ID: 916262599

View in Genome Browser
Species Human (GRCh38)
Location 1:162857358-162857380
Sequence CACCCTGTAGGGTTTGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916262599_916262604 27 Left 916262599 1:162857358-162857380 CCAGTCTCAAACCCTACAGGGTG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 916262604 1:162857408-162857430 GAAGCCATTCATGATTGGATTGG 0: 1
1: 0
2: 1
3: 5
4: 105
916262599_916262603 22 Left 916262599 1:162857358-162857380 CCAGTCTCAAACCCTACAGGGTG 0: 1
1: 0
2: 0
3: 10
4: 104
Right 916262603 1:162857403-162857425 CCTGTGAAGCCATTCATGATTGG 0: 1
1: 0
2: 1
3: 6
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916262599 Original CRISPR CACCCTGTAGGGTTTGAGAC TGG (reversed) Intronic
900410651 1:2511032-2511054 CAGCCTGCAGGGGCTGAGACTGG + Intronic
902279927 1:15366975-15366997 TATCCTGTAGGGTTTGGGATGGG - Intronic
904318252 1:29680002-29680024 CACCCTGCAGGGTCTGAAACAGG - Intergenic
907246890 1:53114468-53114490 CAGCCTGTAGGGTGGGAGGCTGG - Intronic
908013535 1:59808416-59808438 CACCTTGGAGGATTTAAGACAGG - Intergenic
908620724 1:65976257-65976279 CACCCTGCTGGATTTCAGACTGG + Intronic
909742232 1:79045018-79045040 CCCCCTACAGGGTTTGAGGCAGG + Intergenic
913048763 1:115096910-115096932 CACTCTGTAGGTATTGAAACTGG + Intergenic
915389466 1:155528499-155528521 CACCCTGCAGATTTTGGGACTGG - Intronic
916262599 1:162857358-162857380 CACCCTGTAGGGTTTGAGACTGG - Intronic
916577769 1:166082450-166082472 CACTCTGTGGGGGTTGAGGCAGG - Intronic
917609814 1:176676469-176676491 CACCATGTAAGTTTTGAGATTGG - Intronic
921376359 1:214477696-214477718 CACCCTACAGGGTTGCAGACAGG - Intronic
922582819 1:226711376-226711398 CACCCTCTAGGGCTGGAGGCAGG - Intronic
1064087219 10:12354251-12354273 CATCGTGGAGGATTTGAGACTGG + Intronic
1064615282 10:17147557-17147579 CACCCTGTGGGGATGGAGAATGG - Exonic
1066213512 10:33263696-33263718 CCCCCTGGAGGATTTGAGTCAGG + Exonic
1067664928 10:48269646-48269668 CACCCAGTGGGGTTTGTGACAGG - Intronic
1068825669 10:61435883-61435905 CATCCTGTAGGGTGGGGGACAGG + Intronic
1076568489 10:131414967-131414989 CAAGCTGCAGAGTTTGAGACTGG + Intergenic
1080739629 11:35051528-35051550 CACCCAACAGGGTTTGAGGCTGG - Intergenic
1081703588 11:45167084-45167106 CACCCTGCAGGGTTATAGAGAGG + Intronic
1083137975 11:60697575-60697597 CACTCTGGAGGTCTTGAGACAGG - Intergenic
1083168922 11:60910496-60910518 TACATTGGAGGGTTTGAGACAGG - Intergenic
1087306598 11:96496689-96496711 AACCCTGGAGGGTTTGGTACTGG + Intronic
1090118375 11:123998829-123998851 GTCCCTGTAGGGTGGGAGACAGG + Intergenic
1092002228 12:5042585-5042607 AACCCTGCAGGGGTTGAGACAGG + Intergenic
1095152919 12:38817135-38817157 AACTCTGTAGAGTTAGAGACTGG + Intronic
1095353252 12:41240346-41240368 CACCCATTATGTTTTGAGACAGG - Intronic
1096587549 12:52632615-52632637 CACTCTGCTGGTTTTGAGACGGG - Intergenic
1096708280 12:53436972-53436994 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1102579515 12:113877361-113877383 CTCCCTGTAGGGTCTGGGAGGGG - Intronic
1103917853 12:124385226-124385248 CATCCTGGAGGGCTTGAGGCAGG - Intronic
1104996012 12:132657135-132657157 CACCCTGGAGGGCAGGAGACAGG - Exonic
1106772105 13:32971561-32971583 CAACCTGTAGGGACTGAGCCTGG - Intergenic
1106992672 13:35440797-35440819 CACACTGTAGAGTAAGAGACTGG - Intronic
1107041718 13:35955729-35955751 TACCCTGTAGGGTTTCATGCAGG + Intronic
1114682955 14:24502317-24502339 CACCCTGTAGGGTTGGAAGTTGG + Intronic
1114984758 14:28212172-28212194 AACTCTGTAGGGTATTAGACTGG - Intergenic
1117264841 14:54076366-54076388 CACCCTGAAGGGAAGGAGACAGG - Intergenic
1118887174 14:69877292-69877314 AACCCTATGGGATTTGAGACTGG + Intronic
1124871286 15:33545540-33545562 AAGCGTGAAGGGTTTGAGACTGG + Intronic
1129234700 15:74217185-74217207 CAGCCTGCAGGCTTTCAGACTGG + Intergenic
1129759974 15:78123663-78123685 CACCCTGTTGGGACTGGGACTGG - Intronic
1131411296 15:92210293-92210315 CACCCAGTAGGGCTTGTTACCGG + Intergenic
1132259464 15:100409739-100409761 CACCCTGTAGGTTTTGTTACTGG + Intronic
1133387864 16:5385191-5385213 CACCCTGCAGGGTTACACACTGG + Intergenic
1134463388 16:14449790-14449812 CACCCACTAGGTTTTTAGACTGG + Intronic
1139732544 16:68959017-68959039 CACCCTGTAGGGTTCTACACAGG - Intronic
1140765046 16:78149774-78149796 GACCCTGTGGGGTGTGAGCCTGG + Intronic
1151966831 17:77435935-77435957 CACCGTTTAGGGCTTGAGGCAGG + Intronic
1157338782 18:46760041-46760063 CAGCCTGTAGGAGCTGAGACTGG + Intergenic
1163474231 19:17515727-17515749 GACCCTGGAGGCTTTGAAACAGG + Intronic
1165757432 19:38302361-38302383 CAGCCTGTGTGTTTTGAGACAGG + Intronic
1165872226 19:38981100-38981122 CTCCATGTAGGGTTTGTGGCTGG - Intergenic
926214597 2:10896768-10896790 TACCCTGAGTGGTTTGAGACTGG + Intergenic
927178303 2:20425559-20425581 CCCCCTGTAGGTTGTGAGATGGG + Intergenic
928326028 2:30320179-30320201 CACTCTGATGGGTTTGAGGCAGG + Intronic
929245941 2:39703705-39703727 TACCCTTGAGAGTTTGAGACTGG + Intronic
929654317 2:43715428-43715450 AACCCTGCAGGGTTTGTAACAGG + Intronic
930630578 2:53749699-53749721 CACCATATAGCCTTTGAGACTGG - Intronic
930702307 2:54470800-54470822 AACAGTGTGGGGTTTGAGACAGG - Intronic
934163852 2:89276370-89276392 CACACTGAAGGGTCTGAGCCCGG - Intergenic
934203420 2:89906154-89906176 CACACTGAAGGGTCTGAGCCCGG + Intergenic
934585945 2:95495361-95495383 AACTCTGTATGGTTTGAGATAGG + Intergenic
934586289 2:95499990-95500012 CACCCTGTATTCTTTGATACAGG - Intergenic
934593518 2:95581403-95581425 AACTCTGTATGGTTTGAGATAGG - Intergenic
937233232 2:120414345-120414367 CACTCTGTAGGAGTGGAGACAGG + Intergenic
938824860 2:134994610-134994632 CTGCCTGTAGGTTATGAGACTGG - Intronic
941009150 2:160278655-160278677 CACCCTGGGGAGTTGGAGACAGG + Exonic
943110700 2:183601745-183601767 CTCCATGTAGGGTTAGATACAGG + Intergenic
948623287 2:239250323-239250345 CCACCTGCAGGGTTAGAGACCGG - Intronic
1173648858 20:44650794-44650816 CAGCCAGTAGGGTGTGAGAGTGG - Intronic
