ID: 916257494

View in Genome Browser
Species Human (GRCh38)
Location 1:162804599-162804621
Sequence CAGAGCAATGGGAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 2, 1: 0, 2: 3, 3: 29, 4: 419}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916257489_916257494 -4 Left 916257489 1:162804580-162804602 CCAGCAGCTAGAGGAGAGACAGA 0: 2
1: 0
2: 6
3: 30
4: 361
Right 916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG 0: 2
1: 0
2: 3
3: 29
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916257494 Original CRISPR CAGAGCAATGGGAAGCTGGA GGG Intronic
900406097 1:2493653-2493675 CAGAGCACAGGGAGGCTGGCGGG + Intronic
900478426 1:2886960-2886982 CAGGGCACTGGGAGGCTGGGAGG - Intergenic
900828871 1:4949639-4949661 CATGGAAATGGGAAGCTGGAAGG - Intergenic
901371579 1:8802927-8802949 CAGGGCCCTGGGCAGCTGGATGG - Intronic
901393412 1:8963203-8963225 CAGAGGACTGGGAGGCTGGGAGG - Intronic
903118346 1:21196615-21196637 GAGAGCAATGGGAAGCTACTGGG - Intergenic
903768223 1:25748288-25748310 CCGAGCCCTGGGAAGCTGAAGGG + Intronic
903930520 1:26859392-26859414 CAGGACACTGGGAACCTGGAAGG - Intergenic
903950939 1:26995432-26995454 CAGAGGAATGGGAGACTGAAGGG - Intronic
904285835 1:29452806-29452828 CAGAGCACGGGGATGCAGGAGGG + Intergenic
905347879 1:37323636-37323658 CAGAGCAAAAGGAAGCTACAGGG + Intergenic
905482009 1:38268237-38268259 CAGAGGAAAGGGCATCTGGAAGG + Intergenic
906138770 1:43520641-43520663 AGGAGCAGTGGGGAGCTGGATGG + Intergenic
906216330 1:44043204-44043226 CAGAGGAAATGGGAGCTGGAGGG + Intergenic
906745131 1:48216078-48216100 AGGGGCAATGGGAAGCTGGATGG + Intergenic
907848813 1:58234602-58234624 CACAGCCCTGGAAAGCTGGAAGG + Intronic
908398685 1:63749947-63749969 CAAAGGCATGGGAACCTGGAAGG - Intergenic
908673588 1:66576304-66576326 CTCAGCAATGGGAAGCTACATGG - Intronic
909323113 1:74315462-74315484 CAGAGAATTAGTAAGCTGGATGG + Intronic
910921393 1:92351566-92351588 AAGAGCAAAGGGAAGAGGGAAGG - Intronic
911168394 1:94745398-94745420 CAGAGCAGTGGGAATGGGGATGG + Intergenic
912893234 1:113557665-113557687 CAGACCAATAGGGAGCTGAAGGG + Intronic
913077122 1:115350059-115350081 CAGAGCCATCAGCAGCTGGAGGG - Intergenic
913282217 1:117197312-117197334 GAGAGCAATGAGAAGGGGGAGGG - Intronic
913298333 1:117343978-117344000 CAGAATGATGGGAAGCTGGAGGG + Intergenic
914224362 1:145707863-145707885 CAGGGCAGAGGGAAGCAGGATGG - Intronic
915041458 1:152971425-152971447 CAAAGAACTGGGAAGCTTGAGGG - Intronic
915367563 1:155324342-155324364 CCGAGGATTGGGAGGCTGGAAGG - Intronic
915461250 1:156071826-156071848 CAGAGCTATGGAGAGCTGAAAGG + Intergenic
915952575 1:160199221-160199243 CTGAGCAAGGGGAAACAGGACGG + Intronic
916175567 1:162035385-162035407 GAGAGGAGTGGGAAGCAGGAGGG + Intergenic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916900297 1:169215109-169215131 CAGTGGAAAGGGGAGCTGGAGGG + Intronic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917327847 1:173851476-173851498 CAGACCACTGGCGAGCTGGAGGG + Intronic
917442288 1:175078722-175078744 CACAGCAAGAGGCAGCTGGAGGG - Intronic
919981749 1:202646218-202646240 CAGTGCCAGGTGAAGCTGGAAGG - Intronic
920016178 1:202911285-202911307 GTGGGCAATGGGAAGCAGGAAGG - Intronic
920401509 1:205679519-205679541 CAGAGCTCTGAGAAGCTGCACGG + Intronic
920587854 1:207185410-207185432 CAGAGCAATGGGAGAAAGGATGG - Intergenic
920683379 1:208090257-208090279 CAGGGCAATGGGGAGATGAAGGG + Intronic
921094490 1:211874742-211874764 CAGTGCAACGGCAAGCTGAAGGG + Intergenic
921296044 1:213704989-213705011 CTGAACAATCTGAAGCTGGAGGG + Intergenic
921959743 1:221022224-221022246 CAAAGCCATGGCAAGCTTGAGGG + Intergenic
922796202 1:228341004-228341026 CAGAGCACTGGGTACCTGGGTGG + Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
922851691 1:228738250-228738272 CAGAGCAGTCCTAAGCTGGAGGG + Intronic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
924657337 1:245984899-245984921 CAGAGCAAGGAGAAGTCGGATGG - Intronic
1062895746 10:1101863-1101885 CAGGACAAGGGGCAGCTGGATGG - Intronic
1063367079 10:5497252-5497274 CAGAGCAAGGGGGAGAAGGACGG - Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067720237 10:48722589-48722611 CAGTGGAATGGGAAGTTGCATGG + Intronic
1067789741 10:49278644-49278666 CATAGCACTGGGGAGCAGGAGGG + Intergenic
1068156427 10:53205441-53205463 CAGAGCAATGGAACCCTGGCCGG - Intergenic
1070343722 10:75521877-75521899 CATAGCAAAGGAAAGCTAGAAGG + Intronic
1070771837 10:79087104-79087126 ACAAGCAATGGGAAGGTGGAGGG - Intronic
1071008691 10:80912725-80912747 AAGAGCAGTGGGGACCTGGAGGG + Intergenic
1071464818 10:85929382-85929404 GAAAGCCATGGGAGGCTGGATGG - Intronic
1071477154 10:86034851-86034873 CAGATCAATGGGTTGGTGGATGG + Intronic
1071588808 10:86851711-86851733 CAGAGTAATGGAAGCCTGGAAGG + Intronic
1071938569 10:90560219-90560241 CGGAACAGTGGGAAGCTGGCTGG - Intergenic
1072317820 10:94220938-94220960 TGGAACAAGGGGAAGCTGGAGGG - Intronic
1072611782 10:97021988-97022010 CAGAGAAACGGGAAGCTGTTGGG + Intronic
1073036083 10:100565071-100565093 CAGAGAAATGGGGAGAAGGAGGG + Intergenic
1074204176 10:111267767-111267789 CACAGGAATAGGAAGCTGGCAGG + Intergenic
1074783310 10:116817980-116818002 GAGAGGAAGAGGAAGCTGGAGGG - Intergenic
1075136602 10:119791995-119792017 CAGAGCACTGGGGAGAGGGACGG + Exonic
1075481266 10:122783958-122783980 CAGAGTAATGAGAGACTGGAAGG - Intergenic
1075583773 10:123642877-123642899 CTGAGCAATGGGAAGTTCAAAGG + Intergenic
1076673899 10:132137795-132137817 CACAGTTGTGGGAAGCTGGAAGG - Intronic
1076697333 10:132253301-132253323 CCGGGCAAAAGGAAGCTGGAGGG + Intronic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077235737 11:1481219-1481241 AAGAGCACTGGAAAACTGGAAGG - Intronic
1077359443 11:2134215-2134237 CACAGCAATGCTCAGCTGGAAGG + Intronic
1078745408 11:14109156-14109178 CAGAACAATAGATAGCTGGAAGG - Intronic
1078916053 11:15779954-15779976 CAGAGTAATTTGGAGCTGGAAGG - Intergenic
1079138602 11:17792464-17792486 CAGCACAGTGGGAAGCTGGCAGG + Intronic
1080033850 11:27690287-27690309 CACAGAAATGGGCAGCAGGATGG + Intronic
1080424414 11:32143096-32143118 GAGATCAAGAGGAAGCTGGATGG - Intergenic
1080969868 11:37260011-37260033 CAGATTAATGGGAGGCTGGTTGG + Intergenic
1083342614 11:61968101-61968123 CAGATGATTGGGAAGGTGGAAGG + Intergenic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083687247 11:64383881-64383903 CAGGGTAAGGGGAGGCTGGATGG + Intergenic
1084445141 11:69199288-69199310 TAGAGCAATGGTGAGATGGAGGG - Intergenic
1085937323 11:81163868-81163890 AAGAGAAAAGGGAAGATGGATGG + Intergenic
1086058413 11:82675315-82675337 CAGAGCAAGGGAATGCAGGAAGG - Intergenic
1088435809 11:109812095-109812117 CAGAGAAATAGGAAGCAGAATGG + Intergenic
1089528932 11:119114072-119114094 CTGAGCAATGGGCACCTGGCAGG - Exonic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1089849254 11:121482231-121482253 AAGAGCAAGGGGAAACTGGAGGG + Intronic
1089919107 11:122190770-122190792 CAGAGCCATGGAAAGGTTGAAGG + Intergenic
1090135856 11:124198759-124198781 CAGAGGGAAGGGGAGCTGGAAGG - Intergenic
1090431958 11:126653679-126653701 CAGGGCAATGAGAAACGGGAGGG + Intronic
1090442524 11:126736460-126736482 CAGAGAACTGGAGAGCTGGAAGG + Intronic
1090858065 11:130628740-130628762 AAGAGCAAAGAGAAGCTTGAGGG + Intergenic
1091816418 12:3442409-3442431 CAGAGAAAAGGGGAGCTGGCTGG + Intronic
1092039403 12:5370715-5370737 CAGAGAAAAGGGCTGCTGGAGGG - Intergenic
1092830714 12:12441871-12441893 TTGAGAAATGTGAAGCTGGATGG + Intronic
1094742166 12:33302239-33302261 CAGAGGAATGAGAGGCAGGAAGG + Intergenic
1095515024 12:42996041-42996063 GAGAGAAATGGAAAACTGGAGGG + Intergenic
1095962463 12:47844232-47844254 CAGGGCAATGGGATGTTGGTGGG + Exonic
1097294725 12:57950208-57950230 AAGAGCAATGGGAAGCTCTCAGG - Intronic
1098018403 12:66130515-66130537 CAGTGCACTCGGAAGCCGGAGGG + Intronic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1100293069 12:93235786-93235808 CAGTGGGAAGGGAAGCTGGAAGG - Intergenic
1100589028 12:96007403-96007425 CAGGACAATGGTAACCTGGATGG + Intronic
