGAATGGCATGAACCCGGG + Intronic
972768532 4:42174033-42174055 CAGAAGAATGGCATGAACCCGGG - Intergenic
974031874 4:56783508-56783530 CAGGAGAAGGGGGTGAACCCAGG + Intergenic
974161618 4:58148892-58148914 CAGAAGAATGGCATGAACCCCGG + Intergenic
975019426 4:69468375-69468397 CAGAAGAATAGCTTGGAGCCGGG + Intergenic
975245594 4:72117145-72117167 CAAAAGCAGAGGAGGGAGCCTGG - Intronic
975545055 4:75551906-75551928 CAGAAGAAAGGCATGAATCCGGG - Intergenic
975926123 4:79455896-79455918 CAGAAGCAGGGCATGAAACCAGG + Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976199564 4:82564781-82564803 CAGGAGAATGGCATGGACCCGGG - Intergenic
976252099 4:83063498-83063520 CAGGAGAATGGTATGAAGCCAGG - Intronic
976438272 4:85043809-85043831 CTGGAAAAGGGGCTGGAGCCAGG + Intergenic
976694083 4:87899706-87899728 CAGGAGAATGGCATGAAGCCAGG + Intergenic
976776585 4:88713198-88713220 CAGAAGAATGGCATGAACCCAGG - Intergenic
977091053 4:92676270-92676292 CAGGAGAAGGGCATGAACCCGGG - Intronic
977579912 4:98713844-98713866 CTAAAGAAGGGTATAGAGCCTGG - Intergenic
977931461 4:102754647-102754669 CAGAAGAATGGCATGAACCCGGG - Intronic
977992255 4:103458591-103458613 CAGAAGAATGGCATGAACCCTGG - Intergenic
977996090 4:103498517-103498539 CAGAAGAAGGGGCTGTACCGGGG - Intergenic
978529125 4:109696876-109696898 CAGGAGAATGGCATGAAGCCAGG - Intronic
979198002 4:117942638-117942660 CAGAAGAATGGCATGAACCCGGG + Intergenic
979330198 4:119415120-119415142 GAGAATTAGGGGAGGGAGCCAGG - Intergenic
979965998 4:127077317-127077339 CAGGAAAGGGGGCTGGAGCCAGG - Intergenic
980054941 4:128070225-128070247 CAGCAGAATGGGGTGAAGCCGGG + Intronic
980551630 4:134343673-134343695 CAGGAGAAAGGGATGAACCCAGG + Intergenic
980613303 4:135185401-135185423 CATAGGCAGGGGAAGGAGCCTGG - Intergenic
980716498 4:136636540-136636562 CAGAAGAATGGGATAACGCCTGG - Intergenic
981009023 4:139905397-139905419 CAGAAGAATGGCATGAACCCGGG + Intronic
981462328 4:145028042-145028064 GAGAAAATGGGGAGGGAGCCAGG + Intronic
981700655 4:147603529-147603551 CAGGAGAATGGCATGGACCCGGG + Intergenic
981724712 4:147834855-147834877 GAGAAAATGGGGAGGGAGCCAGG - Intronic
981766000 4:148250922-148250944 AAGAAAAAGGTGATGGAGACTGG - Intronic
982076465 4:151742179-151742201 CAGAAGAATGGCATGGACCGGGG - Intronic
982299116 4:153860898-153860920 CAGGAGAATGGCATGAAGCCGGG - Intergenic
982406552 4:155026804-155026826 GAGAAGCAGGGGATAGAGCTGGG - Intergenic
982920293 4:161266273-161266295 CAGGAGAATGGCATGAAGCCAGG + Intergenic
983637493 4:169912825-169912847 CGGAAGGTGGGGAAGGAGCCAGG - Intergenic
984693676 4:182757217-182757239 CAGAAGAATGGCATGAACCCGGG + Intronic
984828531 4:183950408-183950430 CAGAAGAAGGGGACCTGGCCTGG + Intronic
985089479 4:186348673-186348695 CAGAAGCTGGGGAGGGAGCCTGG - Intergenic
985177336 4:187215569-187215591 AATAAGAAAGGGATGGAGGCCGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985342304 4:188968146-188968168 CAGAAGAATGGCATGAACCCAGG - Intergenic
985507358 5:291089-291111 CAGGAGAAGGGAAGGGACCCGGG - Intronic
985586500 5:740495-740517 CAGAAGAATGGCATGAACCCGGG + Intronic
985601088 5:832672-832694 CAGAAGAATGGCATGAACCCGGG + Intronic
985740614 5:1614046-1614068 CAGGAGAAGGGAAGGGACCCGGG + Intergenic
986704716 5:10445546-10445568 AGGAAGAAGGGGGTGGAGACAGG + Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
987026930 5:13936850-13936872 CAGCAGAAGTGGATGGAGGATGG + Intronic
987392289 5:17387318-17387340 CAGAAGAACAGGATGGGGCGGGG - Intergenic
987876028 5:23682022-23682044 CAGAAGAAGAATATGGAGGCAGG - Intergenic
987891706 5:23887403-23887425 CAGGAGAATGGGATGAACCCTGG - Intergenic
987896547 5:23953743-23953765 CAGAAGAATGGCATGAACCCCGG - Intronic
987940126 5:24523077-24523099 CAGAAAACGGGGATGGGGGCAGG + Intronic
988568303 5:32338918-32338940 CAGAAGAATGGCATGAATCCGGG - Intergenic
988718394 5:33851317-33851339 CAGGAGAATGGCATGGACCCAGG + Intronic
990047050 5:51445367-51445389 GAGAGGAAGGGGAAGGAGCTGGG + Intergenic