1173675031 20:44825962-44825984 CACCCTGTTGGTTTTGTGCCTGG + Intergenic
1174369793 20:50078810-50078832 CACACTCTAGGATTTGAGACAGG + Intergenic
1178922759 21:36749493-36749515 CACCCTGTAGGGATTGTGTCAGG - Exonic
1182300154 22:29332676-29332698 CACCCTATGGGGTCTGACACAGG - Intronic
1183463454 22:37967080-37967102 CATCCTGTAGGGATAGGGACAGG - Exonic
1184537139 22:45094789-45094811 AACCCTGAAGGGTTTAAGACAGG - Intergenic
1184857513 22:47154531-47154553 CACGCTGTCGGGTTTGGGGCTGG - Intronic
1184904903 22:47475483-47475505 TACCCAGTAGGGTTTTACACAGG + Intronic
949843725 3:8349847-8349869 CACCCTGAATGGTCTAAGACAGG + Intergenic
966461346 3:180180269-180180291 CACCCTGGAGGGCTTGAGGAAGG + Intergenic
969279132 4:6157775-6157797 CACCCAGTAGGGTGTGAGTGAGG + Intronic
973571398 4:52243298-52243320 CACCATGTTGGGTATGAGGCAGG - Intergenic
975138236 4:70895083-70895105 CACCCTGCAGGGTTCCAGAAAGG + Intergenic
981923752 4:150116187-150116209 CACCCTGAAGGGTTCTAGAAGGG + Intronic
984239491 4:177200523-177200545 CACCCTGCAGAGCTTGGGACTGG - Intergenic
985629362 5:1006770-1006792 CACCCTGTAGGGTGTGGGGTTGG + Intergenic
987204181 5:15608275-15608297 CAACCTGCAGGGTTTGGGAGAGG - Intronic
988260765 5:28883496-28883518 CACCCTGAAGTGTTTCAGAAAGG - Intergenic
1000428459 5:161120532-161120554 GACACTGAAGGGTTTGAAACAGG - Intergenic
1002286924 5:178169548-178169570 CACCCTGTACTATCTGAGACTGG - Intergenic
1003592604 6:7448386-7448408 CAGCCTGTTGGGTTGGAGTCAGG + Intergenic
1005078140 6:21928710-21928732 TACCCTGGAGGATTTGAGGCAGG - Intergenic
1006575972 6:35046288-35046310 CACCCAGAAGGCTTTGTGACAGG + Intronic
1009469697 6:64017219-64017241 CACCCTGTAGTGTTGGTGGCAGG + Intronic
1010758569 6:79695649-79695671 CAGCCTGCCGGGTTAGAGACTGG - Intronic
1013549727 6:111195650-111195672 CAATGTGTAGTGTTTGAGACTGG + Intronic
1015249359 6:131110781-131110803 CATCCTGTAGGGCTTCACACTGG + Intergenic
1015931011 6:138359901-138359923 CATCCTGTGGTGTTTGAGAAGGG + Intergenic
1020331379 7:7020510-7020532 AACCCTGAAGTGTGTGAGACAGG + Intergenic
1023182230 7:37496452-37496474 CAGCCTGTTTGTTTTGAGACAGG + Intergenic
1023847065 7:44128334-44128356 CACCCTGTAGGGTTGGTTACAGG + Intergenic
1029401533 7:100350022-100350044 CCCCCAGCAGGGTGTGAGACTGG - Intronic
1030255443 7:107505489-107505511 CACCCTGAAGTGTTTCAGAGAGG + Intronic
1036590429 8:10163275-10163297 CACGCTGTAGGATTTGAAGCAGG + Intronic
1042166060 8:65947393-65947415 CAGGCTGTAGAGTGTGAGACTGG - Intergenic
1044568933 8:93696775-93696797 CACCCTGTTTGCTTTCAGACAGG + Intergenic
1048317098 8:133370411-133370433 GACCCTGTGAGGTTGGAGACTGG - Intergenic
1052219447 9:26001742-26001764 CACCATGTAGGTTTTAAGCCTGG + Intergenic
1185445738 X:257169-257191 CACCCTGCCTGGCTTGAGACAGG - Intergenic
1188366888 X:29327015-29327037 CAACCTCTAGGGTTTGAGAGGGG - Intronic
1192836205 X:74802139-74802161 CACCCTGAAGGGTAGGACACAGG + Intronic
1199545990 X:149007861-149007883 AACCCTCTAGGGCTGGAGACAGG - Intergenic