ID: 916263834

View in Genome Browser
Species Human (GRCh38)
Location 1:162869626-162869648
Sequence CTATGGATGTAACTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916263834_916263843 5 Left 916263834 1:162869626-162869648 CCCACAGGAAGTTACATCCATAG 0: 1
1: 0
2: 3
3: 16
4: 112
Right 916263843 1:162869654-162869676 GGGGGAGAGTACTACATCAAGGG 0: 134
1: 262
2: 276
3: 337
4: 391
916263834_916263842 4 Left 916263834 1:162869626-162869648 CCCACAGGAAGTTACATCCATAG 0: 1
1: 0
2: 3
3: 16
4: 112
Right 916263842 1:162869653-162869675 AGGGGGAGAGTACTACATCAAGG 0: 147
1: 255
2: 284
3: 328
4: 428

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916263834 Original CRISPR CTATGGATGTAACTTCCTGT GGG (reversed) Intergenic
906437393 1:45808204-45808226 CCATGGATATAATTTCATGTTGG - Intronic
907090436 1:51719530-51719552 CTCAGGATGTTACATCCTGTAGG + Intronic
908485534 1:64588742-64588764 CTATAGACGTTACTACCTGTTGG + Intronic
914387004 1:147179485-147179507 CTTTGGATTTAGCTTCTTGTTGG - Intronic
916263834 1:162869626-162869648 CTATGGATGTAACTTCCTGTGGG - Intergenic
918734375 1:188039425-188039447 CTCTGCATGTAACTTCTAGTGGG - Intergenic
922368938 1:224890631-224890653 ATATGGATGTACCTTCTTGTTGG + Intergenic
923928575 1:238664984-238665006 CTATGCTTGTAACTTTCTGTAGG - Intergenic
924321337 1:242854373-242854395 CTATGGATGTGGTTTCCTGAGGG + Intergenic
1063000050 10:1908759-1908781 CTAAGTATGGAATTTCCTGTGGG + Intergenic
1063930894 10:11027607-11027629 TCATGGAAGTAACTTCCTCTTGG + Intronic
1064288205 10:14011169-14011191 CAATGGATGTATCTTCCTTTGGG - Intronic
1070145361 10:73769946-73769968 CCATGGAGGTAACTAGCTGTCGG - Exonic
1072281720 10:93871607-93871629 TTATGGATGTGACTTCCTCCAGG - Intergenic
1074467875 10:113699484-113699506 CTATGGATGTAGATTCCACTGGG - Intronic
1075517407 10:123119705-123119727 CAATGGAAGTAGCTTCCTCTTGG - Intergenic
1078004779 11:7524416-7524438 CTGTGGAAGAAACTTTCTGTGGG - Intronic
1078896620 11:15602534-15602556 CTATTAAGGAAACTTCCTGTAGG - Intergenic
1079643694 11:22836865-22836887 TTATAGATGTAACTCCCTGCTGG + Intergenic
1080285725 11:30608802-30608824 TTATGGATCTAACTTCCAATAGG + Intergenic
1080402375 11:31947807-31947829 CTATGGATGTGGCTTCCTGTGGG - Intronic
1085706652 11:78792491-78792513 CTATGGGTTTGACTTTCTGTAGG - Intronic
1093181593 12:15972862-15972884 CTATCGATGCAAGTTCCTGCTGG + Intronic
1097763602 12:63497536-63497558 CTATGGATATAAGTTCTTGCTGG + Intergenic
1099077831 12:78133785-78133807 CTTTGGATGAAACTTCATTTGGG + Intronic
1101746572 12:107546257-107546279 CTATTGATCTAAGTTCCTATGGG + Intronic
1105476143 13:20729710-20729732 CTGTGGATGCCACCTCCTGTGGG - Intronic
1108905757 13:55469864-55469886 CTATGGATGCAACCAACTGTGGG - Intergenic
1109148844 13:58818084-58818106 TTGTCGATGTAACTTCCAGTGGG - Intergenic
1109920431 13:69051107-69051129 CTATGGATGTCATTACCTGTGGG - Intergenic
1110335590 13:74326716-74326738 CTCCCCATGTAACTTCCTGTAGG - Intergenic
1115350568 14:32390571-32390593 CTATGGATGTGGCTTCCTGAGGG + Intronic
1116346782 14:43803711-43803733 CTATAGATGTGGCTTCCTGAGGG - Intergenic
1117240486 14:53827542-53827564 CCAAGGATGTAAATTCTTGTAGG - Intergenic
1122330245 14:100907077-100907099 CTATGCATGTATCTTGATGTAGG - Intergenic
1124398489 15:29327825-29327847 CAATGGATAAAAATTCCTGTTGG - Intronic
1125302223 15:38268313-38268335 CTAAGGATGTACCTCCGTGTTGG - Intronic