1100755688 12:97748866-97748888 CAGAGCAATCGGAACCCAGAGGG + Intergenic
1101094765 12:101326709-101326731 CAAAGCTAAGGGAAGCAGGAAGG - Intronic
1102100863 12:110277740-110277762 TAGAGCATTGGGAAGTTGGCTGG + Intergenic
1102521575 12:113480350-113480372 CAGAGCGAAGGGGAGCTAGAAGG - Intergenic
1104603300 12:130168293-130168315 CATAGCAAGGGGAAGCTGCAGGG + Intergenic
1104614944 12:130259708-130259730 CAGGGCACTGGGAACCTTGAAGG - Intergenic
1106530693 13:30588509-30588531 CAGAATAATGGGAAACTGCATGG + Intronic
1113280846 13:108785879-108785901 GAGAGCAATGGAAAGCTGAAGGG - Intronic
1114740875 14:25096084-25096106 GAGAGGACTGGCAAGCTGGAGGG - Intergenic
1115105487 14:29756736-29756758 CAGAGCTATGGGAGCCTGCATGG + Intronic
1115418398 14:33163980-33164002 AGGAGCATTGGGAAGCTGGCAGG + Intronic
1115472414 14:33782238-33782260 CTGAGCAATGGAGAACTGGAGGG - Intronic
1117496668 14:56312492-56312514 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1117498318 14:56327722-56327744 CAGACCAATGAGAAGCTGCTAGG - Intergenic
1118240037 14:64047172-64047194 CAGTGGAGAGGGAAGCTGGAGGG + Intronic
1118391331 14:65298311-65298333 CACAGCCATGGGATGCTGGGTGG + Intergenic
1118599978 14:67465191-67465213 CAGAGCGAGGGGAAGCTCCACGG + Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1119729665 14:76943009-76943031 CAGAGCAGTTGGAAGGTGGGAGG - Intergenic
1120090599 14:80328322-80328344 CAGAGCACTGGAAATCTGTAGGG + Intronic
1121382242 14:93482871-93482893 AAGAGTAACGGGAAGCTAGACGG - Intronic
1121551953 14:94809661-94809683 GAGCTCAATGGGAAGCTGAAAGG - Intergenic
1121706684 14:96001704-96001726 GAGAGCAAAGAGAAGCAGGATGG + Intergenic
1121786596 14:96666180-96666202 GAGAGCAAAGGGAAGACGGAGGG - Intergenic
1122412034 14:101530510-101530532 TACAGGAATGGGAGGCTGGATGG - Intergenic
1123520944 15:21072808-21072830 CAGAGCAGCGGGAAGCAGCATGG - Intergenic
1127062817 15:55204780-55204802 CAGAGCAATGGGAATATAGCGGG + Exonic
1127794799 15:62428227-62428249 AAGAGTAATGGGAAGAGGGATGG + Intronic
1129002454 15:72346024-72346046 CATACCAAAGGGCAGCTGGAGGG + Intronic
1129158641 15:73734321-73734343 CAGAGAAATGGAAAGGGGGAAGG + Intergenic
1129393929 15:75234200-75234222 CAGAGCTGAGGGAAGCAGGAGGG + Intergenic
1129752561 15:78076494-78076516 CAGCACTTTGGGAAGCTGGATGG + Intronic
1129971442 15:79780943-79780965 CAAACCAATGGGGAGCTGAAGGG + Intergenic
1130282695 15:82532018-82532040 CAGAGAAAAGGGAAGCCTGACGG - Intergenic
1130960765 15:88657355-88657377 CTGACCTCTGGGAAGCTGGAGGG + Intergenic
1131797550 15:96034922-96034944 CAGAGCAAAGGGAACGTGCAAGG - Intergenic
1131897125 15:97045786-97045808 AATAGCAATGTGCAGCTGGAAGG + Intergenic
1132060054 15:98685191-98685213 CAGAACTTTGGGAGGCTGGAGGG - Intronic
1132394787 15:101464665-101464687 CAGGGAAATGGGAGGCTGGAGGG + Intronic
1132989663 16:2786276-2786298 CAGAGCACTGTGAAGGTGCAGGG + Intronic
1133795148 16:9040256-9040278 GAGAGCAAGATGAAGCTGGAAGG + Intergenic
1134506157 16:14808948-14808970 CAGATCAATGGAGTGCTGGAGGG + Intronic
1134574393 16:15319822-15319844 CAGATCAATGGAGTGCTGGAGGG - Intergenic
1134629724 16:15748107-15748129 CGGTGCAATGGGGTGCTGGAAGG - Exonic
1134728022 16:16436481-16436503 CAGATCAATGGAGTGCTGGAGGG + Intergenic
1134939414 16:18275345-18275367 CAGATCAATGGAGTGCTGGAGGG - Intergenic
1135008417 16:18849752-18849774 CCAAGAAATGGGAAGCTGAAAGG - Intronic
1135054988 16:19224357-19224379 CAGATGAATGGGAAAATGGATGG + Intronic
1136247457 16:28984167-28984189 CAGAGCCAGGGTGAGCTGGATGG - Intronic
1136392877 16:29976399-29976421 CAGCCCAACTGGAAGCTGGAGGG - Intronic
1137396485 16:48119077-48119099 CAGGGCCATAGGAAGCAGGAGGG - Intronic
1140205917 16:72933319-72933341 CAGAGGAGTAGGAAGGTGGAGGG + Intronic
1140836229 16:78796751-78796773 CACAGCAATGAGTGGCTGGATGG - Intronic
1140888450 16:79264778-79264800 CAGATCCATGGGAAACTGGTGGG - Intergenic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1141175900 16:81719125-81719147 CAGAGCCACCGGAAGCTGCAGGG - Intergenic
