ID: 916273890

View in Genome Browser
Species Human (GRCh38)
Location 1:162972670-162972692
Sequence CGTCTCTGCTCCTCAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916273890_916273894 21 Left 916273890 1:162972670-162972692 CCTGCAGCTGAGGAGCAGAGACG No data
Right 916273894 1:162972714-162972736 TCAACCTCTTTCGAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916273890 Original CRISPR CGTCTCTGCTCCTCAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr