ID: 916263834

View in Genome Browser
Species Human (GRCh38)
Location 1:162869626-162869648
Sequence CTATGGATGTAACTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916263834_916263842 4 Left 916263834 1:162869626-162869648 CCCACAGGAAGTTACATCCATAG No data
Right 916263842 1:162869653-162869675 AGGGGGAGAGTACTACATCAAGG No data
916263834_916263843 5 Left 916263834 1:162869626-162869648 CCCACAGGAAGTTACATCCATAG No data
Right 916263843 1:162869654-162869676 GGGGGAGAGTACTACATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916263834 Original CRISPR CTATGGATGTAACTTCCTGT GGG (reversed) Intergenic