ID: 916275978

View in Genome Browser
Species Human (GRCh38)
Location 1:162993773-162993795
Sequence GGAAAGAAACTGGGATGTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
916275978_916275985 18 Left 916275978 1:162993773-162993795 CCCAAACATCCCAGTTTCTTTCC No data
Right 916275985 1:162993814-162993836 TCTCCCCCTCAAAGAGCTTAGGG No data
916275978_916275986 19 Left 916275978 1:162993773-162993795 CCCAAACATCCCAGTTTCTTTCC No data
Right 916275986 1:162993815-162993837 CTCCCCCTCAAAGAGCTTAGGGG No data
916275978_916275984 17 Left 916275978 1:162993773-162993795 CCCAAACATCCCAGTTTCTTTCC No data
Right 916275984 1:162993813-162993835 ATCTCCCCCTCAAAGAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
916275978 Original CRISPR GGAAAGAAACTGGGATGTTT GGG (reversed) Intergenic
No off target data available for this crispr