ID: 916261651

View in Genome Browser
Species Human (GRCh38)
Location 1:162848287-162848309
Sequence TAGGATTAAATGGCAAAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 255}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916261651 Original CRISPR TAGGATTAAATGGCAAAGTA TGG Intronic
902305251 1:15532815-15532837 AAGGATTAAATGGTTAAGGAAGG + Intronic
905960404 1:42037793-42037815 TAAGATCAAATGACAAAGAACGG - Intergenic
906022242 1:42640278-42640300 TAGGATAAAATGGGAAAGTCTGG - Intronic
906378826 1:45318491-45318513 TAGGTTTTAATGGGATAGTAAGG - Intergenic
907614642 1:55911942-55911964 TAGTATTCAATAGCACAGTAGGG + Intergenic
908078223 1:60544271-60544293 TAGGAAATAATGGGAAAGTAAGG - Intergenic
910474527 1:87592488-87592510 TAAGATTAAATGGCAGCATATGG + Intergenic
911415380 1:97565419-97565441 AAGGATTATATGCTAAAGTAGGG - Intronic
913302528 1:117387580-117387602 TAGTAGTAAATGCAAAAGTATGG + Intronic
915688365 1:157660544-157660566 TAGTATTCAATAGCAAAGTGGGG - Intergenic
916261651 1:162848287-162848309 TAGGATTAAATGGCAAAGTATGG + Intronic
919717593 1:200795532-200795554 TAGCTTCAAATGGCAAATTAAGG - Intronic
921789487 1:219273522-219273544 TAGAATTAAATGGCTAATGACGG + Intergenic
921950892 1:220928737-220928759 TCCCATTCAATGGCAAAGTATGG + Intergenic
922035528 1:221844373-221844395 TAGGATTATATGGTTCAGTAAGG + Intergenic
924362633 1:243256543-243256565 TTGGATTAAATAGCAACGTATGG - Intronic
1062850884 10:742123-742145 TTGGCTGAAATGGCAAACTAAGG - Intergenic
1063725035 10:8627602-8627624 TCTGATTAAATGGGGAAGTATGG - Intergenic
1063909658 10:10816725-10816747 GAGAATTTAATGGCAAAGCAAGG - Intergenic
1064458792 10:15513195-15513217 TGGGAAGAAATGGAAAAGTACGG + Intergenic
1064674154 10:17744860-17744882 CAGCATTAAAGAGCAAAGTAAGG + Intergenic
1065106158 10:22388271-22388293 GAGGAACACATGGCAAAGTATGG - Intronic
1065387835 10:25151061-25151083 TAGTATTCAATAGCACAGTAAGG - Intergenic
1067403860 10:46002658-46002680 TAGGAACAAATTGGAAAGTAGGG + Intronic
1067958508 10:50820546-50820568 AAGCTTTAAATGGCAAGGTAAGG - Exonic
1070511155 10:77162021-77162043 TAGGAAAAAAAGGCAAAGGAAGG - Intronic
1072169329 10:92845040-92845062 TAAAAGTAATTGGCAAAGTAAGG - Intronic
1072880874 10:99227918-99227940 TAAAATTAAATGGCAAAACAAGG + Intronic
1073634397 10:105182647-105182669 AATGATTAAATGGTAAGGTATGG + Intronic
1074237995 10:111605589-111605611 AAGGACTAAATGACATAGTAGGG + Intergenic
1075432518 10:122400295-122400317 TAGGATTATATGGAGAAGTGAGG + Intronic
1077822512 11:5762841-5762863 TAGTAGAAAATGACAAAGTATGG - Intronic
1079794225 11:24779037-24779059 TATTTTTAAATGTCAAAGTATGG + Intronic
1080096529 11:28415099-28415121 TATGATTAAATCCCAGAGTAGGG + Intergenic
1080509118 11:32949700-32949722 TAGGATAAAATAACATAGTATGG + Intronic
1080833685 11:35919927-35919949 CAGAAGTAAATTGCAAAGTAAGG + Intergenic
1085072000 11:73555404-73555426 TAAGAGAAAATGCCAAAGTAAGG + Intronic
1085764636 11:79272050-79272072 TAAGAGTAAATGGCAAAATAGGG + Intronic
1086434590 11:86769008-86769030 TAGGAAAAAATTGCAAAGTAAGG - Intergenic
1086837589 11:91644473-91644495 CAGGATAAAACTGCAAAGTAAGG - Intergenic
1087684092 11:101244269-101244291 AAGAATTAAATGGCAAAGAGAGG + Intergenic
1090494757 11:127199779-127199801 TTGGATTTAATGGCATATTATGG + Intergenic
1090687636 11:129141095-129141117 TATGTTTAAATGGAAAAGCAAGG + Intronic
1095809229 12:46354400-46354422 GAGGATTAGATAGCAAAGGAGGG - Intergenic
1097702620 12:62835531-62835553 CAACATGAAATGGCAAAGTAAGG - Intronic
1099835973 12:87910165-87910187 TAGGTTTTAATGGGATAGTAAGG + Intergenic
1099916381 12:88899462-88899484 TGGGATTAAATTGGAAATTATGG + Intergenic
1099992152 12:89735135-89735157 TAGAATAAAAAGGCAAAGGAAGG - Intergenic
1100187045 12:92149937-92149959 GAGAATTAAATGGGAAAGCATGG - Intergenic
1102242032 12:111330410-111330432 CAGCAATAAATGGCAAAGTCAGG - Intronic
1103639930 12:122342321-122342343 TAGGACAAACTGGCAAAATAAGG - Intronic
1105601072 13:21887462-21887484 TAAGATTAAATTGGAAAGCAAGG + Intergenic
1106863915 13:33942476-33942498 TAGCATTAAATTAAAAAGTATGG - Intronic
1107086037 13:36429096-36429118 TAGGATTAATTTTCAAAATAAGG - Intergenic
1108709769 13:53021170-53021192 TAGAATTGAATGACAAAGCAAGG - Intergenic
1109658690 13:65429611-65429633 TAGGATTAAATAACAAATTAAGG - Intergenic
1110494240 13:76147696-76147718 TAGTGTTCAATGGCACAGTAGGG + Intergenic
1111578822 13:90195949-90195971 TAGGAAAAAATTGCAAAGCATGG - Intergenic
1112080665 13:95966477-95966499 TACTATTCAATAGCAAAGTAGGG + Intronic
1112161972 13:96877627-96877649 TAGAATGAAATGGCAGAGGAAGG - Intergenic
1112670849 13:101636356-101636378 TATGATTAAATGATAAATTAAGG - Intronic
1112842361 13:103596175-103596197 TAAGCTTAAAGGGAAAAGTAAGG - Intergenic
1113883392 13:113642325-113642347 TACCAAGAAATGGCAAAGTATGG + Intergenic
1114206294 14:20574368-20574390 TAGCATTCAATAGCATAGTAGGG + Intergenic
1114696865 14:24633830-24633852 TAGAAGTAAATGGCAGAGGATGG - Intronic
1115691971 14:35853726-35853748 TAGCATTAAATATCAAAATATGG - Intronic
1115704599 14:35986262-35986284 AAGGATTAAATGGAACAGTGTGG + Intergenic
1115965741 14:38885418-38885440 TATGAATAAGTGGCAAGGTATGG + Intergenic
1116972818 14:51084992-51085014 GAGGAGTAAATGGCAATATAGGG - Intronic
1117018276 14:51541500-51541522 TAGGATTCAATGGCGGGGTAGGG + Intronic
1118036575 14:61874889-61874911 TAAAATTAAAAGGAAAAGTAGGG + Intergenic
1118083010 14:62383345-62383367 TAGGTTCAAATGGCACAGTAAGG + Intergenic
1118414515 14:65520228-65520250 CATAATTAAATGGCAAAGAACGG + Intronic
1119129627 14:72159525-72159547 TAGCATCAAATGGCCAAGAAGGG - Intronic
1120199543 14:81521766-81521788 TAGGAGTACATGCTAAAGTAAGG - Intronic
1120572537 14:86139333-86139355 TAGTGTTCAATAGCAAAGTAGGG + Intergenic
1120699581 14:87684166-87684188 TAGGACAAAAAGGCAAAGGAAGG - Intergenic