1125953091 15:43770549-43770571 CTTTGGATTTAGCTTCTTGTTGG - Exonic
1129960186 15:79677225-79677247 TTATTGATGTAGCTCCCTGTAGG - Intergenic
1130243712 15:82222814-82222836 CCATGGATGTTACTTCTTGAAGG + Intronic
1130456763 15:84118461-84118483 CCATGGATGTTACTTCCTGAAGG - Intergenic
1134867089 16:17618167-17618189 CTATGTTTTTCACTTCCTGTTGG - Intergenic
1140430044 16:74895083-74895105 CAATGCATGTAACTTCCTATAGG + Intronic
1148331450 17:46816363-46816385 CTATGGATGTGAAATCGTGTGGG - Intronic
1149121024 17:53164967-53164989 CAATGTATGAAAATTCCTGTTGG - Intergenic
1151465562 17:74282673-74282695 CTCTGGCTGGAACTTTCTGTGGG - Intronic
1152989675 18:351338-351360 CTCTGCTTGTCACTTCCTGTGGG + Intronic
1154390257 18:13930893-13930915 GCATGGATGTAACATCATGTGGG + Intergenic
1156782034 18:40862042-40862064 GTATGTCTGTACCTTCCTGTTGG + Intergenic
1157712682 18:49860720-49860742 ATATGAGTGTAACTTCCTCTAGG + Intronic
1163998241 19:21072618-21072640 CCACAGATGTAACTTCCTGTTGG + Intergenic
925877757 2:8327474-8327496 GTATGGGTGTCACTGCCTGTGGG - Intergenic
926831852 2:16971765-16971787 CTATGAAGATACCTTCCTGTGGG + Intergenic
932438446 2:71716893-71716915 CTCTGGATATCACTTCCTTTGGG + Intergenic
933556939 2:83842367-83842389 TTATGGTTGTATCTTCCTGATGG - Intergenic
934954460 2:98605950-98605972 GTAAGGATGTAAATTCCAGTGGG - Intronic
939904898 2:147900362-147900384 TTATGGAGGTATCTTCCTGAAGG - Intronic
942175719 2:173332552-173332574 CTATTTATGTGCCTTCCTGTGGG + Intergenic
943514819 2:188871508-188871530 TTATGGATATAACATACTGTTGG - Intergenic
943744407 2:191446534-191446556 CTCTGGATTCAGCTTCCTGTTGG + Intergenic
1170580407 20:17694998-17695020 CTCAGGAAGTAACTTCCTTTAGG + Intronic
1170649236 20:18224915-18224937 CTTTGTATGCAACTTCCTATTGG + Intergenic
1173958241 20:47051391-47051413 CTATGAATGAACCTTCCAGTAGG + Intronic
1174444268 20:50580006-50580028 CTGTGGATGCAGCCTCCTGTTGG + Intronic
1177122734 21:17157956-17157978 GTATGGAAATAAATTCCTGTAGG + Intergenic
1177181178 21:17746184-17746206 ATAAGGATGTTCCTTCCTGTGGG + Intergenic
1178462576 21:32816447-32816469 CTGTGGCACTAACTTCCTGTTGG + Intergenic
1179084126 21:38202704-38202726 CTAGGGATGTGGCTTCCTGAGGG + Intronic
1179723145 21:43326809-43326831 CTTTAGATCTAAATTCCTGTTGG + Intergenic
1181601001 22:23951863-23951885 CTATGGATGGAACTGGCTGGGGG + Intergenic
1181607508 22:23989463-23989485 CTATGGATGGAACTGGCTGGGGG - Intergenic
1184350840 22:43943165-43943187 TTATGGATGTAACATTCTCTTGG + Intronic
949253176 3:2012498-2012520 CTATGCATGTTTCTTCCTTTCGG + Intergenic
951179540 3:19643179-19643201 CTATTTCTGTTACTTCCTGTGGG + Intergenic
951183870 3:19689223-19689245 CTATGGATGTGGCTTCCTGAGGG - Intergenic
953118776 3:40018745-40018767 CTATGGAAGTAACCTCTTTTTGG - Intronic
953443191 3:42937312-42937334 CTATGGAAGTGTCTTCCTATGGG - Exonic
957568929 3:81920887-81920909 CAAAGCATGTTACTTCCTGTTGG - Intergenic
957970976 3:87381478-87381500 TTATGGATGTGACTTCCTCGTGG - Intergenic
958535467 3:95397895-95397917 TTATGTATGTACCTACCTGTTGG + Intergenic
959722223 3:109505094-109505116 CTATGGATGTGGCTTCCTGTGGG + Intergenic
959802447 3:110511905-110511927 CTATGGATGTGGCTATCTGTGGG + Intergenic
962632283 3:137290659-137290681 CTATGAAAATGACTTCCTGTAGG - Intergenic
964448997 3:156791884-156791906 CTGTGGATGTGACTTCCTCCAGG - Intergenic