990127198 5:52533152-52533174 CAGGAGAATGGCATGGACCCAGG + Intergenic
990225809 5:53651863-53651885 CAGAAGAATGGCATGAACCCGGG - Intronic
990911502 5:60857186-60857208 CAGAAGAATGGCATGAACCCAGG - Intergenic
991250015 5:64549642-64549664 GAACAGAAGGGGATGGAGACAGG - Intronic
991320172 5:65364657-65364679 CAGAAGAATGGCATGAACCCAGG - Intronic
991343131 5:65634076-65634098 CAGGAGAATGGCATGAAGCCGGG - Intronic
991902324 5:71473365-71473387 CAGGAGAAGGGCATGAACCCAGG - Intronic
992310219 5:75490589-75490611 CAGGAGAAGGGCATGAACCCAGG - Intronic
992538106 5:77732456-77732478 CAGGAGAAAGGCATGGACCCGGG + Intronic
992646762 5:78818708-78818730 CAGGAGAATGGCATGGACCCAGG - Intronic
992694614 5:79273921-79273943 CAGAAGAATGGCATGAACCCGGG - Intronic
992729121 5:79640317-79640339 TAGAAGAATGGGATGGAGGGTGG + Intronic
992738743 5:79751344-79751366 TAGAAGAAGGGTATGAACCCAGG - Intronic
992775842 5:80088355-80088377 CAGAAGAATGGCGTGAAGCCAGG - Intergenic
992962069 5:81966500-81966522 CAGAAGAATGGCATGAACCCGGG - Intergenic
993224477 5:85149741-85149763 GGGAAGAAGGGAATGGAGACTGG - Intergenic
993310769 5:86329517-86329539 CAGTAGGAGGGGAGGGAGCCAGG - Intergenic
993621760 5:90177009-90177031 CAGAAGAATGGCATGAACCCAGG + Intergenic
993881068 5:93361618-93361640 CAGGAGAACGGCATGAAGCCGGG + Intergenic
994038769 5:95233419-95233441 CAGAAGAATGGCATGAACCCAGG - Intronic
994575577 5:101574942-101574964 CAGAAGAATGGGGTGAACCCGGG - Intergenic
995607127 5:113869140-113869162 CAGAAGAATGGCATGAACCCGGG - Intergenic
996102720 5:119460905-119460927 CAGAAGAAGCAGCTGAAGCCAGG + Intronic
996266349 5:121545560-121545582 CAGAAGATGGGGCTGGAGGTGGG - Intergenic
996422704 5:123279562-123279584 CAGAAGAAGGGGACAGAGAATGG - Intergenic
996728305 5:126692175-126692197 CAGGAGAATGGCATGAAGCCGGG + Intergenic
996845451 5:127894283-127894305 CAGAAGAATGGCATGAACCCGGG - Intergenic
997130380 5:131270280-131270302 CAGGAGAATGGCATGGACCCGGG + Intronic
997223877 5:132194460-132194482 CAGAAGATGAGGCTGGAGGCTGG - Intronic
997911611 5:137879615-137879637 CAGGAGAACGGCATGGACCCGGG - Intronic
998088308 5:139345136-139345158 CAGAAGAATGGCATGAACCCTGG - Intronic
998158524 5:139799781-139799803 TCGGAGAAGGGGATGGAGCTGGG + Intronic
998206364 5:140159543-140159565 GAAAAGAAGGGGATGGAGTGAGG - Intergenic
998248754 5:140534297-140534319 CAGAAGAATGGCATGAACCCGGG + Intronic
998363854 5:141615648-141615670 CAGAAGAATGGCATGAACCCGGG + Intronic
998551508 5:143081915-143081937 CAGAAGAATGGCATGAACCCGGG + Intronic
998852430 5:146364002-146364024 CAGAAGAAGGAGATGAAGGGTGG + Intergenic
999226081 5:150025921-150025943 CAGGAGAATGGCATGGACCCGGG - Intronic
999650768 5:153765248-153765270 AACAAGTAAGGGATGGAGCCAGG - Intronic
999697306 5:154198525-154198547 CAGAAGAACTGGAAGAAGCCAGG + Intronic
1000745496 5:165027779-165027801 CAGAAGAATGGCATGAACCCGGG - Intergenic
1000948515 5:167451739-167451761 CAGAAGAATGGCATGAACCCGGG - Intronic
1001228595 5:169966609-169966631 TAAAATAAGGGTATGGAGCCAGG - Intronic
1001409247 5:171498522-171498544 GACAAGAAGGGGATGGAGCTGGG - Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1001908431 5:175493158-175493180 CAGGAGAATGGCATGAAGCCAGG + Intronic
1002186233 5:177456080-177456102 CCGAACAAGGGGATGGAGACCGG - Exonic
1002201342 5:177530420-177530442 CAGGAGAGGGAGATGGAGGCAGG - Intronic
1002804000 6:554132-554154 CAGAAGAATGGGTTGAACCCAGG - Intronic
1002831293 6:823855-823877 CAGAAGAATGGCATGAACCCGGG - Intergenic
1003015307 6:2463013-2463035 CTGCAGAAGCGGAAGGAGCCCGG + Intergenic
1003249971 6:4418380-4418402 CAGAAGAATGGCATGAACCCAGG + Intergenic
1003288875 6:4761000-4761022 CAGAAGAGTGGGCTGGATCCTGG - Intronic
1003475011 6:6473464-6473486 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1003531883 6:6944083-6944105 CAGAAGAATGGCATGAACCCAGG - Intergenic
1003623059 6:7719218-7719240 CAGAAGAATGGTATGAATCCAGG + Intergenic
1003639283 6:7863089-7863111 CAGAAGAATGGCATGAACCCAGG - Intronic
1003930732 6:10921796-10921818 CAGAAGAATGGCATGAACCCAGG - Intronic
1003978917 6:11370968-11370990 ATGAGGAAGGGGACGGAGCCTGG + Intronic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004858069 6:19771488-19771510 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1004925706 6:20413262-20413284 CAGAGGATAGGGATGGAGCCTGG - Intronic
1005013684 6:21358493-21358515 CAGAAGAATGGCATGAACCCGGG + Intergenic
1005066302 6:21821051-21821073 CAGAGAAAAGGAATGGAGCCGGG - Intergenic
1005086639 6:22014140-22014162 CAGAAGAATGGCATGAACCCAGG - Intergenic
1005602384 6:27440910-27440932 CAGAAGAACGGCATGAACCCGGG + Intergenic
1005683504 6:28229948-28229970 CAGAAGAATGGCATGAACCCGGG - Intronic
1006230372 6:32581267-32581289 CAGAGGCAGGGCCTGGAGCCTGG + Intronic
1006324112 6:33340222-33340244 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1006328250 6:33370504-33370526 CAGAAGAATGGCATGAACCCAGG + Intergenic
1006841733 6:37032698-37032720 CAGGAGAATGGCATGGACCCGGG - Intergenic
1006856724 6:37138649-37138671 CAGGAGAATGGGATGAACCCGGG + Intergenic
1006870501 6:37246923-37246945 CAGAAGATGGGGAGACAGCCAGG + Intronic
1007118463 6:39361260-39361282 AAGAAGAATGGGTTGGAGGCTGG + Intronic
1007175186 6:39891518-39891540 AAGAGGAAGGGGATGGAGGTGGG + Intronic
1007397471 6:41585943-41585965 AAGAAGAAGGGGAAGAAGCTGGG - Intronic
1007418041 6:41703428-41703450 CAGGAGCAGGGGCAGGAGCCAGG - Intronic
1007418882 6:41707519-41707541 CAGGAGATGGGGATGGGGCAGGG - Intronic
1007627131 6:43252994-43253016 AGGGAAAAGGGGATGGAGCCAGG + Intronic
1007780989 6:44254646-44254668 CAGCAGAAGGGGATGGTGGGAGG + Exonic
1008164873 6:48124319-48124341 CAGAAGAATGGCATGAACCCGGG - Intergenic
1009464767 6:63955214-63955236 CAGAAGATAGGGATGAAGGCTGG - Intronic
1009727129 6:67550401-67550423 CAGAAGAATGGCATGAATCCAGG - Intergenic
1009814228 6:68710335-68710357 CAGCAGAAGAGGTGGGAGCCTGG - Intronic
1010238032 6:73591319-73591341 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1010771760 6:79839981-79840003 CAGGAGAGAGGGAGGGAGCCAGG + Intergenic
1010866038 6:80977801-80977823 CAGAAGAATGGTATGAACCCAGG + Intergenic
1010997495 6:82550472-82550494 CAGAAGAATGGCATGAACCCAGG - Intergenic
1011040229 6:83021774-83021796 CAGAAGAATGGCATGAACCCAGG + Intronic
1011352635 6:86439465-86439487 CAGAAGAATGGCATGAACCCAGG - Intergenic
1011451207 6:87494513-87494535 CAGAAGAATGGCATGAACCCAGG - Intronic
1011891320 6:92164493-92164515 CAGGAGAATGGCATGGACCCGGG - Intergenic
1012596581 6:101048299-101048321 CAGAAGAATGGCATGAACCCAGG - Intergenic
1012849538 6:104430071-104430093 CAGAAGAATGGCATGAACCCAGG + Intergenic
1013032895 6:106353190-106353212 CAGAAGAATGGCATGAACCCGGG - Intergenic
1013108912 6:107049504-107049526 CAGAAGAATGGCATGAATCCGGG - Intronic
1013120787 6:107138776-107138798 CAGAAGAATGGCATGAACCCGGG - Intergenic
1013438288 6:110135974-110135996 CAGAAGAATGGCATGAACCCGGG - Intronic
1013513879 6:110868238-110868260 CAGAAGAATGGCATGAACCCGGG - Intronic
1013649273 6:112177635-112177657 CAGAAGAAAAGGAAGGAGCGGGG - Intronic
1014097823 6:117479549-117479571 CAGAAGAAGGGCATATAACCTGG - Intronic
1014545422 6:122729682-122729704 CAGAAGAATGGCATGAACCCAGG + Intergenic
1014695504 6:124616132-124616154 CAGAAGAAGAGGATAGAGTTTGG - Intronic
1014816208 6:125938672-125938694 CAGGAGAATGGCATGAAGCCAGG - Intergenic
1014947558 6:127515948-127515970 CAGAAGAGGAGGATGGAGAAGGG + Exonic
1014952202 6:127569573-127569595 CAGGAGAAGGGCATGAACCCGGG - Intronic
1015027165 6:128548823-128548845 CAGGAGAATGGTATGGACCCGGG + Intergenic
1015073920 6:129131930-129131952 CAGAAGAACGTGATGGAGAAGGG - Intronic
1015316137 6:131818553-131818575 CAGGAGAATGGCATGGACCCAGG + Intronic
1015616225 6:135078193-135078215 CAGGAGAAGGGCATGAACCCAGG + Intronic
1015649971 6:135445961-135445983 CAGAAGAATGGCATGAACCCGGG + Intronic
1016031297 6:139341639-139341661 CAGAAGAATGGCATGAACCCAGG - Intergenic
1016036553 6:139389451-139389473 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1016528370 6:145030087-145030109 CAGAAGAATGGCGTGAAGCCTGG - Intergenic
1016613044 6:146014990-146015012 CAGAAGAGGGGGCTAGAGCTGGG + Intergenic
1016719212 6:147273857-147273879 CAGAAGAATGGCATGAACCCGGG + Intronic
1016731573 6:147433160-147433182 GAGAGGAGGAGGATGGAGCCTGG - Intergenic
1017197427 6:151716807-151716829 CAGAAAAGGGGGCTGAAGCCAGG - Intronic
1017220150 6:151956967-151956989 CAGAAGAATGGCATGAACCCAGG - Intronic
1017469418 6:154724602-154724624 CAGAAGAATGGCATGAACCCAGG + Intergenic
1017925596 6:158909287-158909309 CAGGAGAAGGGCATGAACCCAGG + Intronic
1018362611 6:163087230-163087252 GAGAAGATGAGGATGGAGACTGG + Intronic
1018405106 6:163472395-163472417 CAGAAGGAGGTGATGGAGGTGGG + Intronic
1018435375 6:163754156-163754178 CAGAAGAATGGCATGAACCCAGG - Intergenic
1018472891 6:164112220-164112242 CAGAAGAGGGGGCAGGTGCCTGG + Intergenic
1018666147 6:166140393-166140415 CAGTAGCAGGGGACAGAGCCAGG - Intergenic
1018908273 6:168087778-168087800 CGGTAGAAGGGGATGGACCTAGG - Intergenic
1018964577 6:168474444-168474466 CAGACGCAGGAGCTGGAGCCTGG - Intronic
1019008888 6:168825852-168825874 CACGAGGCGGGGATGGAGCCTGG + Intergenic
1019008934 6:168825996-168826018 CACGAGGCGGGGATGGAGCCTGG + Intergenic
1019053884 6:169206030-169206052 CAGCAGAAGGGGCTGGAGCTGGG - Intergenic
1019065885 6:169297284-169297306 CAGAAGAATGGCATGAACCCGGG + Intergenic
1019189443 6:170242979-170243001 CAGAAGAATGGCATGAACCCGGG - Intergenic
1019320522 7:413433-413455 CAGGAGAATGGGGTGAAGCCGGG - Intergenic
1019884157 7:3889598-3889620 CAGGAGAATGGCATGAAGCCGGG - Intronic
1019895893 7:3982745-3982767 CAGGAGAAGGGCATGAACCCAGG + Intronic
1020122358 7:5512150-5512172 CAGAAGAATGGCATGAACCCGGG + Intronic
1020658337 7:10953744-10953766 CAGAAGAATGGCATGAACCCGGG - Intergenic
1020971058 7:14939704-14939726 CAGGAGAATGGCATGAAGCCGGG - Intronic
1020998982 7:15303687-15303709 CAGAAGAAGGAAGTGGAGCATGG + Intronic
1021103023 7:16605773-16605795 CAGGAGAATGGCATGAAGCCAGG - Intronic
1021193609 7:17649936-17649958 CAGGAGAATGGGATGAACCCGGG + Intergenic
1021619822 7:22540412-22540434 CAGAAGAATGGCATGAACCCAGG - Intronic
1021738221 7:23659866-23659888 CAGAAGAATGGCATGAACCCGGG - Intergenic
1021764336 7:23931645-23931667 CAGAGGAAGGGGGTGAAGCAGGG + Intergenic
1021871298 7:25008806-25008828 CAGAAGAATGGCATGAACCCGGG + Intergenic
1021971103 7:25966772-25966794 AAGAAGAAAGGGATGGAGGTAGG + Intergenic
1022193957 7:28045330-28045352 CAAAAGAAGGGGAAGCTGCCAGG + Intronic
1022583360 7:31579650-31579672 CAAAAGAATAGGATTGAGCCAGG + Intronic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1023039421 7:36159594-36159616 CAGCAGAAGGGCATGGAGTTTGG - Intronic
1023421937 7:39989873-39989895 CAGAAGAACGGCATGAACCCAGG - Intronic
1023427687 7:40056419-40056441 CAGAGAAAGGGGATAAAGCCAGG - Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1023535499 7:41204417-41204439 CAGATGAAGAGACTGGAGCCAGG + Intergenic
1024108855 7:46124185-46124207 CATATGCAGAGGATGGAGCCTGG - Intergenic
1024140739 7:46460892-46460914 CAGAAGAATGGCATGAACCCGGG - Intergenic
1024275793 7:47676001-47676023 CAGAAGAATGGCATGAACCCGGG - Intergenic
1024290779 7:47802096-47802118 CAGAAGAATGGCATGAACCCGGG + Intronic
1024516390 7:50262602-50262624 AAGAAGAAGGGGAGGGAGATGGG - Intergenic
1025289054 7:57696236-57696258 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1025307478 7:57875993-57876015 CAGAAGAATGGCATGAAGCCAGG - Intergenic
1025624265 7:63205456-63205478 CTGAACATGGGGTTGGAGCCTGG + Intergenic
1025741278 7:64198416-64198438 AAGATGAAGAGAATGGAGCCAGG + Intronic
1025838213 7:65116435-65116457 CAGAAGAATGGCATGAAGCCGGG + Intergenic
1025879060 7:65516649-65516671 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1025884858 7:65579539-65579561 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1025906665 7:65792271-65792293 CACGAGAAGGTGGTGGAGCCAGG + Intergenic
1025972913 7:66344814-66344836 CAGAAGAATGGCATGAACCCAGG - Intronic
1026021760 7:66713232-66713254 CAGAAGAATGGCATGAACCCGGG - Intronic
1026167641 7:67924359-67924381 CAGAAGAATGGCATGAACCCAGG + Intergenic
1026668785 7:72368026-72368048 CAGAAGAATGGCATGAACCCGGG + Intronic
1026675699 7:72426183-72426205 CAGAAGAAGGTGAGGGGCCCAGG + Intronic
1026713855 7:72768692-72768714 CAGAAGAATGGCATGAACCCGGG + Intronic
1026759510 7:73115915-73115937 CAGAAGAATGGCATGAACCCAGG + Intergenic
1026841925 7:73674225-73674247 CAGGAGAATGGCATGGACCCAGG - Intergenic
1026951898 7:74353341-74353363 CAGAAGAATGGCATGAACCCAGG - Intronic
1026972943 7:74479056-74479078 CAGCAGCAGGGGATGGAGGACGG - Intronic
1027087900 7:75277558-75277580 CAGAAGAATGGCATGAACCCAGG - Intergenic
1027216042 7:76184698-76184720 CAGAAGAATGGCATGAACCCGGG - Intergenic
1027373496 7:77531742-77531764 CAGGAGAATGGCATGGAACCCGG + Intergenic
1027420070 7:78009971-78009993 CAGAAGAAGGGCGTGAACCCAGG + Intergenic
1027654193 7:80908727-80908749 CAGAAAAATGGGAGGGAGACAGG + Intronic
1027924633 7:84445399-84445421 CAGAAGAATGGCATGAACCCAGG + Intronic
1028673321 7:93430022-93430044 CAGAAGAATGGGGTGAACCCGGG - Intronic
1029184460 7:98728709-98728731 AAGAAGAAGGGGAGGGAGAGGGG - Intergenic
1029289591 7:99491978-99492000 CAGAAGAATGGCATGAACCCGGG + Intronic
1029299160 7:99565259-99565281 CAGGAGAATGGCATGAAGCCGGG - Intronic
1029394014 7:100294694-100294716 CAGAAGAATGGCATGAACCCAGG - Intergenic
1029461728 7:100698314-100698336 CAGAAGAATGGCATGAACCCGGG - Intergenic
1029943318 7:104504071-104504093 CAGATGAAAGGAATGGAGTCTGG - Intronic
1030046512 7:105501860-105501882 CAGAAGAATGGCATGAACCCAGG + Intronic
1030207696 7:106966820-106966842 GAGAAGCAGGGGATGGAGTGGGG + Intergenic
1030530268 7:110703936-110703958 CAGAAGAATGGCATGAACCCGGG - Intronic
1030654202 7:112148310-112148332 CAGAAGAATGGCTTAGAGCCAGG + Intronic
1031445127 7:121844669-121844691 CAGGAGAATGGCATGAAGCCAGG - Intergenic
1031563581 7:123266992-123267014 CAGGAGAAGGGCATGAACCCAGG + Intergenic
1031757856 7:125668505-125668527 CAGAGGCAGGGAATGGAGACGGG + Intergenic
1032055684 7:128682421-128682443 CAGAGGAGGAGGAGGGAGCCTGG - Intronic
1032079541 7:128851956-128851978 CAGAAGAATGGCATGAACCCGGG - Intronic
1032308555 7:130759857-130759879 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1032576168 7:133057332-133057354 CAGAAGGATGGAATGAAGCCAGG + Intronic
1033009182 7:137601176-137601198 CAGGAGAAGGGCATGAACCCAGG + Intronic
1033061925 7:138117924-138117946 CAGAAGAATGGCATGAACCCGGG + Exonic
1033138964 7:138808285-138808307 GAGGAGGAGGGGCTGGAGCCAGG - Intronic
1033165047 7:139032529-139032551 CAGAAGAATGGCATGAACCCGGG + Intronic
1033557442 7:142500981-142501003 CAGAAGATGATGATGGAGCAGGG - Intergenic
1033644161 7:143288198-143288220 CAAAAGGAGGGGAAGGAGCGGGG - Exonic
1033756389 7:144400831-144400853 CAGAAAATGAGGCTGGAGCCAGG - Intronic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1034067737 7:148152926-148152948 CAGAAGAATGGCATGAACCCGGG + Intronic
1034108548 7:148513852-148513874 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034683662 7:152950814-152950836 CAGGAGAATGGCATGGACCCGGG + Intergenic
1034798123 7:154031952-154031974 CAGGAGAATGGCATGAAGCCAGG - Intronic
1034918836 7:155062283-155062305 CAGGAGAAGGGGAGGGAGGAGGG + Intergenic
1035246673 7:157566833-157566855 CACAGGGATGGGATGGAGCCTGG - Intronic
1035579207 8:729374-729396 CAGGAGGAGGGGATGGAGCTTGG - Intronic
1035649367 8:1253327-1253349 CAGTAGCAGCCGATGGAGCCGGG - Intergenic
1036028087 8:4933185-4933207 CAGAAGAGAGGGAGGGAGCAAGG - Intronic
1036182662 8:6598439-6598461 GAGAAGAAGGGGATGGGGTGGGG + Intronic
1036289571 8:7475540-7475562 GAGAAGAATGGCATGGAGCGTGG + Intergenic
1036331904 8:7835991-7836013 GAGAAGAATGGCATGGAGCGTGG - Intergenic
1036526457 8:9539485-9539507 CAGAAGAATGGCATGAACCCGGG - Intergenic
1036652431 8:10653974-10653996 CAGCAGCTGGGGAGGGAGCCTGG + Intronic
1036729448 8:11249502-11249524 CAGAAGAATGGCATGGACCCGGG - Intergenic
1036776191 8:11614363-11614385 CAGAAGCAGCGAATGAAGCCAGG + Intergenic
1036946503 8:13099668-13099690 CTGGAGTAGAGGATGGAGCCCGG + Exonic
1037530980 8:19773172-19773194 CAGAAGAATGGCATGAACCCGGG + Intergenic
1037582592 8:20254450-20254472 CAGATGAAGAGGATGCAGGCCGG - Intronic
1037584115 8:20264806-20264828 CAGAATAAAGGGTTGGAGCCTGG - Intronic
1037796592 8:22000543-22000565 CAGAAGAATGGCATGAACCCGGG - Intronic
1037873029 8:22517603-22517625 CAGAAGAAATGGATAGAGTCTGG - Intronic
1038190978 8:25320230-25320252 CAGAAAGAGCTGATGGAGCCCGG - Intronic
1038263500 8:26018576-26018598 CAGAAGAATGGCATGAACCCGGG + Intronic
1038302680 8:26369013-26369035 CAGAAGAATGGCATGAACCCAGG + Intronic
1038518165 8:28205089-28205111 CAGAAGAATGGCATGAACCCGGG - Intergenic
1038957595 8:32484008-32484030 CAGAAGAATGGCATGAACCCAGG + Intronic
1039149062 8:34482905-34482927 CTGAAGAATGGGATGGTGGCAGG + Intergenic
1039176273 8:34810370-34810392 CAGCAGAAAGAGATGGAGGCTGG + Intergenic
1039503509 8:38034788-38034810 GGGAAGAAGGGGATGTAGGCTGG + Intronic
1040469241 8:47723520-47723542 CAGAAGAATGGCATGAACCCGGG - Intronic
1040534466 8:48296565-48296587 CAGGAGAATGGCATGGACCCAGG - Intergenic
1041110908 8:54481431-54481453 CAGAAGAATGGCGTGGACCCGGG + Intergenic
1041333835 8:56757671-56757693 CACAAAAAGGGGAAGGAGTCAGG + Intergenic
1041463851 8:58139835-58139857 CAGGAGAATGGGATGAACCCAGG + Intronic
1041830066 8:62143865-62143887 CAGAAGATGGAGATGCAGGCAGG + Intergenic
1041838355 8:62242213-62242235 CAGAAAAGGGGGCTGAAGCCAGG - Intergenic
1041854679 8:62438137-62438159 CAGAAGAGGAGTGTGGAGCCAGG - Intronic
1041933355 8:63310853-63310875 CAGAAGAATGGCATGAACCCGGG - Intergenic
1041939547 8:63371557-63371579 CAGGAGAATGGCATGAAGCCGGG - Intergenic
1042027845 8:64443106-64443128 CAGAATAAGGGGTGGGAGACAGG + Intergenic
1042063311 8:64845503-64845525 CAGAAGAATGGCATGAACCCGGG - Intergenic
1042553308 8:70013411-70013433 CAGAAGAATGGTATGAACCCGGG - Intergenic
1042606214 8:70549502-70549524 CAGAAGAATGGCATGAACCCAGG - Intergenic
1042732913 8:71956882-71956904 CAGAAGAATGGCATGAACCCAGG - Intronic
1042915760 8:73874336-73874358 CAGGAGAACGGCATGAAGCCCGG + Intronic
1043488040 8:80718376-80718398 CTGATAAAGGGGATGGAGACAGG - Intronic
1044581219 8:93828072-93828094 AACAAGAAGTGGATGCAGCCTGG - Intergenic
1044661995 8:94600636-94600658 CAGAAGAAAGCGATGAGGCCGGG + Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1044986171 8:97758100-97758122 CAGAAGAATGGCATGAACCCGGG + Intergenic
1045305596 8:100953374-100953396 CGGAAGAAGGGGAAGGAGAAAGG + Intronic
1045428384 8:102089299-102089321 CAGAAGAATGGCATGAACCCGGG + Intronic
1045552881 8:103188142-103188164 CAGAAGAAGGGGTTTGAGAGAGG - Intronic
1045857769 8:106783647-106783669 CAGAAGAATGGCATGAATCCAGG - Intergenic
1046021392 8:108669740-108669762 CAGAAGTAGTGCATGGGGCCAGG + Intronic
1046095966 8:109560887-109560909 AAGAAGAAGAAGATGCAGCCTGG + Exonic
1046560656 8:115833004-115833026 CAGGAGAATGGGATGAACCCGGG + Intergenic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1047127634 8:121980221-121980243 CAGAAGAATGGCATGAACCCGGG - Intergenic
1047222276 8:122928130-122928152 GAGATGGAGGAGATGGAGCCTGG - Intronic
1047614265 8:126550250-126550272 CAGAAGTGGAGGAGGGAGCCAGG - Intergenic
1047785100 8:128146502-128146524 GAGAAGACAGGGATAGAGCCAGG - Intergenic
1047961030 8:130011738-130011760 CAGAAGAATGGCATGAATCCGGG + Intronic
1048002226 8:130388136-130388158 CAGAAGAAGAGCATGAAGCAGGG + Intronic
1048393000 8:133985847-133985869 CAGAAGAATGGCATGAATCCAGG + Intergenic
1048472332 8:134714318-134714340 GAGAAGTGGGGGATGGAGCTAGG - Intergenic
1048477983 8:134760173-134760195 CAGAAGAATGGCATGAACCCAGG + Intergenic
1048609594 8:136007767-136007789 GAGATGAAGCTGATGGAGCCAGG - Intergenic
1049425099 8:142534422-142534444 CTGAAGATGGGGATGCCGCCTGG + Intronic