1141704682 16:85658312-85658334 CAGAGCTATGGAAGGCTGGCAGG - Intronic
1141752298 16:85967019-85967041 CAGATGAATGGGTAGATGGATGG - Intergenic
1142284779 16:89167315-89167337 CTGAGCACTGGGAAGGTGGGGGG - Intergenic
1142773143 17:2114362-2114384 CATTTCAATGGGAAACTGGAAGG - Intronic
1143477014 17:7208583-7208605 TAGAGCTCTGAGAAGCTGGAGGG - Intronic
1143771497 17:9171828-9171850 CAGAGCACTGGAAGGCTGGAAGG + Intronic
1144764736 17:17726180-17726202 CAGGGCCATCGGAAACTGGAAGG + Intronic
1144853457 17:18255612-18255634 CAGAGAAATCAGAATCTGGATGG + Intronic
1146110484 17:30084690-30084712 GAGAGAAATGTGAATCTGGAGGG - Intronic
1147583245 17:41638498-41638520 CAGGGCCCTGGGAAGGTGGAGGG - Intergenic
1148033668 17:44641411-44641433 CAGAACAATTTGAAGTTGGAAGG + Intergenic
1148443520 17:47724330-47724352 CAGGGCCATGGGCAGCTGGCTGG - Intergenic
1148471375 17:47895941-47895963 TACAGCAACAGGAAGCTGGAAGG - Intergenic
1148779025 17:50111421-50111443 CAGGGCCATGGGAGGTTGGAAGG - Exonic
1151140151 17:71983961-71983983 CAGAGCCATGGGAACCTGCCAGG + Intergenic
1151419334 17:73987050-73987072 AGGAGCAATGGAAAGTTGGAAGG + Intergenic
1151476928 17:74349385-74349407 CAGAGCAACGTGAGGCTGGCCGG - Intronic
1152218721 17:79049217-79049239 CAGAGCAGGGGAGAGCTGGAAGG + Exonic
1152313809 17:79568083-79568105 CAGAGCAATAGCCTGCTGGAAGG + Intergenic
1152733538 17:81985499-81985521 CAAAGCGATGCGAACCTGGAGGG - Exonic
1154308026 18:13244438-13244460 CAGATCAATAGGAAGGTTGATGG - Intronic
1156472271 18:37384661-37384683 CAGAGCAAAGTGAAGGTGGTAGG + Intronic
1158122387 18:54062951-54062973 GAGATCAATGGGAAGCTAGGTGG - Intergenic
1158350397 18:56559282-56559304 CAGAGCATTGGCTAGCTGGCTGG + Intergenic
1158406599 18:57165471-57165493 CAGAGTCAGGGGCAGCTGGATGG - Intergenic
1158454085 18:57591425-57591447 CAGAGCCCTGGGAAGATGGCAGG + Intergenic
1160412036 18:78681742-78681764 CAAAGCAAAGGGGACCTGGATGG + Intergenic
1160958159 19:1704612-1704634 CAGATCAATGGACAGATGGATGG + Intergenic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1163779710 19:19239922-19239944 CAGAGGAATGGGAGGGAGGAAGG - Intronic
1164938593 19:32233632-32233654 CAGAGCATTGGGAGGATGGTGGG + Intergenic
1165062798 19:33212988-33213010 CAGAGCAGCAGAAAGCTGGAAGG + Exonic
1165098451 19:33423524-33423546 CACAGGAATGGGAACCTGGTGGG + Intronic
1165469859 19:35996934-35996956 CAGACCAAAGGGAGGATGGACGG + Intergenic
1165823698 19:38693488-38693510 CAGAGCGATGGTGAGCTGGAGGG - Intronic
1166561337 19:43734205-43734227 CAGGGCAGTGGGAACTTGGAAGG + Intronic
1166853123 19:45769711-45769733 CAGAGCTTTGGGCAGATGGAGGG + Exonic
1167435070 19:49474504-49474526 CACATCAATGGGACGCGGGAGGG + Intronic
1167873859 19:52395682-52395704 CACAGCTGTGGGAGGCTGGAAGG + Intergenic
1168095157 19:54110245-54110267 CGGAGGGATGGGAAGGTGGAAGG - Intronic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926871504 2:17423069-17423091 CAAAGATATTGGAAGCTGGATGG - Intergenic
927106773 2:19834417-19834439 GAAAGAAAGGGGAAGCTGGAAGG - Intergenic
927476421 2:23417702-23417724 CAGAGAAAAGTGAGGCTGGAGGG - Intronic
927604061 2:24470516-24470538 CAGAGCCATGGGGCTCTGGAAGG + Intergenic
927630205 2:24766636-24766658 CAGAGGAGTGGGAAGAGGGATGG + Intronic
927735188 2:25514356-25514378 TAGAGCAATGGGAAAGTGGCAGG + Intronic
928403310 2:30994814-30994836 AAGAGCGATGTGGAGCTGGAAGG + Intronic
928793247 2:34984521-34984543 CTGAGCACAGGGAAGCTGCAGGG - Intergenic
929256726 2:39819139-39819161 CAGTGCAATGGGAACAAGGAGGG - Intergenic
929763484 2:44825382-44825404 CAGAGGAGTGGTAAGCTGAAGGG + Intergenic
933250629 2:80024957-80024979 CAGAGGGAAGGGGAGCTGGAAGG + Intronic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
934915095 2:98295184-98295206 CCGAGGAGTGGGCAGCTGGAGGG + Intronic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
936242658 2:110801222-110801244 GAGAGCACTGGGAAGGAGGAGGG + Intronic
937204530 2:120226976-120226998 CAGAGCAGCTGGAAGCTGGTGGG + Intergenic