964716950 3:159732597-159732619 GGATGCATCTAACTTCCTGTGGG + Intronic
965622110 3:170652119-170652141 CCCTGAATGTAACTTCCTTTTGG - Intronic
970819459 4:20196149-20196171 ATATGGACGTACCTTCCTGTTGG + Intergenic
972421791 4:38894404-38894426 CTAGAGAGGTAAATTCCTGTAGG + Intronic
973179506 4:47251169-47251191 CTATGGATGTGGTTTCTTGTGGG + Intronic
974122804 4:57660410-57660432 CTCTGGAGGTAACTCCCTGATGG + Intergenic
976640527 4:87333097-87333119 CTATGGGTGTCACTGCATGTGGG + Intergenic
983250991 4:165346289-165346311 CTTTGGATGTATTTTTCTGTGGG - Intergenic
984631866 4:182069656-182069678 CTATGTATGTATTTTCCTGAGGG - Intergenic
990311336 5:54541753-54541775 ATATGGATGAAATTTGCTGTTGG + Intronic
993638831 5:90378146-90378168 CAATAGATTTAACTTCCTGTGGG - Intergenic
995536811 5:113144711-113144733 GTATTTATGTAACTTCCTGGGGG + Intronic
997157798 5:131577436-131577458 ATATGGATGTACCTTCTTGTTGG + Intronic
1005233259 6:23729539-23729561 CAATGAATGAAAGTTCCTGTTGG - Intergenic
1005760345 6:28961692-28961714 CTATGGATGTGGCTTCCTGAGGG - Intergenic
1009389626 6:63130390-63130412 CTAAGGATGGAGCTTCCTGAGGG + Intergenic
1011168701 6:84479900-84479922 CTATGGATGTGGCTTCCTGTGGG - Intergenic
1017530604 6:155288151-155288173 ATATGGAAGAAACTTCCTATGGG + Intronic
1020678502 7:11208059-11208081 CTATGCATGTAACTTCTTTTTGG + Intergenic
1021527452 7:21604768-21604790 TCATGGATGTAACTTCCTCCTGG + Intronic
1023148504 7:37176981-37177003 CTGTAGATGTATCTTCCAGTGGG + Intronic
1024628841 7:51231073-51231095 CAATGTATTTAACTTCCTTTGGG + Intronic
1027440822 7:78217311-78217333 CTATGGGTTTAATTTCCTGAGGG + Intronic
1033266040 7:139888063-139888085 CTTTGCCTGTAACTTCCTTTTGG + Intronic
1033729270 7:144158574-144158596 GTGTTGATGTAACTTTCTGTTGG - Intergenic
1033898810 7:146110644-146110666 CTATGTCTGTGACTTCCTCTTGG - Intergenic
1035151298 7:156874714-156874736 CTAAGGATGTGGCTTCCTGAGGG - Intronic
1035943209 8:3928126-3928148 CTATAGATTTAATTGCCTGTTGG + Intronic
1037552986 8:19992982-19993004 CTGTGGATGTAATTTCCTGCAGG + Intergenic
1038227053 8:25667293-25667315 CTATGGATGTGCCTTCCTCCAGG + Intergenic
1039329450 8:36521131-36521153 CTATGTAACTAACTGCCTGTGGG - Intergenic
1039583060 8:38682674-38682696 CGATGAATGTCATTTCCTGTTGG + Intergenic
1041942455 8:63403603-63403625 CTGTGGATGTCACTTCCTCCAGG - Intergenic
1043181062 8:77087288-77087310 CTATGCTTGTAAGTTCCTGGAGG - Intergenic
1051654993 9:19371525-19371547 CTATTTTTGTAACTTCCTGCAGG - Intronic
1053511598 9:38692711-38692733 GTGTGCATGTAACTTCGTGTAGG - Intergenic
1055008594 9:71537587-71537609 TCATGCATGTAACTTCCTTTTGG + Intergenic
1055770650 9:79713744-79713766 CAATGGATATAAAATCCTGTAGG - Intronic
1056195494 9:84224734-84224756 CTATGGGTGTGACTTCCTCCAGG + Intergenic
1060952969 9:127616558-127616580 CCATTGATGTAACCTCCTGAGGG - Intronic
1061402898 9:130378161-130378183 CAATGGTTGAAACTGCCTGTGGG + Intronic
1186307023 X:8272762-8272784 CTATGTATATAACTTCTTCTGGG + Intergenic
1186318648 X:8399635-8399657 CTGTGGATGGAAATTCCTGACGG + Intergenic
1197463481 X:126772097-126772119 CTAGGGATGTGGCTTCCTGAGGG - Intergenic
1198287789 X:135209708-135209730 CTATGGCTGCAGCTTCCTGTCGG + Intergenic
1199606099 X:149580781-149580803 TTATTGACGAAACTTCCTGTTGG - Intergenic
1199633022 X:149788587-149788609 TTATTGACGAAACTTCCTGTTGG + Intergenic
1200089244 X:153626626-153626648 ATATGGATGTATCTTTCAGTGGG - Intergenic