1049649337 8:143757427-143757449 CAGAAGAATGGCATGAACCCGGG - Intergenic
1049774060 8:144396649-144396671 CAGAGGAGGGGGCTGGGGCCCGG - Exonic
1049840664 8:144769156-144769178 CAGAAGAATGGCATGAACCCAGG + Intergenic
1050275331 9:3991781-3991803 CAGGAGAATGGCATGAAGCCGGG - Intronic
1050565434 9:6877291-6877313 CAGAAGAATGGCGTGAAGCCAGG - Intronic
1050603423 9:7275357-7275379 CAGAAGAAGGGAAAAGAGCTGGG - Intergenic
1052306348 9:27014120-27014142 CAGAAGAATGGCATGAACCCAGG + Intronic
1052363812 9:27589324-27589346 CCCAAGATGGGCATGGAGCCAGG + Intergenic
1052443271 9:28525961-28525983 CAGAAGAATGGCATGAACCCGGG + Intronic
1052834378 9:33239801-33239823 CAGAGAAGGGGGCTGGAGCCTGG - Intronic
1053256506 9:36620842-36620864 CAAAAGAAGGGAATGCAGCTGGG - Intronic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1053440212 9:38109800-38109822 CAGAAGAAGCGCAAGGGGCCAGG + Intergenic
1053485555 9:38452528-38452550 CAGAAGAATGGCATGAACCCAGG - Intergenic
1053555977 9:39137603-39137625 CAGAAGAATGGCATGAATCCGGG - Intronic
1053698143 9:40658336-40658358 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054309434 9:63457744-63457766 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054408228 9:64781881-64781903 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054441375 9:65265693-65265715 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1054488902 9:65755796-65755818 CAGAAAAATGGCATGAAGCCGGG + Intergenic
1055130207 9:72766322-72766344 CAGAAGAATGGCATGAACCCAGG + Intronic
1055414799 9:76070091-76070113 CAGAAGAATGGCATGAACCCAGG - Intronic
1055607428 9:77985218-77985240 CAGAAGAATGGCATGAACCCAGG + Intronic
1055731755 9:79285802-79285824 CAGGAGAATGGCATGGACCCGGG + Intergenic
1056072868 9:83006999-83007021 CAGAAGAATGGCATGAACCCAGG + Intronic
1056235939 9:84594443-84594465 ATGAAGAAAGGGATGGGGCCTGG + Intergenic
1056447337 9:86678580-86678602 CTGAAGTATGGGAGGGAGCCAGG + Intergenic
1056932004 9:90886610-90886632 CAGAAGAATGGCATGAACCCAGG + Intronic
1057169425 9:92952327-92952349 CAGGAGAATGGGGTGAAGCCAGG - Intronic
1057301174 9:93884080-93884102 CAGAAGAATGGGGTGAACCCAGG + Intergenic
1057383271 9:94587601-94587623 CAGAAGAAGGCGATTATGCCTGG + Intronic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057778145 9:98027468-98027490 CAGAAGAAGAGGAACCAGCCAGG + Intergenic
1057836523 9:98449772-98449794 CAGAAGAGGGGGATGGAGGAGGG + Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058909218 9:109505840-109505862 CAGAAGAATGGCATGAACCCGGG - Intergenic
1059128423 9:111717498-111717520 CAGGAGAATGGCATGAAGCCAGG + Intronic
1059150778 9:111947934-111947956 CAGAAAAAGGGGGAGGAGCTTGG - Intergenic
1059244812 9:112840870-112840892 CAGGAGAATGGCATGGACCCGGG - Intronic
1059432778 9:114260037-114260059 CAGAGGATCCGGATGGAGCCTGG - Intronic
1059720793 9:116958494-116958516 CAGAAGAATGGCATGAACCCGGG + Intronic
1059808067 9:117826240-117826262 CAGAAGAAGGGGAAGTAGTGGGG + Intergenic
1060251154 9:121987762-121987784 CAGGGGAGGGGGAGGGAGCCAGG - Intronic
1060360541 9:122952349-122952371 CAGAAGAATGGCATGAACCCAGG - Intronic
1060388270 9:123254366-123254388 CAGAAGAATGGCATGAACCCGGG + Intronic
1060458888 9:123828994-123829016 CAGGAGAAGGGAACGGAGCCAGG + Intronic
1060473241 9:123965980-123966002 CAGAAGAAGGGGAAAGATCTGGG - Intergenic
1060757818 9:126225743-126225765 CAGCTGAACAGGATGGAGCCTGG - Intergenic
1060859186 9:126939843-126939865 CAGAGGAAGGCCATGGACCCAGG + Intronic
1061124168 9:128663301-128663323 CAGAAGAAGAGGAAGGAGTGGGG - Intergenic
1061345151 9:130018004-130018026 CAGGAGAAGGGCATGAACCCAGG - Intronic
1061596368 9:131632219-131632241 CAGAAGAATGGCATGAACCCAGG - Intronic
1061630154 9:131867214-131867236 CAGATGAGGTGGGTGGAGCCAGG + Intronic
1061722224 9:132559250-132559272 CAGAAGAATGGCATGAACCCGGG + Intronic
1061981995 9:134110777-134110799 CAGAAGAATGGCATGAACCCAGG + Intergenic
1062333998 9:136056958-136056980 CAGATAGAGGGGATGAAGCCAGG + Intronic