937758801 2:125574650-125574672 CAGGGCCATGAGAGGCTGGAGGG - Intergenic
937773409 2:125747918-125747940 AAAAGCAATGGGAAGGTGGAAGG + Intergenic
939355446 2:141095755-141095777 AAGACCAAAGGGCAGCTGGATGG - Intronic
939732379 2:145800403-145800425 CAGTGCAAAGGGAAGATGGGGGG + Intergenic
941847101 2:170143923-170143945 AAGGGCAATGGCAAGCTGGCAGG - Intergenic
942204224 2:173603362-173603384 CAGAGCATTTGAAAGCTGGGCGG + Intergenic
942899377 2:181095759-181095781 CAGAGAAAGGGGAAGCTGTCAGG - Intergenic
943953865 2:194161848-194161870 AAGATCAAGGGGAAGCAGGAGGG - Intergenic
946359932 2:219213169-219213191 CAGAGCACTGAGAAGCAGGAAGG + Intronic
946880207 2:224170020-224170042 CTGTGCAATGGAAGGCTGGAAGG + Intergenic
947938499 2:234027570-234027592 AAGGGCAATGGGAAGAGGGAGGG - Intergenic
948241778 2:236443812-236443834 CAGAGAAAAGGGAATGTGGAAGG - Intronic
948457629 2:238114225-238114247 CAGAGCCATGGGGAGGAGGAAGG - Intronic
948619952 2:239228032-239228054 CAAAGGGATGGGAAGGTGGAAGG + Intronic
948732419 2:239975438-239975460 CAGGGAAATGGGAAGCAGCATGG + Intronic
949045171 2:241869602-241869624 CCGAGAAATGGGAAGCAGAAAGG - Intronic
1169248301 20:4041445-4041467 CCGAGGAGTGGGAGGCTGGAAGG - Intergenic
1169497559 20:6129824-6129846 CTGGGGAATGGGAGGCTGGATGG + Intergenic
1170266900 20:14477080-14477102 CAGAGAATTGGGAGGCGGGAAGG + Intronic
1171073262 20:22096377-22096399 GAGATCAATGTGAAGCTGCAAGG - Intergenic
1171213883 20:23337675-23337697 CAGAGGTATGGGGAGTTGGAGGG + Intergenic
1171795705 20:29565498-29565520 CAAAGCCATTGGTAGCTGGATGG - Intergenic
1172032427 20:31991294-31991316 CAGAGCCATGGGAAGGGGAAGGG + Intronic
1172509808 20:35492699-35492721 AAGAGCAATGGGAAACTGTTGGG + Intronic
1173059515 20:39648114-39648136 GAGACTGATGGGAAGCTGGAAGG + Intergenic
1173280298 20:41620927-41620949 GAGAGCAAGAGGAAGATGGAAGG + Intergenic
1173468042 20:43299978-43300000 CAGAGCCATGTGAAAGTGGAAGG + Intergenic
1174008328 20:47428266-47428288 CAGAGGGAAGGGAAGGTGGACGG - Intergenic
1174422030 20:50405512-50405534 CAGTGCCCTGGGAAGCTGGCCGG - Intergenic
1174708015 20:52676803-52676825 AAGCCCAATAGGAAGCTGGAGGG - Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1177076855 21:16586891-16586913 CACAGAAATGGGAAGAGGGAAGG - Intergenic
1177398871 21:20575507-20575529 GAGGGCAATGGGAACCTGAATGG - Intergenic
1178433786 21:32539481-32539503 GACAGGAATGGGGAGCTGGACGG + Intergenic
1179085228 21:38210542-38210564 CACAGCAACCAGAAGCTGGAAGG - Intronic
1179131309 21:38639680-38639702 AAGAGAAATGGGAACCAGGATGG + Intronic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1179927960 21:44548637-44548659 CAGAGCCAGGGGACGCTGGCCGG + Intronic
1180186112 21:46140162-46140184 GTGAGCAATGTGAAGGTGGACGG - Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1181169634 22:21000859-21000881 CAGCGCCGTGGGATGCTGGAAGG + Intronic
1181689635 22:24551416-24551438 AAGAGCAGTGGGAAACTGAATGG - Intronic
1181753220 22:25004548-25004570 CAGGGAAATGGGCAGATGGAGGG - Intronic
1181854452 22:25772184-25772206 CAGAGCACAGGGACTCTGGATGG - Intronic
1181906219 22:26198944-26198966 CTGGCCAATGGGAAGCTGGTGGG + Intronic
1182713014 22:32334404-32334426 CAGAGGAATTGGATGTTGGAGGG - Intergenic
1182994928 22:34803274-34803296 CAGAGCAATGGGAAGATAATCGG - Intergenic
1183664781 22:39241066-39241088 CAAAGCCAGAGGAAGCTGGATGG + Intronic
1184605808 22:45574268-45574290 CAGGGCACATGGAAGCTGGAGGG + Intronic
1184780798 22:46648398-46648420 CAGAGGGATGGGTAGATGGATGG + Intronic
1185413784 22:50698849-50698871 GAGAACAAAGGGAAACTGGAAGG - Intergenic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
949437978 3:4049889-4049911 GAGACGAATGGGGAGCTGGAAGG + Intronic
949547695 3:5086193-5086215 CAGAGCAATGGGAATGGAGAAGG + Intergenic
950421714 3:12903457-12903479 CAGAGGAATCCCAAGCTGGAAGG - Intronic
950454848 3:13086572-13086594 GAGTGCAGTGGGAAGCTGGCGGG - Intergenic
950533859 3:13568440-13568462 CAGCGCAGTGGGCAGCTGGGTGG + Intronic
950569369 3:13790678-13790700 CAACCCAATGGGAAGCAGGAGGG - Intergenic