1120732090 14:88015268-88015290 TAAGATTATATGGGAAAGTAAGG + Intergenic
1122105506 14:99451152-99451174 TAGAAATAAGTGGAAAAGTAGGG - Intronic
1122192328 14:100055403-100055425 TAGGAATAAATAGCAGGGTATGG - Intronic
1122507755 14:102242550-102242572 TAGGTTTTAATGGGATAGTAAGG - Intronic
1125499791 15:40232484-40232506 GAGGAGTTAATGGCAAAGTGAGG - Intergenic
1126200221 15:45977066-45977088 CATGATGAAATGGCAAAGTTGGG + Intergenic
1134856160 16:17521320-17521342 ATGGAGTAAATGGAAAAGTAGGG - Intergenic
1135706056 16:24676007-24676029 TAGGGCTAAATGGAAAAGGAAGG + Intergenic
1135995556 16:27245055-27245077 TGGGATTAGATGGCAAGTTAAGG + Intronic
1138973491 16:62174414-62174436 TAGGATGAAAAGGCAAAGGAAGG + Intergenic
1140896699 16:79331098-79331120 TAGGAATAAATGGGAAACTGAGG - Intergenic
1144449372 17:15363353-15363375 TAGTATTTGATGGCACAGTAGGG + Intergenic
1145338143 17:21930479-21930501 TAGAATGAAATGGCATAGAATGG + Intergenic
1146068396 17:29656610-29656632 TAGGGATAAATGGCAAACTTTGG + Intronic
1147003354 17:37381490-37381512 TATTATTAAATGGAAAAGCAAGG - Intronic
1147196971 17:38773480-38773502 TAGGATTTCAAGACAAAGTATGG + Intronic
1149205252 17:54236825-54236847 TTGGATTAAATGGCATTGAAGGG - Intergenic
1150041887 17:61871525-61871547 TAAGATCAAATGTCAAATTATGG - Intronic
1150065767 17:62107952-62107974 TAGGTGTAAAAGGCAAAATAGGG + Intergenic
1150608265 17:66712849-66712871 GAGGATTAAATGAGTAAGTATGG + Intronic
1151022765 17:70638060-70638082 TAAGATTAAATGGATAGGTATGG - Intergenic
1151788648 17:76289634-76289656 TAGCATTAAAAGACAAAGTGGGG + Intronic
1203193840 17_KI270729v1_random:213658-213680 TGGAATTAAATGGCATCGTATGG + Intergenic
1203203204 17_KI270730v1_random:13088-13110 TGGAATTAAATGGCATCGTATGG + Intergenic
1153612993 18:6906825-6906847 TAGGATGAAAAGACAAACTAAGG + Intronic
1156123477 18:33874190-33874212 AAGGATTAAAGGGAAAAGTGTGG + Intronic
1156176400 18:34552201-34552223 AAAGATTAAAAGGCAAAGTTGGG - Intronic
1156441630 18:37195167-37195189 TAGTATTCAATAGCACAGTAGGG - Intronic
1156962833 18:43053481-43053503 GAGGATTAAATGGGATGGTAAGG + Intronic
1156972954 18:43179613-43179635 TAGTATTCAATAGCACAGTAGGG + Intergenic
1158732605 18:60040992-60041014 TAAGAATAAATGGAAAAGTTTGG - Intergenic
1159168085 18:64726665-64726687 TGGGATTGAATGGCTAGGTAAGG + Intergenic
1159178370 18:64868380-64868402 TAGGATTTAATAGCACAGTAAGG - Intergenic
1159794823 18:72829192-72829214 TAGGATTAAATGGTAGTGCAAGG + Intronic
1159932474 18:74327920-74327942 AAATATTAAATGGCAAAATATGG - Intronic
1161094435 19:2381520-2381542 TAAGAGTAAATGGGAAAGTGTGG + Intergenic
1163174612 19:15555712-15555734 GAGGATTAAATGGGAATATATGG - Intergenic
926591766 2:14748154-14748176 CAGGATTAAATGGAAAAATATGG - Intergenic
926664392 2:15504511-15504533 TAGGATAAAATGGCAACCTTGGG - Intronic
927349925 2:22098208-22098230 TAGAATTAAAAGGCATAGGAAGG + Intergenic
