ID: 916275975

View in Genome Browser
Species Human (GRCh38)
Location 1:162993762-162993784
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275975_916275984 28 Left 916275975 1:162993762-162993784 CCTCCTTCCAGCCCAAACATCCC No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data
916275975_916275982 -1 Left 916275975 1:162993762-162993784 CCTCCTTCCAGCCCAAACATCCC No data
Right 916275982 1:162993784-162993806 CAGTTTCTTTCCGTAATAAAAGG No data
916275975_916275986 30 Left 916275975 1:162993762-162993784 CCTCCTTCCAGCCCAAACATCCC No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275975_916275985 29 Left 916275975 1:162993762-162993784 CCTCCTTCCAGCCCAAACATCCC No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275975 Original CRISPR GGGATGTTTGGGCTGGAAGG AGG (reversed) Intergenic
No off target data available for this crispr