951519749 3:23600247-23600269 CAGAGTAATGGGAAGGTGTAAGG - Intergenic
953167959 3:40482144-40482166 CAGTGCCAGGGGTAGCTGGATGG + Intronic
953237887 3:41121934-41121956 GAAAGCAATGGTAAGCTAGAGGG + Intergenic
954293122 3:49660239-49660261 CAGAGCTTTGGGAAGCAGGAGGG - Intronic
954634138 3:52062440-52062462 CAGAGCAATGGGGATCTGCTGGG + Intergenic
955316591 3:57944198-57944220 CAGAGCAGTGGGGGGCTGGAAGG - Intergenic
956765691 3:72482561-72482583 CACAGAGATGGGAAGCAGGAAGG - Intergenic
956876961 3:73473433-73473455 CAGAGGAATGGGAAGATTGTTGG + Intronic
957252956 3:77797675-77797697 CAGGGCTATTGGAGGCTGGAGGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
959179707 3:102962961-102962983 CATAGCAATGGCAAACTGGGTGG + Intergenic
959934043 3:112011703-112011725 CAGAGCCAAGGAATGCTGGAAGG - Intronic
960519483 3:118638581-118638603 CAGAGCCCTGTGGAGCTGGAAGG + Intergenic
961259982 3:125594739-125594761 GAGAGCGAAGGAAAGCTGGAGGG - Exonic
962051625 3:131821811-131821833 CAGAGGTCTGGGAAGCAGGAAGG - Intronic
962886251 3:139630626-139630648 CAGGGCACTGGCAGGCTGGAGGG + Intronic
963893512 3:150661238-150661260 AACAGAAATGGGAAGCAGGATGG + Intronic
964260397 3:154828816-154828838 TAGAGCAATGGGTGCCTGGATGG + Intergenic
964913499 3:161811247-161811269 CAGATCAAAGGGAAGCTGTTAGG - Intergenic
965627561 3:170696806-170696828 CAGAGAAAGGGGAATCTGAATGG + Intronic
965652298 3:170947150-170947172 CAGTGCAATGGCAGGCTGAAGGG - Intergenic
965900685 3:173637729-173637751 AAGACCAATGGGAAGTTGCATGG + Intronic
966592828 3:181700555-181700577 CAGAGCATGGCGAAGCTGGAAGG + Intergenic
968858761 4:3149765-3149787 CAGAGCAGTGGGAAGCTCTGTGG - Intronic
969693163 4:8718396-8718418 CAGAGGAGAGGGAAGCTGAATGG + Intergenic
972374794 4:38460255-38460277 TGGGGCATTGGGAAGCTGGATGG - Intergenic
972838203 4:42901022-42901044 CAGAACCTTGGGAAACTGGAGGG - Intronic
973697980 4:53509445-53509467 CATAGAAATGGCAAGATGGAAGG + Intronic
973968330 4:56186133-56186155 CAGAGAAATGGGAAACTGGATGG + Intronic
974817997 4:67031037-67031059 CAAAGAAATGGGAATGTGGAGGG + Intergenic
975010110 4:69340272-69340294 CAGAGTAGGGGGAAGGTGGAGGG + Intronic
975074863 4:70193311-70193333 CAGAGCAATGTGAGTCTGTATGG - Intergenic
975927133 4:79470642-79470664 CATAGAAATGGGAAGTTGAATGG - Intergenic
976050045 4:81000941-81000963 CAAAGCAATGGGAAGGTTGGGGG - Intergenic
978636439 4:110813280-110813302 CAGAGCAATTGAAAGCTGAAAGG + Intergenic
979193177 4:117888709-117888731 TAGTGCAATGTGAAGCTGGTTGG + Intergenic
979762672 4:124426324-124426346 GAGAGCAGTGTGATGCTGGAAGG - Intergenic
980334331 4:131450796-131450818 CAGAGCACTGGGAAGCTGTAGGG - Intergenic
981161296 4:141502244-141502266 CACAGAAATGTGAAGCTGAATGG + Intergenic
984842586 4:184082011-184082033 AACAGCAATGGGAAGCTGGTGGG - Intergenic
985144566 4:186881591-186881613 AGGAGCAATGGGAAGCTGCCAGG - Intergenic
985560685 5:584478-584500 TAGATAAATGGGCAGCTGGAAGG + Intergenic
985884891 5:2670153-2670175 CAGTGGAAGGGGAGGCTGGAGGG - Intergenic
986151935 5:5137697-5137719 CAGTGCAGTGGGGAGCTGAAGGG - Intergenic
986446948 5:7829747-7829769 CAGAGCAAAGGAAAGATGAATGG - Exonic
986748974 5:10768448-10768470 CAGAGAAATGGGAAGTGGTAAGG + Intergenic
987149914 5:15028283-15028305 CAGAGGAGTGGAAAGCTTGATGG - Intergenic
987732354 5:21791160-21791182 CAGAGCACTGGGAAGATGCCAGG - Intronic
987997033 5:25296155-25296177 CATAGCAATGGCAATCTGGTAGG + Intergenic
989154910 5:38335393-38335415 AAGAGTAGTGGGAAGTTGGATGG - Intronic
989741606 5:44779846-44779868 CAGAGGACTAGGAAGCTGGATGG + Intergenic
991502047 5:67286782-67286804 AACAGAAATGGGAAGCAGGAGGG + Intergenic
993835249 5:92811939-92811961 CAGATCAAAGGCAAGCTAGAAGG - Intergenic
994956604 5:106541094-106541116 ATGAGCCATGGGAAGCTGCAGGG - Intergenic
996817121 5:127586855-127586877 CTTAGCAAGGGGCAGCTGGAGGG - Intergenic
996966081 5:129307964-129307986 CAGAACAATGGGAGGCTGTTTGG - Intergenic
998749653 5:145305625-145305647 CTGACCAATGAAAAGCTGGATGG - Intergenic