927717883 2:25364285-25364307 TAGGGTTCAATGGAAAAGCATGG - Intergenic
927971759 2:27310047-27310069 GAGCATGAAATGGCAAAGGAGGG + Intronic
928057797 2:28075477-28075499 TAAGGTTAAATTTCAAAGTATGG + Intronic
928549804 2:32358675-32358697 TAAGAGTAAATGGCAATTTAGGG + Intronic
929924170 2:46195577-46195599 TGGGATCAAATGCCAAAGAAGGG - Intergenic
930477705 2:51904280-51904302 TACCAATAAATGGGAAAGTATGG + Intergenic
931523185 2:63122272-63122294 AAGCATTAAAAGGCAAAGAAAGG + Intronic
931803187 2:65778538-65778560 TAGAATTGAATGGGAAAGAATGG - Intergenic
933408740 2:81897462-81897484 TAGGATTCAGTGTGAAAGTACGG - Intergenic
936056421 2:109265227-109265249 TAGGATTAAAGGGCCAAGGCAGG + Intronic
937335023 2:121057215-121057237 TAGGATGAAATGACAAAGCCTGG - Intergenic
941064756 2:160889529-160889551 TAGTATAAAAAGGCAAGGTAAGG + Intergenic
942009748 2:171748819-171748841 TAGATTTTAATGCCAAAGTATGG - Intergenic
942059230 2:172212629-172212651 AAGGAGTAAATAGCAAGGTATGG + Intergenic
943348185 2:186766003-186766025 CTAGATTAAATGGCAATGTAGGG - Intergenic
944529355 2:200652072-200652094 TAGGAACAAATGGCAGGGTAGGG + Intronic
945765177 2:213967659-213967681 GATTATTAAATAGCAAAGTAAGG + Intronic
946289603 2:218734224-218734246 TAGGATTAAATGAGATAATATGG + Intronic
946937702 2:224738564-224738586 TAGAAAAAAATGGCAAAGGAAGG - Intergenic
947085725 2:226450034-226450056 TACGATTATTTGGCAAAATAAGG - Intergenic
1169874631 20:10283456-10283478 TAGGCTTTAGTGGCAAAGTCAGG - Intronic
1170003399 20:11639806-11639828 TAGTATTCAATAGCAGAGTAGGG + Intergenic
1170296144 20:14828422-14828444 TAGGGTTAACTGGGACAGTATGG + Intronic
1171334088 20:24367908-24367930 TAGAATTAAAGGCAAAAGTAAGG + Intergenic
1172462617 20:35131622-35131644 TAGGTAAAAATGGCAGAGTAAGG - Exonic
1173184152 20:40827743-40827765 TAGGATTAAATGCGATAATATGG - Intergenic
1173280645 20:41623980-41624002 TGGGATAAAATGACTAAGTAAGG + Intergenic
1174718212 20:52783283-52783305 TAGGAGTGAGTGGAAAAGTATGG - Intergenic
1174825975 20:53768990-53769012 TGGGATTAAAAGACATAGTAAGG - Intergenic
1176757241 21:10734587-10734609 TGGAATCAAATGGCAAAGAATGG - Intergenic
1176929654 21:14792935-14792957 TAGGATTTTATGGCAGAGTTGGG - Intergenic
1177204024 21:17990881-17990903 TAGTATTCAATAGCACAGTAGGG - Intronic
1177453911 21:21309650-21309672 CAGGACTTAATGGCAAAGTGAGG - Intronic
1177509166 21:22060944-22060966 TAGTGTTCAATGGCACAGTAGGG + Intergenic
1177765441 21:25451701-25451723 TAAGATTAAATGGGACTGTAAGG - Intergenic
1182860487 22:33555459-33555481 TAGGATTCAATGGGACAGTCAGG + Intronic
949523139 3:4875518-4875540 TTGGATTAAATGCCAAAGAATGG + Intronic
949655764 3:6217093-6217115 TATGCTAAAATGGCAAAATATGG - Intergenic
951444988 3:22768271-22768293 TAGTAGTAGATGGCAAAGGAAGG + Intergenic
951612303 3:24504120-24504142 TTGGATAAAATGGTAAGGTAAGG - Intergenic
953831649 3:46302741-46302763 GAAGAGTAAATGGCAAACTATGG + Intergenic
953985354 3:47437871-47437893 TAGGATGAAATGGCTGGGTATGG + Intronic
954406264 3:50346784-50346806 CTGGATTAAATGGCCAAGAAAGG - Exonic
957302393 3:78409394-78409416 TAGAATTGAATGGCAATGTATGG + Intergenic
958987711 3:100801748-100801770 TAGGAAAAAATGGCAAAATGTGG + Intronic
959027419 3:101256476-101256498 TAGATTTAAAAGGCAAGGTAGGG - Intronic
959095553 3:101951503-101951525 TGGAATTAAATGGCAAGGAATGG - Intergenic
959831141 3:110864036-110864058 TAGCACAAAAAGGCAAAGTAAGG - Intergenic
962134078 3:132714780-132714802 TAGTTTTAAATGTCAAACTAAGG - Intronic
962332893 3:134495652-134495674 TAGTGTTAAATAGCACAGTAAGG - Intronic
962351067 3:134656128-134656150 TAGGATGAAATGAAAGAGTAAGG + Intronic
962376580 3:134863370-134863392 TAGGATTAACTGGCCAGGTGTGG + Intronic
963859724 3:150296510-150296532 TAGGATTGAATAGCAATGAAAGG - Intergenic
964048677 3:152363731-152363753 AAGAATTAAATGCCTAAGTACGG + Intronic
965967666 3:174514203-174514225 TAAAATTAAAGGGCAAAATATGG - Intronic
966432440 3:179846404-179846426 TAGTGTTGAATGGCACAGTAGGG - Intronic
967586570 3:191221392-191221414 TAGGATAATATGGGAAAGTTTGG + Intronic
970193660 4:13536705-13536727 AAGGAAGAAATGCCAAAGTACGG - Intergenic
970307179 4:14744929-14744951 TAGTATTAAATGTCAGACTAAGG - Intergenic
970675254 4:18441623-18441645 TAGCAGTAAATAGCAAATTAAGG - Intergenic
971296956 4:25402861-25402883 TAGGATAAAATAGAACAGTAAGG + Intronic
972441955 4:39103040-39103062 AAGGATTAACTGTCAAAGGAGGG - Intronic
973166980 4:47090407-47090429 TAGGATAAAAGGGGAAAGTGAGG + Intronic
973296649 4:48530272-48530294 TGGGATTTAATGGGAAAGTGGGG - Intronic
976018021 4:80583568-80583590 TAGGACTAAAAGGCAGACTATGG - Intronic
977664585 4:99631222-99631244 TAGGATTACATGTAAAAGTGTGG + Intergenic
978975046 4:114859056-114859078 TAACTGTAAATGGCAAAGTATGG + Intronic
979040336 4:115783276-115783298 TATGAATGAATGGCAAAGTAGGG + Intergenic
979202612 4:117996481-117996503 TATGATAAAATGGCATAGTATGG + Intergenic
979824759 4:125219269-125219291 TTGGAGTAACTAGCAAAGTATGG - Intergenic
980097997 4:128512820-128512842 TAGGATTAAATGGATAATAAAGG - Intergenic
982560978 4:156927730-156927752 TAGGAAAATATGGCAAAGTTTGG - Intronic
982988541 4:162241654-162241676 TAGGTTTAGATGGAAAATTAAGG + Intergenic
983059726 4:163144175-163144197 TAGGATTAAAGGGCAAAGGTAGG + Intronic
983080238 4:163376092-163376114 TAGTATAAAATTGCAAAATAAGG - Intergenic
983518039 4:168677811-168677833 CAGGATTAACTGGCGGAGTAGGG - Intronic
986855375 5:11862572-11862594 TAGGATTATAGGGCAAGGCATGG - Intronic
987730524 5:21765276-21765298 TAGAATTCAATACCAAAGTAAGG + Intronic
988414959 5:30934767-30934789 AAGCATTAAGTGGCAAAGTGGGG + Intergenic
988835350 5:35026913-35026935 TCAGATTAAATGGCAATGAAAGG - Intronic
989557258 5:42812123-42812145 TAGGATTTAATGGTACAGTCGGG + Intronic
992382686 5:76254354-76254376 AAGGAATAGATGGAAAAGTAGGG - Intronic
993769820 5:91913318-91913340 AAGTCTTAAATGGCAGAGTAAGG - Intergenic
995555169 5:113320497-113320519 CAGTATTAACTGGCAAAGCAGGG + Intronic
996385274 5:122904006-122904028 TACGGTTAAATGGCACAGTAGGG + Intronic
996628146 5:125595505-125595527 TTGGATTAAACTGCAAAGTAAGG - Intergenic
997370325 5:133355755-133355777 TAGGTTTTAATGGCCAAGAAGGG + Intronic
997636937 5:135417446-135417468 TAGTATGTCATGGCAAAGTAAGG - Intergenic
998223959 5:140311903-140311925 TAGGCGTATATGGCAAAGAAGGG + Intergenic
998969265 5:147573933-147573955 TAGAATAAAATGGCAAAATCAGG + Intergenic
1000136704 5:158360377-158360399 TTGCATTTAATGGCAAAGGATGG - Intergenic
1000419453 5:161021641-161021663 TAGGTTTAAATGGCGTAATATGG + Intergenic
1000828315 5:166073608-166073630 GAGGATTAAATAGGATAGTATGG + Intergenic
1003731090 6:8825455-8825477 TAGGTGTAAATGGCATATTATGG + Intergenic
1003802116 6:9681660-9681682 TAGGATTCAAAGGCAACCTATGG - Intronic
1006646454 6:35517976-35517998 TAAGATTAAAAGGCAAAATATGG - Intergenic
1007068533 6:39017448-39017470 TAACATCAAATGGCAAAGCATGG - Intronic
1008447902 6:51614460-51614482 GAGGAATAAAAGGAAAAGTAAGG - Intergenic
1009576265 6:65465527-65465549 TAGAATGAAATGGAAAAGAAGGG + Intronic
1013962898 6:115922204-115922226 TAGGAATAAAATGCAAAGAATGG + Intergenic
1014515304 6:122370449-122370471 TAGGATTTGATAGCACAGTAAGG + Intergenic
1014558451 6:122862003-122862025 AAGGAGTAAATGGCAGAGTCTGG - Intergenic
1014587207 6:123213550-123213572 TAGGAGTGAATGGGAAAGTGAGG + Intergenic
1015564027 6:134547419-134547441 CAGGAGTAAATGTCAAAGAACGG + Intergenic
1015909960 6:138160909-138160931 TAGGATTTAATGACACAATAGGG - Intergenic
1016107167 6:140177235-140177257 TAGGTTTTAATGGCAAATAAAGG + Intergenic
1017200668 6:151751125-151751147 TAGGATCATATGGCAAAGTCAGG - Intronic
1017786380 6:157760439-157760461 AAGGTTCAAATCGCAAAGTAGGG + Intronic
1018479769 6:164178720-164178742 TAGGAGGAAATGGTAAAGGAGGG + Intergenic
1021406741 7:20276576-20276598 TAGTATTAAATAACACAGTATGG + Intergenic
1022260136 7:28695864-28695886 TGGGATTAAAGTGCAAAGTGGGG - Intronic
1024245344 7:47465562-47465584 TAGCTTTAAATGGCACAGTTGGG - Intronic
1024766148 7:52662619-52662641 TAGGTTTCAATGCAAAAGTAGGG - Intergenic
1026408801 7:70097545-70097567 TAGAAATAAGTGACAAAGTAGGG - Intronic
1030726978 7:112938521-112938543 TAGGATTAGAAGGAAAATTATGG - Intronic
1030831264 7:114224981-114225003 TTAGATTTAATAGCAAAGTAAGG - Intronic
1031880974 7:127198264-127198286 TAGTATTCAATAGCACAGTAAGG - Intronic
1032152086 7:129437732-129437754 TTGGATTAAAAGGAACAGTAGGG - Intronic
1032514048 7:132493880-132493902 CAGGATTAAGTGGCAGAGTTGGG - Intronic
1032905739 7:136362625-136362647 TGGGGTAGAATGGCAAAGTATGG + Intergenic
1033886164 7:145948959-145948981 TAGCATTCAATAGCACAGTAAGG + Intergenic
1033931457 7:146528139-146528161 AAGGAGTAAATGAAAAAGTAGGG + Intronic
1035988179 8:4457590-4457612 TATGATTAAGTAGCAATGTAGGG - Intronic
1036122870 8:6037071-6037093 TGTGATTTAATGGCAATGTAAGG - Intergenic
1038267427 8:26047571-26047593 TGGGGTTAAAGGGCAAAGTCAGG + Intergenic
1038946442 8:32366261-32366283 TAGTATTCAATAGCACAGTAGGG - Intronic
1039041875 8:33416186-33416208 CAGAATAAAATGGCAAAGTATGG + Intronic
1039088044 8:33799447-33799469 TAGGATTGAGTGGGAAAGAAGGG + Intergenic
1039638192 8:39189679-39189701 TAGTGTTCAATAGCAAAGTAGGG - Intronic
1039655251 8:39397645-39397667 TAGGATAAAATGAAAAACTATGG - Intergenic
1039874884 8:41577255-41577277 TAAGAATAAAGGGCAGAGTATGG - Intronic
1040064847 8:43137530-43137552 TAGAATTGAATGACAAATTATGG - Intergenic
1040738510 8:50541730-50541752 TAGTATTAAATAGCTTAGTAAGG - Intronic
1040795194 8:51282904-51282926 TAAGATTAAATGACAAACTTTGG + Intergenic
1040896961 8:52378172-52378194 TAGTATTTAGTAGCAAAGTAGGG + Intronic
1041434485 8:57822664-57822686 TAGCATTTAATAGCACAGTAGGG + Intergenic
1041908293 8:63058109-63058131 TCTGATTAAGTGGCAAACTATGG + Intronic
1043094428 8:75948495-75948517 TAGGACAAAATGGCAAAGAGAGG + Intergenic
1045800011 8:106091316-106091338 TAGTATTCAATAGCACAGTAGGG + Intergenic
1045828234 8:106426747-106426769 TAGGATTAAATGAAAGTGTATGG + Intronic
1047806181 8:128362578-128362600 TAGGATAAAAAGACTAAGTATGG - Intergenic
1047861836 8:128975799-128975821 TAGGATTTAATGGCCAAATGTGG - Intergenic
1048106391 8:131415013-131415035 TAGGATAAAATGGCAGAGGAAGG - Intergenic
1050431487 9:5566760-5566782 GAAGTTTAAATGGCAACGTAGGG - Intronic
1051516954 9:17940404-17940426 TTGAATTCAATGGCCAAGTAGGG + Intergenic
1052771721 9:32696467-32696489 CAGGATTACAGAGCAAAGTAAGG - Intergenic
1057542986 9:95993216-95993238 AAAGAGTAAGTGGCAAAGTAGGG + Intronic
1059307599 9:113367039-113367061 AAGGAATATAGGGCAAAGTAGGG - Intronic
1059900015 9:118913700-118913722 TAGTGTTCAATAGCAAAGTAGGG - Intergenic
1060298227 9:122357372-122357394 TAGCAGTAAATGGCAAAGTCAGG + Intergenic
1060911435 9:127354246-127354268 GGAGATTAAATGGAAAAGTAAGG - Intronic
1203342572 Un_KI270442v1:3566-3588 TAGAATCAAATGGAAAAGAATGG + Intergenic
1186975487 X:14898198-14898220 CATGATGAAATGGCAAATTATGG + Intronic
1188360669 X:29249011-29249033 TATCATTAAATGAAAAAGTAGGG + Intronic
1188994475 X:36866376-36866398 GAAGAAAAAATGGCAAAGTAAGG + Intergenic
1189493678 X:41490234-41490256 TAGGATGAAAAGACAAGGTATGG + Intergenic
1191756703 X:64600990-64601012 TAAGATTACATTGCACAGTAGGG - Intergenic
1192594526 X:72392667-72392689 TACTATTAAATGCCAAAGTTTGG - Intronic
1194239627 X:91428589-91428611 TAGGTTTAAAGGACAAAGTAAGG + Intergenic
1197108682 X:122746281-122746303 TATGATTAATTTTCAAAGTATGG + Intergenic
1197144659 X:123158347-123158369 TAACAATAAATAGCAAAGTAGGG + Intergenic
1197986595 X:132272412-132272434 TTGGCTTAAAAGGCAAAGTAAGG - Intergenic
1199167620 X:144695969-144695991 GAGGATTAAAAGGCCAAGAATGG - Intergenic