1062406923 9:136401006-136401028 CAGATGGAGGGGATGGAACCAGG + Intergenic
1062465377 9:136678465-136678487 CAGCCGGCGGGGATGGAGCCAGG + Intronic
1062559839 9:137136619-137136641 CAGAAGCAGGGAAGGGACCCCGG - Intergenic
1062675182 9:137738863-137738885 GAGTAGAAGGGGCTGGAGTCTGG + Intronic
1202780506 9_KI270717v1_random:31527-31549 CAGAAAAATGGCATGAAGCCGGG - Intergenic
1203582017 Un_KI270746v1:16485-16507 CAGGAGAATGGCATGAAGCCAGG + Intergenic
1203611494 Un_KI270749v1:10724-10746 CAGGAGAATGGCATGAAGCCAGG - Intergenic
1203616043 Un_KI270749v1:65583-65605 CTGAAGAATGGCATGAAGCCGGG + Intergenic
1185460828 X:332144-332166 CAGAATAAGGGGACCCAGCCTGG - Intergenic
1186125194 X:6405760-6405782 CAAGAGAATGGCATGGAGCCGGG + Intergenic
1186315511 X:8365399-8365421 CAGGAGAATGGGATGAACCCGGG - Intergenic
1186900161 X:14045893-14045915 GAGAAAAAGGGGTTGGAGGCTGG + Intergenic
1187383023 X:18822599-18822621 CAGGAGAATGGCATGGACCCAGG - Intronic
1187503688 X:19861282-19861304 CAGAAGAATGGCATGAACCCAGG + Intronic
1187742232 X:22368408-22368430 CAAAAGAAGGGGATCGAGAAAGG - Intergenic
1187773043 X:22723615-22723637 CAGGAGAAGGGCATGAACCCAGG - Intergenic
1188310857 X:28614979-28615001 CAGAAGAATGGAGTGAAGCCGGG - Intronic
1188920695 X:35973280-35973302 CAGAAGAATGGCATGAACCCGGG - Intronic
1189122302 X:38407745-38407767 CAGAAGCAGAGGATGGAGGTGGG + Intronic
1189189843 X:39090769-39090791 CAGGAGAAGGGCATGAACCCGGG - Intergenic
1189248435 X:39581261-39581283 CAGAAGCAGGTGATGAGGCCAGG + Intergenic
1189359285 X:40337147-40337169 CAGAAGAATGGCATGAACCCGGG - Intergenic
1189960344 X:46318585-46318607 CAGAAGGAAGGGATGGAGGAAGG + Intergenic
1190215955 X:48479559-48479581 CATTAAAAGGGGATGGGGCCAGG + Intronic
1190503483 X:51102236-51102258 CAGAAGAATGGCATGAATCCCGG - Intergenic
1190508997 X:51157936-51157958 CAGAAGAATGGCGTGAAGCCAGG - Intergenic
1190549996 X:51570276-51570298 AAGAAAAAGGGGAAGGGGCCAGG - Intergenic
1190821170 X:53974171-53974193 CAGAAGAATGGCATGAACCCGGG + Intronic
1191142158 X:57126584-57126606 CCAAAGAAGAGAATGGAGCCAGG + Intergenic
1192782396 X:74307477-74307499 CAGAAGAATGGCATGAACCCGGG - Intergenic
1193079327 X:77390368-77390390 CCGAAAAAGGGGCTGAAGCCAGG + Intergenic
1193381187 X:80817951-80817973 CAGAAGAATGGGTTGAAGCCAGG + Intergenic
1193829986 X:86278706-86278728 CTGGAAAAGGGGATGAAGCCAGG + Intronic
1194012719 X:88582685-88582707 CAGAAGAATGGTGTGGACCCGGG + Intergenic
1194091401 X:89584312-89584334 CAGCCTAAGGAGATGGAGCCCGG + Intergenic
1194243564 X:91480944-91480966 CAGAAGAAGGGCATTGAGAGTGG - Intergenic
1194357257 X:92901233-92901255 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1195696878 X:107674007-107674029 CAGAGGAAGGGGAAGGGGCGGGG + Intergenic
1195888674 X:109669484-109669506 CAGGAGAATGGGATGAACCCAGG - Intronic
1197765155 X:130055424-130055446 CAGGAGAAGGGAAGGCAGCCAGG + Intronic
1197988596 X:132293598-132293620 TAGAGGAAGGGGAGGGAGACAGG + Intergenic
1198371094 X:135990076-135990098 CAGAAGAATGGCATGAACCCAGG - Intronic
1199154845 X:144535520-144535542 CAGAAGAATGGCATGAACCCGGG + Intergenic
1199434913 X:147802372-147802394 CAGAAGAATGGCATGAACCCAGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200562544 Y:4722319-4722341 CAGAAGAAGGGCATTGAGAGTGG - Intergenic
1200665587 Y:6018229-6018251 CAGAAGAATGGCATGAAGCCGGG - Intergenic
1200698124 Y:6379096-6379118 CAGAAGAATGGCATGAACCCAGG - Intergenic
1200790304 Y:7293563-7293585 CAGAAGAAAGGCATGAACCCGGG - Intergenic
1201035989 Y:9785603-9785625 CAGAAGAATGGCATGAACCCAGG + Intergenic
1201078010 Y:10200892-10200914 CAGGAGAAGAGGACGGTGCCTGG - Intergenic
1201149282 Y:11086852-11086874 CAGAAGAATGGCATGAACCCAGG - Intergenic
1201517611 Y:14835103-14835125 GAGATGAAGTGGATGGTGCCTGG + Intronic
1201726650 Y:17159318-17159340 CAGGAGAATGGCATGAAGCCGGG + Intergenic
1202039165 Y:20664802-20664824 GAGAATAAGGGAATGGAGCTGGG - Intergenic
1202093583 Y:21219995-21220017 CAGAAGAATGGCATGAACCCAGG + Intergenic