999394038 5:151215177-151215199 CAGTCCAATGGCAAACTGGAAGG + Intronic
999585544 5:153085812-153085834 CACAGCTATGGAAAGCTGAAGGG + Intergenic
999585856 5:153088820-153088842 CAGAGCAAAGGGCACCAGGAAGG + Intergenic
999619510 5:153458423-153458445 CAGAGAACTGGGAAACTGGCTGG - Intergenic
1000285929 5:159826236-159826258 CTGAGAAATGGGAGACTGGAGGG - Intergenic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1001690155 5:173626862-173626884 GAGGTCAATGTGAAGCTGGAAGG + Intergenic
1002680022 5:180954514-180954536 GACAGCAGTGGGAAGCAGGATGG + Intergenic
1002892256 6:1345484-1345506 CAGTGCTTTGGGAAGCTGAAAGG + Intergenic
1003195901 6:3914402-3914424 CAGGACAACGGGAAGCTGAAGGG + Intergenic
1003380727 6:5622211-5622233 CAGAGCAATTTCAACCTGGAGGG + Intronic
1003449888 6:6220796-6220818 CTGAGCCATAGTAAGCTGGAGGG - Intronic
1004522708 6:16377444-16377466 CACAGCAATGGGAAGGATGAGGG - Intronic
1004707872 6:18141309-18141331 CAGATCAGTAGGAAGCTTGATGG - Intronic
1005340252 6:24837366-24837388 CAGCACTTTGGGAAGCTGGAGGG - Intronic
1006302336 6:33200267-33200289 CGGAGCCAGGGGAGGCTGGACGG - Exonic
1006731265 6:36237962-36237984 CACAGCAATGGAAGTCTGGATGG - Intergenic
1007698226 6:43747271-43747293 CAGAACAAAAGGAAGATGGAGGG + Intergenic
1007703021 6:43775278-43775300 GAGACCACTGGGAAGCTGGAAGG - Intronic
1010895752 6:81360727-81360749 CTGACCATTGGGAACCTGGAAGG - Intergenic
1012172886 6:96041486-96041508 CATAGAAATGGGATGTTGGAAGG - Intronic
1012627963 6:101427306-101427328 CAGAGCAATGAGAATGGGGATGG - Intronic
1014543757 6:122708196-122708218 AAGAGGAATTAGAAGCTGGAGGG + Intronic
1015619737 6:135118512-135118534 CAGTGCAGTTGGAAGCTGGTTGG - Intergenic
1016038950 6:139411990-139412012 CAGCTGAATGGGAAGCTGGAAGG + Intergenic
1016051418 6:139534326-139534348 CAGAGCCATGCAAAGCTGGAAGG + Intergenic
1017409853 6:154156527-154156549 CAGAGCATGGGGCAGCGGGAGGG + Intronic
1018704267 6:166450948-166450970 CAGAACAATGGGAAGTGTGAGGG + Intronic
1018926027 6:168207614-168207636 CAGAGCATCAGGAGGCTGGAAGG + Intergenic
1019045035 6:169139417-169139439 CGGAGCACTGGGCATCTGGAGGG - Intergenic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1021758770 7:23882629-23882651 CAGAGCAGGAGGAAGGTGGAGGG + Intergenic
1023128872 7:36982874-36982896 TAGGGCAATGTGGAGCTGGATGG - Intronic
1025248800 7:57337932-57337954 CAGGGCCCTGGGAAGCTGGCTGG + Intergenic
1026428976 7:70325102-70325124 GAGAGAAGTGGGAGGCTGGAAGG + Intronic
1027161976 7:75809397-75809419 CAGAGAATTGGAAAGCTGCATGG + Intergenic
1028154196 7:87410797-87410819 CAGAGGATAGGGAGGCTGGAAGG + Intronic
1028810097 7:95075897-95075919 CAGAGCAATGGGTAACTTGTGGG + Intronic
1031023382 7:116652543-116652565 CAGAGGAAAAGGAATCTGGAGGG + Intergenic
1031213886 7:118865791-118865813 CAGTGGAATGGGAAGCTCTAAGG - Intergenic
1031922499 7:127612332-127612354 CAGATTAATGGAAAGATGGATGG + Intronic
1032419477 7:131766242-131766264 GAGAGGAATGGGAAGCTGAGTGG - Intergenic
1033131684 7:138750689-138750711 CAGAGCGCTGGGAGGCTGGCCGG - Intronic
1034354664 7:150443123-150443145 GAGAGCACAGGGAAGCTGGGAGG + Intergenic
1035049886 7:155992574-155992596 CAGAGCTGTGGGAGGCTGCAGGG + Intergenic
1035543110 8:457518-457540 CATAGAAATGTAAAGCTGGAAGG + Intronic
1035939108 8:3875923-3875945 GAGATCAATGGGAAGCTCGGAGG + Intronic
1037101217 8:15049455-15049477 CAGAGCAAATGGAAGCTATAGGG + Intronic
1037611541 8:20480390-20480412 CAGATCAAAGGGAAGGAGGATGG + Intergenic
1037780432 8:21864754-21864776 CAGAGCAGTGGGAAGAAGGTGGG + Intergenic
1039823470 8:41154119-41154141 CAGAGCTAAGGGAAGAGGGAGGG + Intergenic
1041554104 8:59133763-59133785 CAGAGAGATGTGGAGCTGGAAGG - Intergenic
1042185810 8:66135268-66135290 CAGGGCCATGGGACACTGGAGGG + Intronic
1043262950 8:78224796-78224818 CAGAGTTATTGGAAGCTTGATGG - Intergenic
1043692605 8:83174381-83174403 CTGAGCGATGGGATGGTGGAGGG - Intergenic
1043715493 8:83480141-83480163 CAAAGAAATGGGAATTTGGAGGG + Intergenic
1043889688 8:85642540-85642562 CAGAGCGATGGGGACATGGACGG + Intergenic
