ID: 916258505

View in Genome Browser
Species Human (GRCh38)
Location 1:162815721-162815743
Sequence AATATCTTCCAGAATATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916258505_916258507 14 Left 916258505 1:162815721-162815743 CCTTCTATATTCTGGAAGATATT No data
Right 916258507 1:162815758-162815780 TTAATTCTTCTTTAAATATTTGG 0: 43
1: 326
2: 1036
3: 1639
4: 4543

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916258505 Original CRISPR AATATCTTCCAGAATATAGA AGG (reversed) Intergenic
No off target data available for this crispr