1045315472 8:101040257-101040279 CAGAGCCACCAGAAGCTGGAAGG - Intergenic
1045869543 8:106909079-106909101 CAGAGCAGTGGGCAGCCAGAGGG - Intergenic
1045992673 8:108327893-108327915 AAGAGCAATGGGATTCTGAATGG - Intronic
1047254838 8:123207149-123207171 CAGAGCCAGGTGAAGCTGGAGGG - Exonic
1047344136 8:124010741-124010763 TAGAGAATTGGGAAGCTGGTGGG + Intronic
1047431699 8:124798709-124798731 CAGAGAAGAGGGAACCTGGAGGG - Intergenic
1049117791 8:140704731-140704753 CAGAGCAATGGGAAGTACGTAGG - Intronic
1049329098 8:142040307-142040329 CCGAGAAATGGCAAGCTGGAGGG - Intergenic
1049759202 8:144324299-144324321 AAGAGCAGCAGGAAGCTGGAGGG + Intronic
1051668565 9:19488235-19488257 CAGAACAAGGGGAAGCTGGTGGG - Intergenic
1051813479 9:21076849-21076871 AAGAGAAAAGGAAAGCTGGAGGG - Intergenic
1052201045 9:25780561-25780583 CAGAGCCATGGGAAGAAGTATGG + Intergenic
1053278556 9:36801476-36801498 AAGAGCAAAGAGAAGATGGAAGG + Intergenic
1053423627 9:37997017-37997039 CAGGGAAATGGGAAGCTGACAGG + Intronic
1053680860 9:40484348-40484370 CCGATCAATGGGAGGATGGAAGG - Intergenic
1053930848 9:43112662-43112684 CCGATCAATGGGAGGATGGAAGG - Intergenic
1054282853 9:63140587-63140609 CCGATCAATGGGAGGATGGAAGG + Intergenic
1054293942 9:63319863-63319885 CCGATCAATGGGAGGATGGAAGG - Intergenic
1054391967 9:64624352-64624374 CCGATCAATGGGAGGATGGAAGG - Intergenic
1054503762 9:65891976-65891998 CCGATCAATGGGAGGATGGAAGG + Intronic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1055806012 9:80094307-80094329 TAGGGCAAGAGGAAGCTGGATGG + Intergenic
1056737187 9:89219971-89219993 CAGAGCAATGAAAAGCCAGAGGG + Intergenic
1056798499 9:89675313-89675335 AAGAACAATGGGAAGCTGAAAGG - Intergenic
1058128887 9:101227065-101227087 CAGAGCCATGGGAACTTGAAGGG + Intronic
1058336629 9:103837553-103837575 CAGACTGATGGGAAGCTGGAGGG - Intergenic
1058485747 9:105442045-105442067 CAGAGCCATGGGAGGGTAGATGG + Intergenic
1058915524 9:109560834-109560856 CAGAGCACAGGCAAGCAGGAGGG - Intergenic
1060038343 9:120278347-120278369 GTGGGCAATGGGAAGCTAGAAGG + Intergenic
1060120275 9:120982347-120982369 TTGAGAAATGGGAAGCAGGAAGG - Intronic
1060736780 9:126071186-126071208 CAGAGGAAGAGGTAGCTGGAAGG - Intergenic
1060821994 9:126666462-126666484 AAGAGGAAAGGGAAGCAGGAAGG + Intronic
1060960967 9:127680409-127680431 GAGAGGAACGGGATGCTGGAGGG - Intronic
1062548793 9:137076767-137076789 CCAGGCAATGGGAAGCAGGAAGG + Intergenic
1185724420 X:2407964-2407986 CAGAGCATTGAGAATCTAGATGG + Intronic
1186066378 X:5770177-5770199 CAGAGCAAGGGGGAACTGAAAGG - Intergenic
1186968861 X:14818207-14818229 CAGAGCTATGGAAAGCAGTAGGG + Intergenic
1187232667 X:17437440-17437462 CAGAGAAATGGGTGACTGGAAGG - Intronic
1187742221 X:22368325-22368347 CAGAGAAAGGGAAAACTGGAGGG - Intergenic
1187802131 X:23075659-23075681 CTGAGCGCTGGGAAGCCGGAAGG + Intergenic
1188072041 X:25729039-25729061 CAGAAAAATAGGAAGATGGATGG - Intergenic
1188601542 X:31972146-31972168 CAGAGAGTTGGGAAGCAGGAAGG + Intronic
1189075244 X:37907484-37907506 CAGAGAAGTGGGAAGCTTAACGG - Intronic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190337424 X:49270600-49270622 CTCAGCAAAGGGCAGCTGGAAGG - Exonic
1192307090 X:69972848-69972870 CAAAGCAATAGGTAGTTGGAAGG - Intronic
1194994275 X:100575663-100575685 AAGATCAATGGGCAGCAGGAGGG - Intergenic
1195318780 X:103704333-103704355 CAAACCAAAGGGAAGATGGAGGG + Intergenic
1196283000 X:113845969-113845991 AAGAGCAGTGGGATTCTGGATGG + Intergenic
1196618585 X:117796000-117796022 AAGAGCAGTGGGAAGTGGGAAGG + Intergenic
1197033602 X:121848501-121848523 GAAAGCAATGGGAAGATGGAGGG + Intergenic
1197048497 X:122029372-122029394 GAGAGCAACAGGAAGGTGGAGGG + Intergenic
1199516465 X:148682245-148682267 CAAAGCAATGAAAAGCTGAATGG - Intronic
1199680459 X:150220905-150220927 CAGAGCCACCAGAAGCTGGAGGG - Intergenic
1200814029 Y:7513219-7513241 CAGGGGAATGGTAAGCGGGATGG + Intergenic
1201306049 Y:12551536-12551558 CAGAGCTGAGGGAAGCTGAAAGG + Intergenic